The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	554973	607697	5146765	terminase,tRNA,portal,tail,holin,integrase,protease	Enterobacteria_phage(32.14%)	65	565784:565798	610071:610085
WP_000912345.1|554973_556359_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|556394_556916_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|557023_557236_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|557237_558104_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001298992.1|558466_559630_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_077462013.1|559485_559941_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	84.0	4.0e-63
WP_000206737.1|559856_560162_-	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_001242749.1|560161_560524_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|560514_561051_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|561178_562003_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|562068_562431_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|563117_563792_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|563882_564083_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|564126_564678_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_021524652.1|564674_565511_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	98.9	1.4e-151
WP_024186770.1|565515_565740_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	89.2	1.0e-32
WP_000995577.1|565736_566036_+	hypothetical protein	NA	NA	NA	NA	NA
565784:565798	attL	TCAGCGCCTGATTAT	NA	NA	NA	NA
WP_101356868.1|566032_567028_+	replication protein	NA	Q8SBF1	Shigella_phage	87.9	8.5e-50
WP_021524670.1|567024_567519_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_021531977.1|567518_568172_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_021524668.1|568168_568495_+	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	2.7e-53
WP_101356869.1|568491_568881_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	97.7	3.9e-67
WP_021531991.1|568900_569698_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_001223333.1|569713_570229_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_021524665.1|570238_571228_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	4.4e-192
WP_001204806.1|571245_571626_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_077462104.1|571723_572056_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.0e-48
WP_001304601.1|574941_575124_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_021545054.1|575161_575407_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_000284510.1|575483_575699_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001037012.1|575703_576594_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.6	6.1e-108
WP_001092866.1|576630_577164_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_122986666.1|577682_577868_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	7.1e-19
WP_016236020.1|578382_578859_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_050019234.1|578855_580979_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.6	0.0e+00
WP_000102415.1|580975_581188_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_016236019.1|581187_582690_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	4.5e-289
WP_128958825.1|582679_584659_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	99.4	0.0e+00
WP_001097059.1|584746_585073_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_001281346.1|585065_585347_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_016236016.1|585349_585973_+	hypothetical protein	NA	S5MBY4	Escherichia_phage	98.1	4.7e-99
WP_000682708.1|585985_586384_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_016234254.1|586391_587138_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
WP_016236015.1|587156_587588_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
WP_000533397.1|587614_588019_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	6.9e-43
WP_021524658.1|588008_590621_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|590617_590947_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021524657.1|590946_591645_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_001528990.1|591655_592399_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	3.7e-143
WP_077792027.1|592344_592977_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	7.1e-103
WP_101356870.1|593227_596920_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.6	0.0e+00
WP_101356871.1|596987_597587_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.5	1.5e-102
WP_101356872.1|597651_599715_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	1.2e-151
WP_001204581.1|599711_599990_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355700.1|599999_600293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|600332_600431_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000742376.1|600485_601142_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937499.1|601210_601516_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226381.1|601699_603184_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201822.1|603370_604324_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001331488.1|604798_605107_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_001304815.1|605126_605426_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
WP_000259980.1|605483_605789_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
WP_000239877.1|605843_606512_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201816.1|606743_607697_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
610071:610085	attR	TCAGCGCCTGATTAT	NA	NA	NA	NA
>prophage 2
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	806189	866256	5146765	terminase,head,coat,portal,lysis,holin,integrase	Enterobacteria_phage(63.16%)	84	815772:815790	855196:855214
WP_101356880.1|806189_807260_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	9.6e-201
WP_001303849.1|807237_807456_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_101357007.1|807571_807916_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	98.2	5.0e-58
WP_000545736.1|807942_808110_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	3.7e-27
WP_101356881.1|808182_808467_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	94.7	7.2e-47
WP_101356882.1|808459_809008_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	50.6	2.2e-36
WP_101356883.1|809009_809753_-	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	57.3	6.4e-26
WP_048943238.1|809739_810057_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	93.0	4.7e-47
WP_101356884.1|810053_810650_-	hypothetical protein	NA	G8EYH3	Enterobacteria_phage	54.3	4.7e-40
WP_101356885.1|810646_810811_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	3.2e-23
WP_094319198.1|810821_811118_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	1.7e-51
WP_101356886.1|811141_811525_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	1.9e-66
WP_101356887.1|811524_812130_-	ERF family protein	NA	A5VWA8	Enterobacteria_phage	99.5	3.2e-108
WP_014532157.1|812386_812662_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_072658121.1|812962_813355_-	antitermination N domain protein	NA	K7P6R2	Enterobacteria_phage	99.2	7.4e-58
WP_012817806.1|813357_813630_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_000394871.1|814357_814654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092875.1|814694_815369_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	84.4	5.3e-104
WP_001054987.1|815513_815738_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
815772:815790	attL	TCCCGCCGAAATGCGGGAA	NA	NA	NA	NA
WP_000251072.1|815847_816141_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|816163_816436_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_001350936.1|816438_817386_+	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
WP_001248388.1|817382_818759_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000229808.1|818831_819038_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_000814617.1|819667_820078_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_001254264.1|820074_820251_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000177653.1|820247_820673_+	DUF2591 domain-containing protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_000950973.1|820665_820842_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_001004257.1|820834_821557_+	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000002243.1|821556_821847_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008200.1|821843_822206_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994515.1|822202_822391_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235461.1|822387_823011_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|823598_823922_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001519603.1|823905_824382_+	glycoside hydrolase family protein	NA	Q716B5	Shigella_phage	99.4	1.7e-88
