The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	0	30182	5397521	tail,transposase,capsid	Escherichia_phage(47.83%)	23	NA	NA
WP_000787524.1|1706_3851_+	hypothetical protein	NA	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
WP_000345010.1|4008_5016_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214470.1|5039_6254_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.5	1.1e-232
WP_001140444.1|6308_6698_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_001370499.1|6748_7210_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
WP_000829203.1|7193_7757_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
WP_000207919.1|7756_8407_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000117996.1|8403_10242_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001023433.1|10243_10513_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_001370566.1|10650_10830_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001146329.1|11133_12759_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_000162956.1|12755_14024_+	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
WP_001369201.1|14038_14320_+	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_001399382.1|14325_14883_+	hypothetical protein	NA	Q08J77	Stx2-converting_phage	98.9	5.5e-107
WP_000682942.1|15029_15752_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	76.7	9.0e-102
WP_000035554.1|16181_16583_+	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.0	3.9e-70
WP_000509480.1|16676_17330_+	hypothetical protein	NA	Q08J74	Stx2-converting_phage	96.8	1.1e-109
WP_000455646.1|17332_17779_+	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_000540396.1|17788_18040_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	97.4	5.1e-12
WP_085948186.1|18361_19517_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370495.1|19590_20583_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.0	3.3e-163
WP_000885695.1|20651_29027_+	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	97.0	0.0e+00
WP_000368131.1|29249_30182_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 2
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	48052	49138	5397521		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|48052_49138_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 3
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	57693	58830	5397521		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|57693_58830_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 4
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	65306	66824	5397521		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|65306_66824_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 5
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	71035	72896	5397521		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|71035_71809_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156151.1|72005_72896_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.6	2.6e-66
>prophage 6
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	83455	86683	5397521		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203394.1|83455_84106_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	28.0	2.1e-09
WP_001012899.1|84192_86025_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|86083_86683_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 7
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	121100	126104	5397521		Tupanvirus(50.0%)	4	NA	NA
WP_000860242.1|121100_123083_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461657.1|123082_124051_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_001399222.1|124054_125194_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.7	3.8e-30
WP_001297077.1|125501_126104_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 8
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	129707	134023	5397521	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_001370513.1|129707_130913_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	5.5e-27
WP_001370560.1|130969_132259_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992959.1|132276_133080_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140570.1|133120_134023_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 9
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	139916	154030	5397521		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000772514.1|139916_140993_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	43.8	1.3e-08
WP_000301048.1|141455_142106_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|142159_142414_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332037.1|142413_143544_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075170.1|143690_145976_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_024025996.1|146671_150406_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	24.8	3.1e-20
WP_000990766.1|150533_151256_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|151402_154030_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 10
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	168953	173796	5397521		Bacillus_phage(50.0%)	2	NA	NA
WP_000559125.1|168953_170780_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876014.1|170946_173796_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 11
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	178072	183850	5397521		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865558.1|178072_179176_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	6.2e-118
WP_000406103.1|179287_180343_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786348.1|180416_181481_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
WP_000884957.1|181480_182131_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422169.1|182206_183850_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	7.2e-14
>prophage 12
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	192618	193236	5397521		Bacillus_virus(100.0%)	1	NA	NA
WP_001296826.1|192618_193236_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 13
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	204934	212583	5397521		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|204934_205942_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|206080_206365_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578135.1|206489_208250_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	7.1e-100
WP_001234850.1|208399_209095_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|209122_210313_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|210645_210990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194915.1|210993_212583_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 14
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	218337	222638	5397521		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|218337_218904_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|219315_220029_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|220067_221054_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000848208.1|221171_222638_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	2.3e-43
>prophage 15
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	237261	238119	5397521		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|237261_238119_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 16
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	242188	245974	5397521		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489250.1|242188_244180_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425430.1|244211_245048_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|245305_245974_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 17
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	249668	251189	5397521		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|249668_251189_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 18
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	271505	280947	5397521		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569358.1|271505_272432_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|272436_273168_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|273148_273256_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|273315_274047_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|274268_275954_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|275950_276670_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001370504.1|276716_277187_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_001295429.1|277227_277689_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370558.1|277813_279814_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001370574.1|279810_280947_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 19
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	292579	294613	5397521	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001370528.1|292579_294613_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 20
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	305261	308818	5397521		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001351455.1|305261_306080_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|306131_306878_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011997.1|306851_307817_-	sugar kinase	NA	NA	NA	NA	NA
WP_101329671.1|307813_308818_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	6.4e-13
>prophage 21
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	318038	324912	5397521	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000807346.1|318038_318938_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
WP_001295425.1|319352_319670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476010.1|319999_321361_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	6.1e-216
WP_001220181.1|321463_321760_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|321761_322058_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|322266_322599_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|322789_323512_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_101329672.1|323508_324912_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 22
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	339412	340759	5397521		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469744.1|339412_340759_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.4	1.3e-05
>prophage 23
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	345423	355899	5397521		Catovirus(20.0%)	9	NA	NA
WP_001295424.1|345423_346065_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|346156_346738_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252305.1|346759_348613_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454701.1|348886_350470_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_163424363.1|350670_350820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978094.1|351128_352268_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_101329673.1|352273_352717_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137094.1|352719_354882_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|355059_355899_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 24
