The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018757	Bifidobacterium bifidum strain PRI 1 chromosome, complete genome	2243572	1135219	1218704	2243572	integrase,transposase,holin,tRNA	Escherichia_phage(30.0%)	58	1192001:1192023	1221471:1221493
WP_047271350.1|1135219_1136359_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	41.1	2.9e-70
WP_047271972.1|1136538_1137414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047271348.1|1137526_1137997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271346.1|1138012_1138411_-	ImmA/IrrE family metallo-endopeptidase	NA	I3NLD5	Bifidobacterium_phage	46.2	2.0e-26
WP_047271344.1|1138388_1139291_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	46.4	6.9e-67
WP_047271343.1|1139302_1139638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047297658.1|1139793_1140021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157829222.1|1140020_1140332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015439062.1|1140313_1141093_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_047271245.1|1141089_1142589_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.6	1.8e-11
WP_003815054.1|1143220_1144567_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_101357197.1|1144670_1145471_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013362847.1|1145524_1145959_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_047271197.1|1146333_1149831_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_047271200.1|1150601_1152938_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_047271202.1|1153409_1154462_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.1	2.5e-15
WP_047271203.1|1154791_1155241_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_003817396.1|1155364_1155637_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_013389335.1|1155702_1157220_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_013389336.1|1157505_1158246_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003815072.1|1158433_1158913_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_047271205.1|1159353_1160427_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_013389338.1|1160462_1161815_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_101357198.1|1161993_1162542_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_047271207.1|1162685_1163369_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003817384.1|1163651_1164215_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_047271208.1|1164556_1166470_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	36.2	2.4e-48
WP_014759670.1|1168546_1171303_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_082247834.1|1171734_1173714_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_047271210.1|1173786_1174878_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_047271211.1|1175451_1176471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047271213.1|1176946_1178044_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_047271214.1|1178184_1178565_+	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_047271923.1|1180199_1181225_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.7	3.2e-76
WP_047271216.1|1181236_1181452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271218.1|1181567_1184171_+	1,4-beta-N-acetylmuramidase	NA	A0A1U9WQS3	Geobacillus_phage	30.4	7.2e-16
WP_047297650.1|1184224_1185196_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	48.2	2.9e-79
WP_080588994.1|1186943_1187504_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.6	1.4e-33
WP_015439062.1|1187904_1188684_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_047271245.1|1188680_1190180_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.6	1.8e-11
1192001:1192023	attL	GCATTGGAGTCCCGAGCAGATCG	NA	NA	NA	NA
WP_082247907.1|1193222_1194941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047271226.1|1196826_1197897_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_047271228.1|1197960_1199832_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_047271927.1|1199979_1201071_+|holin	phosphorylcholine metabolism protein	holin	V5LSD6	Emiliania_huxleyi_virus	47.5	1.3e-06
WP_082247908.1|1201089_1201833_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_082247909.1|1201848_1202916_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_101357258.1|1202996_1203821_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047297697.1|1203820_1205080_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.4e-09
WP_047271234.1|1205142_1207140_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_101357199.1|1207232_1208411_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.9	2.8e-92
WP_082247910.1|1208469_1209105_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_047271237.1|1209108_1210863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101357259.1|1211024_1212050_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.1	1.2e-78
WP_047271241.1|1212388_1213660_-	MFS transporter	NA	NA	NA	NA	NA
WP_047271933.1|1213816_1214479_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015439062.1|1214987_1215767_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_047271245.1|1215763_1217263_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.6	1.8e-11
WP_047271246.1|1217456_1218704_+|integrase	tyrosine-type recombinase/integrase	integrase	I3NLE2	Bifidobacterium_phage	44.4	6.8e-89
1221471:1221493	attR	CGATCTGCTCGGGACTCCAATGC	NA	NA	NA	NA
>prophage 2