WP_101356889.1|824378_824846_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	3.0e-74
WP_001139680.1|824833_824986_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_101356890.1|825191_825722_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	94.9	9.9e-90
WP_000999679.1|825909_826281_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	90.2	2.0e-57
WP_000807788.1|826384_826627_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113731.1|826629_827070_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000200779.1|827066_828482_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000818371.1|828483_830682_+|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000372589.1|830772_831666_+	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000370106.1|831684_832938_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_001389518.1|832979_833168_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|833148_833610_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001122367.1|833619_835038_+	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_000785531.1|835037_835739_+	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_000627629.1|835738_836194_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_101356891.1|836196_836889_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.7	1.1e-109
WP_101356892.1|836898_838305_+	acyltransferase	NA	I6RSG0	Salmonella_phage	55.4	1.4e-127
WP_101356893.1|838304_840143_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.2	3.1e-247
WP_053270946.1|840160_840610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101356894.1|840785_841352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101356895.1|841360_841810_+	hypothetical protein	NA	G8C7Q9	Escherichia_phage	59.6	1.5e-43
WP_021522817.1|841846_842104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101356896.1|842787_845733_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.2	0.0e+00
WP_101356880.1|847353_848424_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	9.6e-201
WP_001303849.1|848401_848620_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_101357007.1|848735_849080_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	98.2	5.0e-58
WP_000545736.1|849106_849274_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	3.7e-27
WP_101356881.1|849346_849631_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	94.7	7.2e-47
WP_101356882.1|849623_850172_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	50.6	2.2e-36
WP_101356897.1|850441_850918_-	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	57.3	4.1e-26
WP_048943238.1|850904_851222_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	93.0	4.7e-47
WP_101356884.1|851218_851815_-	hypothetical protein	NA	G8EYH3	Enterobacteria_phage	54.3	4.7e-40
WP_101356885.1|851811_851976_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	3.2e-23
WP_094319198.1|851986_852283_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	1.7e-51
WP_101356886.1|852306_852690_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	1.9e-66
WP_101356887.1|852689_853295_-	ERF family protein	NA	A5VWA8	Enterobacteria_phage	99.5	3.2e-108
WP_014532157.1|853551_853827_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_072658121.1|854127_854520_-	antitermination N domain protein	NA	K7P6R2	Enterobacteria_phage	99.2	7.4e-58
WP_012817806.1|854522_854795_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_000394871.1|855522_855819_-	hypothetical protein	NA	NA	NA	NA	NA
855196:855214	attR	TTCCCGCATTTCGGCGGGA	NA	NA	NA	NA
WP_000092875.1|855859_856534_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	84.4	5.3e-104
WP_001054987.1|856678_856903_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000251072.1|857012_857306_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_101356893.1|858827_860666_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.2	3.1e-247
WP_053270946.1|860683_861133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101356894.1|861308_861875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101356895.1|861883_862333_+	hypothetical protein	NA	G8C7Q9	Escherichia_phage	59.6	1.5e-43
WP_021522817.1|862369_862627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101356896.1|863310_866256_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.2	0.0e+00
>prophage 3
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	946624	1021730	5146765	capsid,plate,terminase,head,portal,tail,lysis,integrase,protease	Salmonella_phage(63.46%)	79	946524:946550	979638:979664
946524:946550	attL	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290937.1|946624_947677_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000866326.1|947755_948127_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	54.8	5.6e-31
WP_021570730.1|948104_949175_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.5	4.2e-71
WP_000130914.1|949177_949960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009008398.1|949960_950860_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.1	2.5e-37
WP_000188448.1|951005_951227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460883.1|951259_951769_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|951776_951977_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001311552.1|951940_952282_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244228.1|952349_952583_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|952582_952810_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_096969117.1|952806_953664_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.6	1.1e-162
WP_096969118.1|953660_956075_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154434.1|956228_956417_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|956427_956661_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000008839.1|956982_958392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520349.1|958439_959474_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.4	6.5e-170
WP_001098431.1|959473_961240_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216237.1|961382_962216_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742511.1|962232_963291_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_089564033.1|963294_963945_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	1.2e-110
WP_000673520.1|964040_964505_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|964504_964708_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|964711_964927_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_101356902.1|964907_965423_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	2.4e-88
WP_000196202.1|965419_965848_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	92.2	8.6e-60
WP_101356903.1|965943_966375_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_101356904.1|966367_966814_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.9	3.1e-60
WP_052415661.1|966852_967551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033555171.1|967640_968219_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_001522712.1|968215_968575_+	hypothetical protein	NA	A0A1S6KZZ4	Salmonella_phage	88.2	5.0e-53
WP_000268284.1|968561_969470_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086836.1|969462_970068_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000104760.1|970064_971690_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.2	6.4e-188
WP_000356478.1|971689_972292_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.9	3.6e-88
WP_000046126.1|972426_973599_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_001207660.1|973608_974124_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|974178_974481_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|974495_974615_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_101356905.1|974607_977685_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.5	0.0e+00
WP_000980413.1|977681_978167_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_053885094.1|978163_979264_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000972391.1|979354_979573_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|979808_981494_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
979638:979664	attR	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|981763_982141_+	membrane protein	NA	NA	NA	NA	NA