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	360143	366937	5397521		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|360143_361265_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043606.1|361267_362233_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000479842.1|362235_362715_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699721.1|362711_363935_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079280.1|363937_365374_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001370567.1|365566_366937_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.9e-32
>prophage 26
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	400771	401671	5397521		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|400771_401671_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 27
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	409315	410482	5397521		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830155.1|409315_410482_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	6.5e-227
>prophage 28
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	427975	428785	5397521		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000034.1|427975_428785_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.1	4.1e-10
>prophage 29
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	442615	477763	5397521	transposase,integrase	Escherichia_phage(33.33%)	18	449395:449409	477727:477741
WP_000041052.1|442615_443500_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_000055677.1|444883_446146_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.2e-72
WP_122994343.1|446387_448031_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|448660_449377_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
449395:449409	attL	AAATTTATTTACATT	NA	NA	NA	NA
WP_001060244.1|449719_451174_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378572.1|451275_452592_-	shikimate transporter	NA	NA	NA	NA	NA
WP_164502361.1|454167_455380_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001370494.1|455534_462611_-	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_001370578.1|463100_463898_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533619.1|464133_465159_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_000067202.1|465158_465362_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085948186.1|467742_468899_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_024174242.1|469206_471180_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
WP_122994832.1|471406_472426_+	peptidase M85	NA	NA	NA	NA	NA
WP_072004195.1|472744_473782_-	Secreted effector protein EspF(U)	NA	NA	NA	NA	NA
WP_029594361.1|474106_474757_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_169301992.1|474741_475970_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	8.0e-175
WP_001079059.1|477232_477763_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
477727:477741	attR	AATGTAAATAAATTT	NA	NA	NA	NA
>prophage 30
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	481307	493689	5397521		Bacillus_phage(28.57%)	12	NA	NA
WP_001339045.1|481307_481979_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826745.1|481978_483337_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.2	5.1e-05
WP_000218204.1|483444_484296_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824361.1|484887_485961_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	8.1e-99
WP_072097048.1|486527_486893_+	permease	NA	NA	NA	NA	NA
WP_000365561.1|486932_487628_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157238.1|487694_489113_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786004.1|489093_489564_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212238.1|489552_490473_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|490645_491563_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|491641_491824_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_024026113.1|491994_493689_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.0e-18
>prophage 31
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	507706	508375	5397521		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334596.1|507706_508375_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
>prophage 32
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	520725	521478	5397521		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|520725_521478_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 33
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	527735	561807	5397521	tail,portal,head,capsid,terminase,plate,holin,integrase	Enterobacteria_phage(87.18%)	46	526670:526729	561914:562037
526670:526729	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|527735_527876_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488108.1|528066_528327_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|528369_529479_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005425.1|529636_530821_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000290450.1|530820_531333_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|531387_531753_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333494.1|531761_531917_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000853431.1|531903_534711_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_001447286.1|535389_535935_+	transferase	NA	NA	NA	NA	NA
WP_000885638.1|535898_536516_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_000108489.1|536515_538516_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.6	4.6e-111
WP_000071720.1|538518_539049_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111920.1|539041_539938_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_001067548.1|539941_540271_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_077633718.1|540288_540855_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	2.8e-98
WP_000356316.1|540866_541502_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_000920594.1|541494_541962_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780572.1|542099_542507_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|542503_542896_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104342.1|542892_543216_-|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	100.0	4.2e-51
WP_000864901.1|543218_543419_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063078.1|543418_543913_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	2.3e-88
WP_000632364.1|544015_544816_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	97.4	3.3e-137
WP_001055112.1|544861_545914_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_001262656.1|545937_546774_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.5e-148
WP_000613773.1|546928_548680_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087807.1|548679_549726_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
WP_101329675.1|550255_550786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001289970.1|550877_551261_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	9.8e-31
WP_000211270.1|551324_551636_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	4.2e-48
WP_000686474.1|551640_552600_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	6.4e-180
WP_000564228.1|555514_555904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985482.1|555900_556518_-	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000108347.1|556529_556829_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.9	9.0e-40
WP_000153711.1|556825_557092_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000985144.1|557088_557292_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_029594336.1|557315_557711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|557825_557939_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514274.1|557935_558178_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000159467.1|558189_558468_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	5.3e-34
WP_000739029.1|558478_558829_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|558850_559054_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|559125_559263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|559352_559757_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000865386.1|560452_560800_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|560805_561807_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
561914:562037	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 34
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	568713	570228	5397521		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187811.1|568713_570228_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 35
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	580315	585959	5397521		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001370571.1|580315_581977_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000483246.1|582022_583624_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.2e-15
WP_000204335.1|583642_584503_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|584505_585555_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763874.1|585569_585959_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	34.6	1.0e-06
>prophage 36
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	591142	598112	5397521	transposase,tRNA	Stx2-converting_phage(85.71%)	7	NA	NA
WP_000997984.1|591142_592681_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_000612591.1|592730_593078_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|593074_593455_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001066419.1|593603_595160_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|595179_595527_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|595523_596198_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001025305.1|596378_598112_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	5.7e-86
>prophage 37
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	604728	606779	5397521		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|604728_605472_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|605512_605908_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639274.1|605960_606779_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 38
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	610797	617861	5397521		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|610797_611319_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|611320_611923_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|611993_612059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|612197_612809_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|612817_613828_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|613974_614760_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000203009.1|614756_615512_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.7e-18