NZ_CP018757	Bifidobacterium bifidum strain PRI 1 chromosome, complete genome	2243572	1235839	1302656	2243572	protease,portal,tRNA,capsid,terminase	Bifidobacterium_phage(27.78%)	62	NA	NA
WP_047271262.1|1235839_1236625_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_047271264.1|1237578_1238907_+	DNA methyltransferase	NA	NA	NA	NA	NA
WP_003816157.1|1239032_1239488_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_003816156.1|1239565_1240354_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_047271266.1|1240350_1241580_+	class E sortase	NA	NA	NA	NA	NA
WP_003811402.1|1241675_1242320_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	40.7	1.3e-35
WP_047271268.1|1242552_1244619_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8JE84	Murine_leukemia_virus	31.8	2.0e-16
WP_003816154.1|1244621_1245605_-	serine/threonine protein kinase	NA	T2AWK4	Cannes_8_virus	29.9	2.2e-18
WP_003820732.1|1245601_1247068_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003811411.1|1247064_1248543_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_101357203.1|1248539_1250198_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003811415.1|1250204_1250747_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003811419.1|1250774_1251476_-	DUF3662 domain-containing protein	NA	NA	NA	NA	NA
WP_047271939.1|1251716_1254248_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_052773296.1|1254472_1257298_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_047271272.1|1257294_1259622_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003816148.1|1259774_1260830_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_101357261.1|1260889_1261843_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047271275.1|1262108_1262864_+	DUF1109 domain-containing protein	NA	NA	NA	NA	NA
WP_047271276.1|1262942_1263443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047271942.1|1263544_1264549_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_101357205.1|1265403_1268589_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	26.0	1.7e-19
WP_017143690.1|1268585_1269101_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_082247839.1|1269251_1269689_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_080959301.1|1269722_1270043_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003811449.1|1270085_1270418_+	putative heavy metal-binding protein	NA	NA	NA	NA	NA
WP_047271282.1|1270539_1271358_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080999910.1|1271354_1271852_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013389403.1|1272486_1273788_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	32.4	2.8e-53
WP_047271284.1|1274155_1276057_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.8	1.1e-13
WP_047271287.1|1276435_1278628_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.5	7.9e-40
WP_047271288.1|1278797_1280249_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047271290.1|1280420_1281359_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_017143391.1|1281950_1282094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101357206.1|1282090_1282285_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047271292.1|1282343_1283159_-	CHAP domain-containing protein	NA	I3NL82	Bifidobacterium_phage	93.8	5.4e-127
WP_003813084.1|1283142_1283568_-	hypothetical protein	NA	I3NL83	Bifidobacterium_phage	98.6	1.6e-66
WP_047271294.1|1283579_1283798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047284901.1|1283794_1284202_-	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	98.5	6.7e-70
WP_157829223.1|1284405_1284558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047271296.1|1284658_1285495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271298.1|1285496_1285730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271945.1|1285740_1287390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047297655.1|1287380_1288205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052773297.1|1288191_1290990_-	tape measure domain-containing protein	NA	A0A1P8BLL5	Lactococcus_phage	32.0	2.2e-47
WP_082247843.1|1291002_1291380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271301.1|1291427_1291793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271303.1|1292576_1292954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271305.1|1292953_1293241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271307.1|1293240_1293579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052773299.1|1293575_1293983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082247844.1|1293999_1294437_-	hypothetical protein	NA	I3NL98	Bifidobacterium_phage	48.9	4.7e-21
WP_082247845.1|1294436_1295396_-|capsid	phage major capsid protein	capsid	I3NL99	Bifidobacterium_phage	57.5	2.6e-96
WP_052773300.1|1295421_1295955_-	helicase	NA	NA	NA	NA	NA
WP_133239685.1|1295979_1296807_-	hypothetical protein	NA	A0A1D8EU00	Propionibacterium_phage	39.1	3.5e-41
WP_101357207.1|1296694_1298230_-|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	41.1	7.8e-87
WP_082247846.1|1298229_1299594_-|terminase	terminase	terminase	A0A0S1S2I3	Propionibacterium_phage	41.8	8.2e-88
WP_052773303.1|1299664_1300039_-	hypothetical protein	NA	F8S0R2	Gordonia_phage	32.6	2.2e-06
WP_157829224.1|1300307_1300685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052773304.1|1300859_1301477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052773459.1|1301466_1302159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047271312.1|1302155_1302656_-	hypothetical protein	NA	A0A0A0RKU9	Mycobacterium_phage	43.5	7.5e-23