WP_001195230.1|982170_982428_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|982587_982875_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|983641_984544_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|984631_985108_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|985457_986570_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|986664_987798_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|987807_988761_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|988757_989603_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|989662_990151_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|990191_991319_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_001295905.1|991347_992079_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|992304_992973_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|992972_993689_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|993695_994427_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|994444_995173_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001160737.1|996030_996354_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|996350_997181_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001305933.1|997177_998191_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136572.1|998289_999720_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566391.1|999730_1000732_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815373.1|1000768_1002487_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000178694.1|1002619_1003588_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|1003599_1005252_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|1005395_1006295_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1006615_1007311_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599822.1|1007736_1009395_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|1009391_1010348_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746477.1|1010498_1011614_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188147.1|1011610_1013557_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1013629_1013854_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1014176_1014497_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1014527_1016804_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|1017516_1018500_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|1018496_1021730_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
>prophage 4
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	1269070	1314232	5146765	capsid,terminase,tRNA,head,portal,tail,lysis,integrase,protease	Enterobacteria_phage(55.36%)	65	1259590:1259603	1289360:1289373
1259590:1259603	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|1269070_1270177_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1270230_1270692_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|1270701_1271355_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1271526_1272777_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1272890_1274033_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1274022_1274259_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1274398_1274638_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1274621_1274948_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1274947_1275169_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1275555_1275747_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1275719_1275902_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1275898_1276579_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1276575_1277361_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|1277366_1277663_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|1277738_1277882_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1277850_1278015_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1278087_1278456_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1278638_1278839_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|1279052_1279634_+	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|1279650_1279923_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1279900_1280083_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1280359_1281112_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1281108_1281666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|1281705_1282401_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1282476_1282692_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1282833_1283130_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1283162_1284062_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1284058_1284760_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1284756_1285047_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1285120_1285561_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1285557_1286085_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1286081_1286258_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1286260_1286602_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950951.1|1286594_1286789_+	protein ninF	NA	NA	NA	NA	NA
WP_001099712.1|1286808_1287171_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1287167_1287308_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1287393_1287777_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1287964_1289047_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1289635_1289851_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
1289360:1289373	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_001135277.1|1289850_1290348_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1290564_1290747_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1290837_1291131_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1291611_1291938_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1292144_1292327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867575.1|1292888_1293437_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622379.1|1293408_1295337_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000259002.1|1295320_1295527_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|1295523_1297116_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253914.1|1297105_1298611_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1298647_1298995_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522649.1|1299052_1300081_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
WP_000201530.1|1300132_1300507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1300499_1300853_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1300864_1301443_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|1301439_1301835_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_101357009.1|1301842_1302583_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
WP_000479129.1|1302598_1303021_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459485.1|1303002_1303437_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	89.2	3.4e-56
WP_101356909.1|1303429_1305985_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	85.9	0.0e+00
WP_000847402.1|1305981_1306311_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|1306310_1307009_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000090879.1|1307692_1308295_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000515327.1|1308355_1311838_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|1311896_1313957_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|1313953_1314232_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 5
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	1393197	1483820	5146765	transposase,capsid,terminase,head,portal,tail,lysis,holin,integrase,protease	Enterobacteria_phage(30.77%)	96	1386592:1386608	1439509:1439525