WP_001342995.1|615590_616523_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184022.1|616538_617861_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 39
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	621860	623336	5397521		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|621860_623336_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 40
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	631392	635861	5397521		Clostridium_phage(33.33%)	7	NA	NA
WP_000944246.1|631392_632055_-	exodeoxyribonuclease X	NA	A0A0A7RWA3	Clostridium_phage	32.5	4.4e-10
WP_000011658.1|632078_632735_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|632836_633067_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168739.1|633205_633580_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879277.1|633583_634456_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976478.1|634468_634810_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|635204_635861_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
>prophage 41
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	643358	645407	5397521		Moraxella_phage(100.0%)	1	NA	NA
WP_001055780.1|643358_645407_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	2.3e-86
>prophage 42
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	650737	650947	5397521		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|650737_650947_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 43
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	656588	658145	5397521		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|656588_658145_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 44
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	662007	670113	5397521	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000855002.1|662007_663369_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.6e-41
WP_000457334.1|663442_663622_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|663741_664101_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|664462_664807_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128842.1|664938_666849_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.7e-91
WP_001220952.1|666906_667602_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|667641_668223_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_024026081.1|668427_670113_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	3.4e-35
>prophage 45
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	684867	689444	5397521		Bacillus_phage(100.0%)	3	NA	NA
WP_000766132.1|684867_686358_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616433.1|686538_688014_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|688160_689444_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 46
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	692762	693617	5397521		Indivirus(100.0%)	1	NA	NA
WP_001186347.1|692762_693617_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 47
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	702430	706515	5397521		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723723.1|702430_703411_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
WP_000719088.1|703547_704306_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000438810.1|704422_705781_+	MFS transporter	NA	NA	NA	NA	NA
WP_001120535.1|705873_706515_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
>prophage 48
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	711441	713403	5397521		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|711441_713403_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 49
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	719001	719655	5397521		Planktothrix_phage(100.0%)	1	NA	NA
WP_001370496.1|719001_719655_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	2.9e-14
>prophage 50
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	726430	727651	5397521		Klosneuvirus(100.0%)	1	NA	NA
WP_000081996.1|726430_727651_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.5e-27
>prophage 51
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	735127	735955	5397521		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|735127_735955_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 52
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	742293	744555	5397521		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|742293_744555_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 53
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	755822	775362	5397521	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144192.1|755822_757751_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|757754_758297_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|758393_758591_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|758644_759001_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|759123_759168_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018605.1|759450_760434_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672359.1|760448_762836_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|762840_763140_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956529.1|763240_764221_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|764283_764835_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|764834_765584_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|765661_766126_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001370474.1|766372_767086_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175614.1|767148_768585_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001399170.1|768588_768780_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|768911_769958_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|770114_770948_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069374.1|771280_773659_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_001370575.1|773715_775362_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	2.0e-32
>prophage 54
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	793960	799044	5397521		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|793960_794329_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|794337_795825_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948876.1|795834_796581_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	7.6e-11
WP_000908001.1|796555_797827_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144589.1|797823_799044_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	1.7e-92
>prophage 55
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	807333	809600	5397521		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|807333_808002_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069986.1|807998_808784_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587560.1|808787_809600_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 56
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	815104	823896	5397521		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|815104_815746_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|815785_816934_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_101329676.1|817224_818436_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|818548_819481_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|819477_820503_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|820801_820891_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|821056_822226_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|822371_822953_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|823080_823896_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 57
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	832698	834197	5397521		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|832698_833595_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|833675_834197_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 58
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	841108	842383	5397521	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|841108_842383_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 59
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	861882	863694	5397521		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|861882_863694_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 60
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	873589	874891	5397521		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|873589_874891_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 61
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	884991	1028158	5397521	tail,portal,head,protease,transposase,capsid,terminase,holin,integrase	Enterobacteria_phage(32.43%)	160	910047:910064	962079:962096
WP_001260840.1|884991_885813_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|885912_885996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|886088_886424_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|886820_888074_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019555.1|888180_889074_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|889208_890429_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|890553_891249_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|891201_892494_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_101329677.1|892652_893267_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_000526492.1|893309_894164_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|894165_894783_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_024025733.1|894793_897217_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	2.9e-205
WP_000041709.1|897277_899704_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.0e-214
WP_001295396.1|899902_900208_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_024025734.1|900315_901026_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|901028_901589_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705196.1|901623_901965_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|902099_902426_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001370501.1|902631_903846_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001341423.1|904665_905340_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|905336_905684_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|905703_907260_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000612591.1|907441_907789_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997984.1|907838_909377_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_000005552.1|909534_909786_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
910047:910064	attL	GGCAGGGGATCCCCTGCC	NA	NA	NA	NA
WP_101329727.1|911044_912258_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	1.0e-166
WP_012775982.1|912530_912809_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265275.1|912810_913860_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
WP_001047121.1|913873_914626_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