1386592:1386608	attL	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001111620.1|1393197_1394397_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|1395189_1396032_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|1396081_1396540_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1396652_1397558_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|1397649_1398663_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1398864_1399773_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1399916_1400330_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1400933_1401551_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|1403008_1405684_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|1406160_1406808_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_000051910.1|1406965_1407127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297114.1|1407545_1409177_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|1409262_1410183_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1410197_1411106_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|1411117_1412131_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|1412127_1413132_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|1413184_1413514_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|1413548_1415009_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1415151_1415325_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|1415379_1416633_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1416932_1417229_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|1417452_1418169_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1418208_1418607_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|1418712_1419252_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|1419281_1420025_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|1420380_1421019_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1421064_1422195_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1422172_1422421_-	excisionase	NA	NA	NA	NA	NA
WP_000048435.1|1422485_1424957_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|1425049_1425241_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1425237_1425426_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1425826_1425991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|1425991_1426213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1426372_1426528_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|1426820_1427159_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|1427550_1427793_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|1427776_1428202_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|1428273_1429344_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151217.1|1429384_1429807_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
WP_014639476.1|1429998_1430961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|1430976_1431978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|1432386_1432494_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|1432538_1432751_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|1432918_1433197_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|1433198_1434245_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|1434257_1434632_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1434628_1435450_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|1435674_1435872_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|1436022_1437072_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_001331709.1|1438346_1438574_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|1438842_1439058_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|1439062_1439407_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|1439372_1439645_-	hypothetical protein	NA	NA	NA	NA	NA
1439509:1439525	attR	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001082537.1|1440583_1441048_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|1441355_1441766_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|1441822_1442056_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|1442442_1442991_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000259002.1|1444873_1445080_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|1445076_1446669_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_101356910.1|1446658_1448164_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	3.6e-100
WP_000256823.1|1448200_1448548_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522602.1|1448605_1449634_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	2.1e-112
WP_000201495.1|1449685_1450069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1450061_1450415_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|1450430_1450964_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1450960_1451356_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1451363_1452116_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_021530079.1|1452129_1452561_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	69.4	1.6e-42
WP_000533402.1|1452587_1453001_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|1452981_1455555_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|1455551_1455881_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|1455880_1456579_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|1456583_1457327_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|1457263_1457866_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1457939_1458278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233195.1|1461890_1462490_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|1462641_1465749_+	membrane protein	NA	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|1465748_1466333_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|1466387_1467056_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1467112_1467382_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079492.1|1468154_1468661_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1468706_1469207_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1469292_1469472_-	general stress protein	NA	NA	NA	NA	NA
WP_101356911.1|1469852_1470659_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|1470658_1471852_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|1471863_1473222_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|1473225_1474821_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|1474820_1476383_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1476474_1476519_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|1476656_1477538_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1477534_1478155_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|1478182_1480078_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1480290_1481166_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|1481205_1481796_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_101356912.1|1481792_1482551_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	9.7e-06
WP_000422062.1|1482770_1483820_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	2596231	2666409	5146765	tRNA,head,coat,terminase,portal,lysis,holin,integrase	Enterobacteria_phage(75.0%)	84	2613188:2613204	2658527:2658543
WP_001283598.1|2596231_2597044_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|2597043_2598057_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|2598122_2599259_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|2599357_2600353_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|2600349_2601528_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2601792_2603013_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_157829384.1|2603171_2603315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157829385.1|2603350_2605177_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2605297_2605576_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|2605609_2606158_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|2606157_2606967_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|2606966_2607791_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|2607794_2608880_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|2608914_2609847_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2610012_2610564_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|2610883_2611726_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|2611727_2612255_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|2612251_2612731_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|2612727_2613231_-	fimbrial protein	NA	NA	NA	NA	NA
2613188:2613204	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|2613247_2614000_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001195816.1|2617855_2618341_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|2618543_2620688_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2620687_2621998_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2622178_2622463_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|2622834_2624175_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2624232_2624988_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2625281_2626214_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|2626525_2627683_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000129907.1|2628796_2631742_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.4	0.0e+00
WP_001350929.1|2631842_2632745_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
WP_000410001.1|2632977_2633130_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051911.1|2633244_2633493_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903306.1|2633492_2634029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198454.1|2634077_2634527_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|2634535_2635102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|2635298_2635628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101356946.1|2635645_2637658_-	injection protein	NA	A0A2I7QW93	Vibrio_phage	36.6	4.2e-96
WP_000257015.1|2637657_2639109_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
WP_000964905.1|2639119_2639812_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
WP_000627629.1|2639814_2640270_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|2640269_2640971_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|2640970_2642389_-	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|2642398_2642860_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|2642840_2643029_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000370106.1|2643070_2644324_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_000372589.1|2644342_2645236_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818371.1|2645326_2647525_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|2647526_2648942_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|2648938_2649379_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|2649381_2649624_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|2649851_2650394_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|2650599_2650752_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|2650739_2651177_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|2651173_2651650_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|2651633_2651957_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027549.1|2652553_2653072_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000994516.1|2653068_2653257_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2653253_2653616_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|2653612_2653903_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|2653902_2654625_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950973.1|2654617_2654794_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000177653.1|2654786_2655212_-	DUF2591 domain-containing protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|2655208_2655385_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|2655381_2655792_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_024189664.1|2655991_2656312_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	70.2	1.5e-32
WP_000229808.1|2656420_2656627_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_001248388.1|2656699_2658076_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001350936.1|2658072_2659020_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
2658527:2658543	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|2659022_2659295_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2659317_2659611_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|2659719_2659905_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2659985_2660636_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219332.1|2661157_2661457_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000167596.1|2661465_2661936_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_014532157.1|2662025_2662301_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_101356887.1|2662557_2663163_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	99.5	3.2e-108
WP_000951332.1|2663162_2663546_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|2663569_2663866_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|2663960_2664479_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|2664475_2664775_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|2664776_2665349_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000002106.1|2665626_2665911_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2665983_2666151_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2666208_2666409_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 7
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	2793764	2838270	5146765	tail,integrase,holin,terminase	Escherichia_phage(56.86%)	54	2814100:2814117	2845201:2845218
WP_001344399.1|2793764_2793938_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669398.1|2794251_2794767_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|2794782_2795322_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_001336051.1|2795540_2796023_-	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	93.8	6.9e-74
WP_001567213.1|2796019_2796649_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.4e-113
WP_000256103.1|2796638_2796947_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_001276090.1|2796933_2797338_-	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_000218907.1|2797644_2800764_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	95.7	0.0e+00
WP_001188252.1|2800959_2801217_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_042095197.1|2801532_2802243_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	79.8	7.5e-101
WP_000405096.1|2802355_2802544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001113079.1|2802545_2802878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|2802975_2803137_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001147904.1|2803168_2803465_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_063269916.1|2803660_2806135_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.3	0.0e+00
WP_083574916.1|2806140_2807943_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	96.2	0.0e+00
WP_063269918.1|2807939_2810453_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	93.8	0.0e+00
WP_000332878.1|2810452_2810998_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_063269919.1|2810997_2811462_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.7	3.2e-84
WP_001018557.1|2811461_2813933_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_000179259.1|2813932_2814538_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	1.1e-111
2814100:2814117	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_000424495.1|2814537_2814861_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_000012373.1|2814911_2815247_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	3.8e-55
WP_000627062.1|2815257_2815695_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	98.6	2.4e-73
WP_000268715.1|2815746_2816733_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_063269920.1|2816747_2817443_-	peptidase	NA	G9L6C4	Escherichia_phage	99.6	6.0e-95
WP_021517651.1|2817445_2817742_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
WP_000852419.1|2817738_2819418_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
WP_000335899.1|2819432_2819639_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_063269921.1|2820345_2820684_+	hypothetical protein	NA	A0A1W6DXZ5	Salmonella_phage	96.4	2.5e-54
WP_021543020.1|2820774_2822250_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	6.4e-296
WP_024187282.1|2822246_2822921_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.1	4.4e-119
WP_021515113.1|2822961_2823300_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	2.2e-58
WP_021573221.1|2823292_2823574_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	4.5e-49
WP_000253289.1|2823566_2823851_-	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_063269923.1|2824739_2825480_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	77.6	2.8e-58
WP_001350881.1|2825476_2825686_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	98.6	2.0e-33
WP_000156548.1|2825678_2825993_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	86.9	1.6e-42
WP_101356951.1|2825989_2826409_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	57.2	1.6e-29
WP_063269925.1|2826470_2826815_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	1.5e-59
WP_001680564.1|2826932_2827718_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	2.1e-152
WP_001559621.1|2827714_2828530_-	hypothetical protein	NA	Q286X4	Escherichia_phage	96.4	3.2e-119
WP_001282459.1|2828896_2829127_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2829281_2829866_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001102257.1|2830174_2830474_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	100.0	3.4e-47
WP_063269926.1|2830470_2831292_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.2	2.0e-161
WP_000063821.1|2831288_2832170_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	6.8e-160
WP_000675390.1|2832219_2832468_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|2832625_2832877_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000163451.1|2832869_2833520_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	99.1	2.5e-127