WP_000203370.1|915786_915972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795389.1|916598_916688_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|916742_916955_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066485.1|917255_917471_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_024025755.1|918224_918440_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	93.0	5.5e-31
WP_001092971.1|918752_919286_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|919282_919780_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|920141_920354_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|920364_920553_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|920555_920621_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|920700_920856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019140.1|921027_921201_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|921352_921763_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|922063_922270_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421825.1|922822_923362_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001399690.1|923436_924408_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	3.1e-182
WP_000114064.1|924525_925764_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|925756_925981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038673.1|926040_926619_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	65.4	4.9e-58
WP_001113138.1|927693_928014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261504.1|928020_928320_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833609.1|928316_930143_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	2.0e-129
WP_001399692.1|930430_930676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|930672_931095_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000860401.1|931753_933643_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|933900_934182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072975.1|935664_935877_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077633710.1|935804_937385_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	1.1e-288
WP_001097046.1|939443_939767_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283147.1|939759_940035_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677106.1|940046_940625_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079398.1|940621_941023_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211089.1|941034_941778_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	4.0e-129
WP_001370402.1|941838_942225_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_001161009.1|942233_942563_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372036.1|942534_945600_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447255.1|945599_945929_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	8.6e-60
WP_001152409.1|945938_946637_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000140752.1|946642_947386_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_001399694.1|947283_947931_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_000515486.1|947991_951390_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_001230525.1|951456_952056_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	8.8e-111
WP_072004194.1|952120_955075_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	80.7	6.0e-67
WP_001370405.1|955074_955596_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	2.3e-91
WP_085948186.1|955652_956808_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000086528.1|957014_957602_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	6.1e-24
WP_000836768.1|957918_958152_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|958220_958334_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001206148.1|958984_960280_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_048258936.1|960299_960563_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.8	5.4e-12
WP_085948186.1|960555_961712_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000102122.1|961890_964353_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
962079:962096	attR	GGCAGGGGATCCCCTGCC	NA	NA	NA	NA
WP_000199475.1|964445_964634_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|964630_964819_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|965383_965593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|965593_966232_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|966243_966396_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|966688_967027_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|967418_967661_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|967644_968070_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262401.1|968138_969206_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	85.3	1.9e-84
WP_000139447.1|969198_969660_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|969693_970410_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|970442_970724_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|970720_970948_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|970940_971252_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|971379_971598_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104475.1|971599_972157_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.3	2.4e-33
WP_000935259.1|972390_972603_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|972722_973067_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|973188_973461_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|973462_974512_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|974524_974884_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|974892_975447_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917748.1|975671_975869_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
WP_000301797.1|976004_976718_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|977168_977600_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000023191.1|978078_979929_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024164617.1|980367_980583_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731236.1|980587_980932_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|980982_981516_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|981786_982356_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|982355_982502_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|982724_982910_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|983397_983712_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|983793_984018_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|984404_984950_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|984924_986850_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|986846_987053_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|987049_988651_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_032212710.1|988631_989951_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.6e-232
WP_001299443.1|989960_990293_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024025845.1|990348_991374_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_000158899.1|991415_991811_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|991822_992176_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_024025847.1|992187_992766_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000683137.1|992762_993158_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|993165_993918_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|993931_994354_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|994380_994794_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212771.1|994774_997387_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000847401.1|997383_997713_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001299882.1|997712_998411_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_001370115.1|998416_999160_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_077696211.1|999105_999741_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_032212772.1|999976_1003453_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.1	0.0e+00
WP_001230496.1|1003519_1004119_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_032212694.1|1004183_1005497_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_001023386.1|1005498_1005768_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_122988840.1|1005878_1005956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|1006170_1007184_+	peptidase M85	NA	NA	NA	NA	NA
WP_001120551.1|1007554_1007797_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347482.1|1007928_1009212_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000214712.1|1010797_1011001_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|1011178_1011865_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|1011953_1012700_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001370614.1|1012836_1014882_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024746.1|1014925_1015444_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671731.1|1015719_1016112_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592837.1|1016366_1017257_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_000901367.1|1017475_1017571_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054189.1|1017697_1018885_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087216.1|1019079_1019979_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000577184.1|1020023_1020722_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000722571.1|1020920_1021232_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001370581.1|1021346_1022669_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001296721.1|1022696_1023008_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001022785.1|1023063_1024737_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_085948186.1|1025849_1027005_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000803659.1|1027524_1027743_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|1027774_1028158_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 62
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1035904	1037323	5397521		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|1035904_1037323_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 63
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1045204	1046740	5397521		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194883.1|1045204_1046740_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 64
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1072863	1079799	5397521		Bacillus_phage(50.0%)	3	NA	NA
WP_000628546.1|1072863_1074549_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	1.9e-09
WP_000832446.1|1074586_1076959_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001245001.1|1077015_1079799_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	1.1e-19
>prophage 65
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1085079	1088886	5397521		Bacillus_virus(50.0%)	2	NA	NA