WP_001077940.1|2833516_2833711_+	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	100.0	3.3e-27
WP_020231273.1|2833714_2834965_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	8.0e-239
WP_000138282.1|2835157_2836735_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|2836803_2838270_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
2845201:2845218	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 8
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	2922143	3009491	5146765	capsid,plate,tRNA,head,terminase,portal,tail,lysis,holin,protease	Shigella_phage(42.86%)	96	NA	NA
WP_000083664.1|2922143_2922881_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2923012_2924347_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|2924379_2925261_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2925363_2925951_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2926006_2926390_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2926694_2927384_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|2927431_2928469_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2928675_2929095_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2929163_2929862_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|2929893_2932554_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2932667_2934023_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2934068_2934392_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|2934388_2935687_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|2944170_2946744_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|2946873_2947605_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|2947601_2948582_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2948716_2949454_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2949723_2950065_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2950168_2950216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|2950314_2951475_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|2951517_2952639_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|2952649_2953720_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2953929_2954295_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2954443_2954962_+	YfiR family protein	NA	NA	NA	NA	NA
WP_097423947.1|2954951_2956178_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2956193_2956676_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2956752_2957100_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2957141_2957909_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2957939_2958488_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2958506_2958755_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2958891_2960253_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2960419_2961211_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2961231_2962518_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|2962572_2963166_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2963288_2964167_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2964252_2965914_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2966062_2966404_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2966465_2966756_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2966745_2967222_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2967353_2967836_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|2968992_2969781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|2969868_2970162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|2970372_2971146_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|2972196_2974086_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|2974339_2974831_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|2974833_2975277_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|2975248_2975851_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|2975850_2976594_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000539246.1|2976597_2977182_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|2977172_2978231_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|2978217_2978643_-	hypothetical protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|2978642_2979191_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|2979190_2980270_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|2980266_2981595_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|2981655_2983491_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|2983632_2983902_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2983901_2984258_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|2984257_2985754_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|2985737_2985908_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|2985916_2986477_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|2986473_2986980_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|2986954_2987365_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|2987361_2987685_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2987687_2987888_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|2987937_2989143_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|2989157_2989808_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|2989785_2991027_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|2991026_2991209_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|2991220_2992717_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2992950_2993445_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|2993570_2993921_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000026993.1|2994023_2994464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332386.1|2994570_2994822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|2994892_2995330_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|2995326_2995803_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|2995789_2996095_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|2996246_2996582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|2996767_2997520_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|2997533_2998523_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|2998530_2999328_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|2999347_2999737_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|2999733_3000060_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001350763.1|3000056_3000710_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	98.6	4.7e-126
WP_001332382.1|3000709_3001204_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|3001200_3002142_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|3002131_3002311_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|3002486_3003038_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|3003081_3003282_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3003372_3004047_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|3004249_3004762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|3005230_3005593_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|3005658_3006483_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|3006610_3007135_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|3007243_3008110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|3008151_3008358_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|3008318_3009491_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 9
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	3085151	3092291	5146765		Escherichia_phage(83.33%)	6	NA	NA
WP_101356954.1|3085151_3087713_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.0	4.1e-32
WP_001141302.1|3087818_3088475_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|3088525_3089293_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|3089488_3090397_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|3090393_3091656_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|3091652_3092291_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	4157234	4175188	5146765	integrase	Morganella_phage(27.27%)	19	4156458:4156471	4161062:4161075
4156458:4156471	attL	GAACTGGGTAAAAA	NA	NA	NA	NA
WP_023352357.1|4157234_4158503_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	1.0e-193
WP_001059729.1|4158499_4159150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336356.1|4159621_4159840_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_021568517.1|4159914_4160613_+	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	38.7	1.1e-11
WP_050436474.1|4160605_4161349_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	42.0	1.6e-21
4161062:4161075	attR	GAACTGGGTAAAAA	NA	NA	NA	NA
WP_021543050.1|4161341_4161899_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.6	1.1e-51
WP_024188802.1|4162067_4162265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094456.1|4162322_4162520_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	43.1	9.5e-06
WP_024188801.1|4162725_4162929_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032166143.1|4162921_4163179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543048.1|4163181_4163484_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032273012.1|4163480_4165607_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.6	1.8e-174
WP_021543046.1|4165817_4166240_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_021543045.1|4166276_4166774_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	46.3	9.2e-13
WP_101356979.1|4166754_4167117_+	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	75.8	1.6e-19
WP_023352366.1|4167537_4167744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032166144.1|4167840_4170372_+	bacteriophage protein	NA	Q858G0	Salmonella_phage	79.6	0.0e+00
WP_021543042.1|4170371_4172432_+	hypothetical protein	NA	Q858F9	Salmonella_phage	59.9	3.6e-204
WP_032166145.1|4172431_4175188_+	hypothetical protein	NA	Q858F8	Salmonella_phage	88.9	0.0e+00
>prophage 11
NZ_CP025328	Escherichia coli strain ExPEC XM chromosome, complete genome	5146765	5034152	5117240	5146765	transposase,terminase,portal,tail,lysis,holin,integrase,protease	Enterobacteria_phage(47.17%)	85	5035164:5035198	5119308:5119342
WP_000181195.1|5034152_5035073_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
5035164:5035198	attL	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_020233658.1|5035300_5035381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000648248.1|5035478_5037572_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000132612.1|5037618_5037960_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_101357000.1|5038188_5039556_-	type I restriction-modification system specificity subunit	NA	NA	NA	NA	NA
WP_001063199.1|5039552_5041142_-	type I restriction-modification system methyltransferase	NA	NA	NA	NA	NA
WP_011478352.1|5041343_5044853_-	type I restriction-modification system endonuclease	NA	NA	NA	NA	NA
WP_000217935.1|5045043_5045958_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001295525.1|5046003_5046960_-	GTPase	NA	NA	NA	NA	NA
WP_000467859.1|5046970_5047174_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_000919587.1|5049817_5051473_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	5.2e-12
WP_000118642.1|5051515_5052787_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001235681.1|5052783_5053257_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000034589.1|5053320_5054292_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_001298060.1|5054982_5056635_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000091596.1|5056805_5057711_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106008.1|5057849_5058872_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001292631.1|5059011_5061303_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001357532.1|5061556_5062051_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|5062099_5062837_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001350779.1|5062839_5063379_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000538188.1|5063486_5063960_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_001314410.1|5063950_5064721_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000936639.1|5065340_5066066_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001311355.1|5066023_5066701_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_000331592.1|5066738_5067527_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001350368.1|5067667_5067904_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272336.1|5068463_5069495_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204030.1|5069597_5070011_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092461.1|5069979_5070426_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870712.1|5070440_5071118_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218291.1|5071502_5072738_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	2.6e-234
WP_001105426.1|5072896_5074030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008196.1|5074468_5075005_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.2	1.3e-97
WP_000081280.1|5075132_5075957_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|5076022_5076385_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001311077.1|5077106_5077799_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001401082.1|5077896_5078157_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	97.7	3.9e-39
WP_001542074.1|5078149_5078701_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.7	9.3e-99
WP_001401085.1|5078697_5079849_+	phage regulatory, Rha family protein	NA	A0A0P0ZE80	Stx2-converting_phage	97.9	1.2e-212
WP_001401086.1|5079845_5080070_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	97.3	8.2e-38
WP_000061487.1|5080066_5080885_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_001359043.1|5080881_5081376_+	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	99.4	1.9e-87
WP_001343335.1|5081375_5082029_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_000210155.1|5082025_5082352_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_000767113.1|5082348_5082738_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001542077.1|5082757_5083555_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
WP_001542078.1|5083562_5084552_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.6e-194
WP_001205457.1|5084570_5084915_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
WP_001542079.1|5084940_5085555_-	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	35.9	2.2e-32
WP_125282403.1|5085558_5085903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907077.1|5085918_5086668_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_001120496.1|5087068_5087395_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_061091416.1|5087398_5087875_+	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.8	5.0e-85
WP_001341210.1|5087871_5088339_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001139675.1|5088326_5088479_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000421825.1|5089151_5089691_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_101357001.1|5089699_5091799_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.4	0.0e+00
WP_001072975.1|5091795_5092008_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023908451.1|5091935_5093516_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	3.1e-288
WP_001360054.1|5093460_5095488_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097046.1|5095574_5095898_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_025492009.1|5095890_5096166_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	97.8	7.2e-44
WP_042003597.1|5096177_5096756_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	6.1e-101
WP_001079398.1|5096752_5097154_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|5097165_5097909_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|5097969_5098356_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|5098364_5098694_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_025492007.1|5098665_5101731_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
WP_000447253.1|5101730_5102060_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|5102069_5102768_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_063116075.1|5102773_5103517_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.4e-150
WP_101357002.1|5103535_5104063_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.1	8.3e-89
WP_101357003.1|5104123_5107822_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	75.3	0.0e+00
WP_063269873.1|5107889_5108489_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
WP_101357004.1|5108553_5110617_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	2.1e-151
WP_001204579.1|5110613_5110892_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	7.9e-22
WP_000355702.1|5110901_5111192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358619.1|5111691_5112405_+	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_000734593.1|5112401_5113223_+	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000859544.1|5113219_5113792_+	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
WP_001217535.1|5113899_5114148_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	3.5e-37