WP_000426272.1|1085079_1086462_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_024174248.1|1086486_1088886_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 66
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1093202	1095108	5397521		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193519.1|1093202_1094189_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	2.5e-17
WP_001285540.1|1094181_1095108_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
>prophage 67
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1098381	1099822	5397521		Tupanvirus(50.0%)	2	NA	NA
WP_000642421.1|1098381_1099392_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	1.2e-24
WP_000781370.1|1099537_1099822_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 68
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1105834	1106125	5397521		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|1105834_1106125_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 69
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1113011	1114556	5397521		Escherichia_phage(100.0%)	1	NA	NA
WP_000702557.1|1113011_1114556_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 70
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1126370	1128512	5397521		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103401.1|1126370_1128512_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.4	6.3e-26
>prophage 71
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1133419	1135522	5397521		Salmonella_phage(100.0%)	1	NA	NA
WP_000689366.1|1133419_1135522_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	1.8e-134
>prophage 72
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1143974	1221654	5397521	tail,transposase	Escherichia_phage(23.53%)	66	NA	NA
WP_000220396.1|1143974_1144988_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|1145005_1146151_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760614.1|1146395_1147802_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|1147880_1148297_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|1148342_1148519_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|1148740_1148971_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001301045.1|1149062_1151024_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000429141.1|1151096_1151633_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001326689.1|1151685_1152900_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826419.1|1152939_1154148_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	9.5e-205
WP_101329727.1|1154796_1156009_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	1.0e-166
WP_001261010.1|1156049_1156661_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586720.1|1156963_1157557_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|1157553_1158546_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234074.1|1158669_1159650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140888.1|1159644_1160181_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1160243_1160468_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1160607_1162263_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|1162487_1163831_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|1164047_1164971_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098531.1|1165008_1166649_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1167047_1167197_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1167268_1167442_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001397126.1|1167686_1168217_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
WP_000048667.1|1168405_1169407_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115935.1|1169448_1170888_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|1171084_1171885_-	YdcF family protein	NA	NA	NA	NA	NA
WP_101329680.1|1172156_1176059_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|1176259_1176865_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|1176915_1178232_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000890932.1|1179660_1180557_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177543.1|1180556_1181162_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_085948186.1|1183662_1184818_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000097838.1|1184968_1185829_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123454.1|1186060_1186651_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039890.1|1186632_1187583_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|1187683_1188997_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206188.1|1189023_1190229_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018416.1|1190228_1190651_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973382.1|1190640_1192068_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969780.1|1192069_1192858_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292357.1|1192857_1193625_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206362.1|1193621_1194692_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|1194699_1195197_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|1195211_1195958_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1195966_1196254_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|1196265_1197195_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186507.1|1197479_1199525_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|1199772_1202046_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138618.1|1202103_1203603_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067509.1|1203838_1204744_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001325798.1|1204915_1205245_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|1205249_1205435_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900919.1|1205431_1208071_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1208278_1209268_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|1209378_1209801_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1209797_1210064_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628168.1|1210337_1213862_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837940.1|1214227_1215361_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	59.1	6.3e-118
WP_001295593.1|1215501_1215936_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_085948186.1|1216790_1217946_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370599.1|1217995_1218877_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|1219217_1219295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|1219405_1219675_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_032212629.1|1219676_1220990_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001230471.1|1221054_1221654_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
>prophage 73
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1225429	1270421	5397521	tail,portal,tRNA,protease,transposase,terminase,holin	Escherichia_phage(50.98%)	56	NA	NA
WP_136865629.1|1225429_1226059_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	4.4e-105
WP_032212713.1|1226753_1227452_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000847298.1|1227451_1227781_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_157830735.1|1227777_1228542_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	98.4	5.0e-135
WP_157830736.1|1228692_1228836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101329682.1|1230359_1230770_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	60.4	5.1e-25
WP_101329683.1|1230756_1231218_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.5	1.4e-68
WP_000235098.1|1231230_1231983_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000682719.1|1231990_1232389_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	2.9e-70
WP_000974955.1|1232401_1233025_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_001281345.1|1233027_1233309_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
WP_024025855.1|1233301_1233628_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	2.3e-49
WP_001114424.1|1233715_1235740_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974578.1|1235684_1237187_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.4	4.5e-289
WP_000102415.1|1237186_1237399_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077633.1|1237395_1239519_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000348566.1|1239515_1239992_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.2	2.2e-80
WP_012816791.1|1240507_1240693_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1240920_1241067_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1241066_1241636_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087730.1|1241906_1242440_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_000284506.1|1242444_1242660_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290233.1|1242736_1242982_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000142777.1|1243022_1243202_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_000640170.1|1246818_1247373_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_000228018.1|1247369_1247660_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000940340.1|1247659_1248259_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000687447.1|1248318_1248492_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	70.4	1.2e-17
WP_000818166.1|1248720_1249206_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|1249224_1249404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813257.1|1249615_1249771_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_085947598.1|1249873_1251035_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000156213.1|1251589_1252687_+	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
WP_001204666.1|1252646_1253225_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_001275735.1|1253547_1254021_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	2.9e-64
WP_001151266.1|1254017_1254434_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.2	1.6e-58
WP_001370676.1|1254449_1255211_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	2.0e-120
WP_000788989.1|1255232_1255979_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_000899743.1|1255985_1256843_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000702023.1|1256855_1257278_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_071829568.1|1257261_1257522_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.3	1.1e-20
WP_001253182.1|1257640_1258105_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_001169149.1|1258479_1258632_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000560223.1|1259056_1259278_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_000245534.1|1259271_1259448_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000102191.1|1259528_1262198_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	59.6	2.0e-194
WP_000595429.1|1262190_1263000_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