WP_000202563.1|5114367_5115954_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5116346_5116952_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5117078_5117240_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
5119308:5119342	attR	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 1
NZ_CP025329	Escherichia coli strain ExPEC XM plasmid unnamed	286854	545	92089	286854	transposase,integrase,protease	Enterobacteria_phage(11.11%)	57	24014:24030	103360:103376
WP_001696784.1|545_4679_+|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	4.3e-297
WP_000612591.1|6855_7203_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001282162.1|7199_7589_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	98.4	6.6e-67
WP_001017347.1|7655_8636_-	FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_000379710.1|8632_8902_-	membrane protein	NA	NA	NA	NA	NA
WP_001323890.1|9841_10078_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001183603.1|10535_12650_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	4.8e-34
WP_001332356.1|12624_13866_-	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
WP_001324224.1|14580_14778_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000969988.1|14774_14957_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000377483.1|15055_15364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001190233.1|15923_16958_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
WP_001222186.1|17802_19980_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_000271277.1|20024_20981_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_011402704.1|22397_26183_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
24014:24030	attL	CGCCTGCGGCGACACCG	NA	NA	NA	NA
WP_001318220.1|26196_27312_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000738422.1|30456_30750_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_085948338.1|31411_32684_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.8e-175
WP_000450493.1|33139_34333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610305.1|34967_36365_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001610304.1|36596_36866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610303.1|36865_37333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610302.1|37375_37747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610298.1|40088_42353_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_001610297.1|42354_43131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696614.1|45526_46897_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001610286.1|46900_48841_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001696612.1|48837_50025_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
WP_001595315.1|51739_52156_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
WP_001696610.1|54812_55922_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000175738.1|55984_56893_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001312821.1|57267_57456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066954.1|57576_58317_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_000361611.1|58601_59579_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_000949004.1|62560_63475_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|63474_64302_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001101723.1|64298_65156_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|65152_66010_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|67251_67632_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095528.1|68011_69205_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|69340_71065_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|71065_72013_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015721.1|72012_73755_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|73751_75029_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973519.1|75110_77312_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000361402.1|78642_79665_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001034044.1|81288_81705_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|81701_81932_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_084818649.1|82282_86107_+	pcar	NA	NA	NA	NA	NA
WP_001034046.1|86151_86568_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261278.1|86564_86795_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000528932.1|87059_87560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905949.1|87572_88346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151784.1|89678_90191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813630.1|90756_90975_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|90976_91282_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_021543129.1|91282_92089_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.4	3.7e-56
103360:103376	attR	CGGTGTCGCCGCAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP025329	Escherichia coli strain ExPEC XM plasmid unnamed	286854	220654	277678	286854	tRNA,transposase,bacteriocin	Salmonella_phage(27.27%)	46	NA	NA
WP_000911333.1|220654_221053_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_077944073.1|221052_221283_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000205749.1|226650_227397_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000704513.1|227455_228316_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139315.1|228418_228979_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001299730.1|229114_229327_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001312851.1|230007_230157_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083845.1|230440_230698_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|230929_231004_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001324615.1|230984_231479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019842754.1|231471_232329_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001323889.1|232625_234203_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001161490.1|234512_235073_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|235076_238043_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000844627.1|238100_238343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|238374_239025_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000058717.1|240360_241245_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|241382_241775_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001132900.1|244424_244676_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000222760.1|244672_244960_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.3e-19
WP_000255956.1|245835_246858_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001442137.1|246854_247637_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_000661609.1|250212_251175_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_001084509.1|251201_252752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084168.1|252864_254283_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000027750.1|254282_255830_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000531854.1|255789_256638_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000066154.1|256723_257329_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.0	1.7e-05
WP_001084376.1|257716_258646_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001334006.1|259319_259640_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.0	3.5e-13
WP_000536047.1|261398_262064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633743.1|262121_262412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595317.1|264800_265190_-	cytochrome B562	NA	NA	NA	NA	NA
WP_000470711.1|265623_266514_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024188138.1|266591_267815_-	cytosine permease	NA	NA	NA	NA	NA
WP_001696803.1|267837_268227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696801.1|268243_269200_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001093931.1|269192_270617_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000865634.1|270613_272173_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000400881.1|272267_272666_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_157674767.1|272800_273127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155780.1|273132_273801_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001442106.1|274747_275089_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	92.4	5.5e-41
WP_001334660.1|276314_276434_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000451769.1|277186_277420_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000412701.1|277420_277678_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