WP_001317028.1|1263056_1263251_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|1263243_1263453_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|1263531_1263747_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|1263748_1264984_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157421.1|1265035_1265971_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000123758.1|1266099_1267473_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|1267502_1267676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|1267950_1268934_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|1269188_1270421_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 74
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1276748	1277264	5397521		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|1276748_1277264_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 75
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1295446	1296529	5397521		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|1295446_1296529_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 76
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1310531	1311797	5397521		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|1310531_1311797_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 77
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1324712	1330370	5397521		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|1324712_1325519_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968852.1|1325586_1325940_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1326307_1327096_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001356195.1|1327240_1328368_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|1328435_1330370_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 78
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1338185	1338776	5397521		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1338185_1338776_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 79
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1343700	1348992	5397521	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|1343700_1346298_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|1346677_1346929_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422070.1|1346964_1348014_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	7.9e-22
WP_000559250.1|1348233_1348992_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
>prophage 80
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1353925	1356883	5397521		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763513.1|1353925_1355521_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	1.9e-51
WP_000983916.1|1355521_1356883_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
>prophage 81
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1361917	1390318	5397521	tail,transposase	Escherichia_phage(35.29%)	32	NA	NA
WP_169073085.1|1361917_1362568_-	T3SS effector NleG family protein	NA	B6ETE1	Enterobacteria_phage	32.9	5.9e-28
WP_001144877.1|1364058_1364649_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|1364832_1365480_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1365616_1365763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|1366190_1366469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|1367636_1368206_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|1368271_1369183_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|1369289_1369412_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025669.1|1371007_1372333_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.4	1.7e-215
WP_001101707.1|1373358_1373628_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_085947772.1|1375148_1376362_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001370670.1|1376646_1377639_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	47.3	7.3e-78
WP_010917803.1|1377640_1377919_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|1377988_1378246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1378466_1378679_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|1378957_1379716_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_122368318.1|1380414_1380579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|1380575_1381310_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_157830737.1|1381343_1381886_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|1381797_1382838_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705623.1|1382809_1383361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|1383344_1383572_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|1383648_1384056_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1384320_1384620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171901.1|1384692_1384911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|1384967_1386123_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000394552.1|1386200_1386608_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|1386585_1386819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|1386812_1386980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1387377_1387566_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1387562_1387754_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048547.1|1387846_1390318_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.6e-57
>prophage 82
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1399657	1401672	5397521		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|1399657_1400662_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|1400658_1401672_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 83
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1410082	1420093	5397521		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|1410082_1410700_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|1411304_1411718_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|1411861_1412770_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|1412971_1413985_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001399713.1|1414076_1414982_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|1415094_1415553_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|1415602_1416445_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|1417170_1417848_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|1417847_1418558_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|1418554_1420093_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 84
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1431346	1438150	5397521		Spodoptera_litura_granulovirus(33.33%)	9	NA	NA
WP_001146444.1|1431346_1431577_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_001295620.1|1431846_1432947_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170965.1|1433351_1433459_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000170954.1|1433886_1433994_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|1434142_1434997_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|1435032_1435842_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|1435845_1436238_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|1436234_1437068_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804731.1|1437067_1438150_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 85
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1441286	1444038	5397521		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|1441286_1442234_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|1442358_1444038_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 86
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1470780	1472468	5397521		Salmonella_phage(50.0%)	2	NA	NA
WP_000457619.1|1470780_1472049_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.9e-209
WP_000897378.1|1472048_1472468_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 87
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1489193	1564548	5397521	lysis,tail,tRNA,head,transposase,protease,capsid,terminase,holin,integrase	Enterobacteria_phage(35.62%)	95	1541766:1541783	1573394:1573411
WP_000332303.1|1489193_1489925_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373106.1|1490145_1490550_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|1490602_1490713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399714.1|1491245_1491569_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	66.4	5.5e-43
WP_000444487.1|1491671_1492922_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248692.1|1493093_1493747_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|1493756_1494218_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001370675.1|1494271_1495378_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1495413_1496055_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1496058_1497429_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1497596_1498268_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735415.1|1498267_1499728_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|1499803_1500925_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359448.1|1500973_1502200_-	peptidase T	NA	NA	NA	NA	NA
WP_000531590.1|1502449_1503586_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.2	2.1e-28
WP_000799399.1|1503569_1504433_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001132165.1|1504706_1505297_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144080.1|1505479_1506130_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|1506204_1507263_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|1507390_1508026_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|1508093_1508675_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131642.1|1508965_1509541_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001370649.1|1509654_1509924_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	98.9	1.4e-44
WP_032212660.1|1509925_1511239_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_024174257.1|1511303_1511879_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_101329685.1|1511947_1515424_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.2	0.0e+00
WP_136720099.1|1515659_1516292_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	95.7	1.6e-102
WP_032316709.1|1516237_1516981_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.7	8.0e-146
WP_070081090.1|1516991_1517690_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	1.6e-132
WP_000847306.1|1517689_1518019_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_101329686.1|1518015_1520595_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
WP_000533420.1|1520575_1520989_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000479115.1|1521015_1521447_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143019.1|1521460_1522213_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000683065.1|1522220_1522616_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975030.1|1522612_1523146_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_001204559.1|1523160_1523514_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000201512.1|1523506_1523890_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|1523941_1524970_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256807.1|1525027_1525375_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_001254023.1|1525411_1526917_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_085948186.1|1527613_1528770_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000259002.1|1529762_1529969_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001299181.1|1529952_1531881_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	1.8e-261
WP_001429103.1|1531852_1532359_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	1.5e-34
WP_001307652.1|1532786_1532981_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000092313.1|1533934_1534372_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135302.1|1534368_1534866_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_024164617.1|1534865_1535081_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_001066419.1|1535294_1536851_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|1536870_1537218_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|1537214_1537889_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_101329687.1|1538236_1540087_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_000499454.1|1540384_1540543_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_122986323.1|1540628_1541372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097237.1|1541555_1542245_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
1541766:1541783	attL	TTCGCTCTTCACATCCTG	NA	NA	NA	NA
WP_032160865.1|1542259_1542382_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|1542720_1543680_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028836.1|1543891_1544557_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	3.2e-130
WP_001108066.1|1544553_1545174_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	2.0e-94
WP_000566869.1|1545166_1545337_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001254222.1|1545333_1545516_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000736903.1|1545512_1545953_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145926.1|1546026_1546317_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788869.1|1546313_1547015_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000185425.1|1547011_1547911_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	6.0e-172
WP_000251069.1|1547943_1548237_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|1548355_1548556_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|1548656_1549370_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708835.1|1549497_1550355_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.7	5.8e-39
WP_072097037.1|1550703_1551159_+	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	6.8e-63
WP_000213975.1|1551907_1552108_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_001132915.1|1552293_1552662_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	96.7	1.1e-63
WP_001198859.1|1552734_1552899_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	9.0e-26
WP_000372922.1|1552867_1553032_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	9.3e-23
WP_000995439.1|1553086_1553383_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|1553388_1554174_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186740.1|1554170_1554848_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032204932.1|1554847_1555030_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.2e-28
WP_000548546.1|1555002_1555194_+	DUF1382 family protein	NA	A0A0P0ZC49	Stx2-converting_phage	100.0	4.3e-27
WP_001443983.1|1555204_1555486_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763386.1|1555584_1555806_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_001289864.1|1555802_1556210_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582238.1|1556211_1556967_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	4.2e-142
WP_000208006.1|1556977_1557775_+	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000022062.1|1557889_1558171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|1558259_1558427_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|1558466_1558685_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533662.1|1558662_1559736_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.7	1.3e-200
WP_001399304.1|1559830_1562575_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
WP_000818477.1|1562646_1563720_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1563768_1563942_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|1563931_1564162_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1564136_1564325_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1564335_1564548_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
1573394:1573411	attR	TTCGCTCTTCACATCCTG	NA	NA	NA	NA
>prophage 88
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1578874	1639395	5397521	tail,head,protease,transposase,holin,integrase	Stx2-converting_phage(30.95%)	63	1574043:1574060	1644591:1644608
1574043:1574060	attL	CACCCGTTCCAGTTCGCG	NA	NA	NA	NA
WP_000003671.1|1578874_1579462_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|1579458_1580166_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|1580184_1581978_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001370123.1|1581974_1583093_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_012817749.1|1584209_1584962_+	type III effector	NA	NA	NA	NA	NA
WP_032212659.1|1585087_1585357_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
WP_001090017.1|1591059_1591638_-|tail	tail assembly protein	tail	H6WZM5	Escherichia_phage	93.7	6.6e-87
WP_101329690.1|1593063_1593360_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	90.0	1.4e-45
WP_157830739.1|1594691_1594883_-	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	98.1	9.2e-22
WP_001453698.1|1596662_1596872_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001431923.1|1598458_1598632_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	4.3e-26
WP_157830740.1|1598628_1598853_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	98.5	3.5e-28
WP_101329692.1|1598840_1599248_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.0	4.7e-47
WP_101329693.1|1599402_1599597_-	hypothetical protein	NA	A0A0P0ZBH1	Stx2-converting_phage	100.0	5.0e-15
WP_000347013.1|1601815_1601956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208049.1|1602085_1602199_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	85.7	2.9e-07
WP_085948186.1|1602666_1603822_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000735655.1|1603940_1604165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|1604229_1604436_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_085948186.1|1605429_1606586_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000138558.1|1607042_1607315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|1608546_1609703_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_053897820.1|1610150_1610366_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_101329696.1|1610803_1612654_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.6	0.0e+00
WP_001344632.1|1613096_1613228_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000935558.1|1614115_1615174_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.1	3.8e-189
WP_000917750.1|1615324_1615522_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000762899.1|1615747_1616569_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	8.2e-83
WP_001121083.1|1616565_1616940_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.4e-35
WP_001265272.1|1616952_1618002_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.1e-108
WP_000046991.1|1618003_1618276_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.1	1.9e-12
WP_000756560.1|1618396_1618744_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	81.7	9.2e-44
WP_024174193.1|1618861_1619074_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.5e-28
WP_001278454.1|1619262_1619367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208016.1|1619482_1620352_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_136865621.1|1620362_1620581_-	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.8	7.6e-12
WP_001341423.1|1620586_1621261_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|1621257_1621605_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|1621624_1623181_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_001370098.1|1623184_1623343_-	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	75.6	2.2e-13
WP_000209148.1|1623344_1623563_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000935423.1|1623595_1623808_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_001151187.1|1623913_1624336_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	3.9e-65
WP_000095671.1|1624376_1625339_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693944.1|1625361_1625787_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1625783_1626086_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|1626183_1626555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1626575_1626767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1626768_1627047_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001240334.1|1627399_1627699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|1627841_1628006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560212.1|1628411_1628633_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_000048560.1|1628756_1631228_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|1631289_1631559_+	excisionase	NA	NA	NA	NA	NA
WP_000074974.1|1631527_1632646_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_001113310.1|1632722_1633190_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000824186.1|1633167_1633371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580316.1|1633679_1634474_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759317.1|1634470_1635517_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|1635672_1636494_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291280.1|1636509_1637421_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251388.1|1637449_1638694_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|1638693_1639395_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
1644591:1644608	attR	CGCGAACTGGAACGGGTG	NA	NA	NA	NA
>prophage 89
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1646684	1646942	5397521		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1646684_1646942_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 90
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1659273	1660916	5397521		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267955.1|1659273_1660278_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|1660274_1660916_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 91
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1664188	1665370	5397521		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1664188_1664425_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008538.1|1664635_1665370_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
>prophage 92
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1677727	1678669	5397521		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|1677727_1678669_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 93
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1694553	1694799	5397521		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1694553_1694799_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 94
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1699461	1700382	5397521		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1699461_1700382_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 95
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1709690	1710224	5397521		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1709690_1710224_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 96
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1714358	1715192	5397521		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1714358_1715192_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 97
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1720015	1720804	5397521		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|1720015_1720804_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 98
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1735840	1737941	5397521		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028092.1|1735840_1736335_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	6.5e-51
WP_001370093.1|1736355_1737684_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.5e-232
WP_001273658.1|1737767_1737941_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 99
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1742242	1748701	5397521		Klosneuvirus(33.33%)	6	NA	NA
WP_000420621.1|1742242_1743163_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|1743162_1743468_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000211826.1|1743560_1744160_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063166.1|1744156_1746697_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.3e-70
WP_001370111.1|1746696_1747869_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120109.1|1748008_1748701_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	1.3e-17
>prophage 100
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1751725	1862377	5397521	tail,portal,head,protease,capsid,terminase,holin,integrase	Escherichia_phage(36.67%)	122	1795667:1795685	1841433:1841451
WP_001131653.1|1751725_1752307_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_106420821.1|1752297_1752492_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767049.1|1752436_1752979_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.0	9.3e-51
WP_001023455.1|1753200_1753470_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_101329698.1|1753471_1754785_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_001233099.1|1754849_1755449_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	1.1e-108
WP_101329699.1|1755516_1758996_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000090917.1|1759056_1759689_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_024174194.1|1759625_1760369_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	1.4e-142
WP_032212654.1|1760374_1761073_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_000847306.1|1761072_1761402_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_101329686.1|1761398_1763978_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
WP_000533420.1|1763958_1764372_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000479115.1|1764398_1764830_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143019.1|1764843_1765596_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000683065.1|1765603_1765999_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975030.1|1765995_1766529_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_001204559.1|1766543_1766897_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000201512.1|1766889_1767273_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|1767324_1768353_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256807.1|1768410_1768758_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_001254023.1|1768794_1770300_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_000831794.1|1770289_1771882_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_000259002.1|1771878_1772085_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001370721.1|1772068_1773997_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000235436.1|1773968_1774478_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|1774880_1775105_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001302717.1|1775186_1775501_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1775985_1776171_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000459343.1|1776392_1776530_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	95.6	2.2e-17
WP_000992152.1|1776689_1777223_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_000731198.1|1777273_1777618_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
WP_000284518.1|1777622_1777838_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290231.1|1777914_1778187_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143462.1|1778227_1778407_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_101329700.1|1778542_1780480_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.6	0.0e+00
WP_000466957.1|1780958_1781390_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000261909.1|1781837_1782551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917739.1|1782688_1782886_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	5.7e-27
WP_000265267.1|1783172_1783991_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|1784142_1784514_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|1784503_1784875_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|1784887_1785937_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|1785938_1786217_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|1786384_1786540_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|1786641_1786779_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160651.1|1787144_1787918_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|1788269_1788683_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450862.1|1788698_1789469_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_000788752.1|1789494_1790235_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.0	2.0e-117
WP_072097015.1|1790231_1791356_-	DNA-binding protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000273724.1|1791434_1791890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|1792096_1792522_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|1792505_1792778_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|1792886_1793288_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|1793315_1793507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|1793506_1793794_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|1794070_1794226_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|1794367_1794757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|1794943_1795129_-	hypothetical protein	NA	NA	NA	NA	NA
1795667:1795685	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_000413705.1|1795702_1795891_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1795887_1796079_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_054626455.1|1796172_1798644_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	3.6e-57
WP_000273151.1|1798711_1798954_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001370339.1|1798931_1799951_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000938124.1|1800762_1802124_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023407.1|1802578_1802848_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001230497.1|1804226_1804826_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_001365123.1|1809918_1810617_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_000847306.1|1810616_1810946_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_157830741.1|1812160_1812445_-	hypothetical protein	NA	Q687F3	Enterobacteria_phage	95.6	1.1e-26
WP_000532075.1|1813621_1813930_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000682716.1|1815147_1815546_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974958.1|1815558_1816182_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_101329702.1|1816184_1816466_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	7.9e-46
WP_001097065.1|1816458_1816785_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_000974564.1|1818843_1820346_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|1820345_1820558_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000373410.1|1822672_1823149_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_012816791.1|1823619_1823805_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1824032_1824179_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_000142777.1|1826129_1826309_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001443281.1|1828686_1829013_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_000024329.1|1829608_1830685_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	87.1	3.8e-181
WP_000917767.1|1830836_1831034_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640048.1|1831275_1831806_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|1831814_1832174_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265133.1|1832186_1833236_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|1833237_1833516_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000902696.1|1833683_1833896_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|1834084_1834189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|1834304_1835174_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|1835184_1835448_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|1835699_1835912_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|1835962_1836319_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|1836296_1836758_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|1836754_1837051_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151153.1|1837047_1837470_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001262384.1|1837510_1838581_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	62.2	8.2e-59
WP_000693884.1|1838652_1839078_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000712069.1|1839100_1839397_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|1839520_1839997_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000379585.1|1840312_1840465_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000394568.1|1840476_1840866_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	39.3	1.9e-21
WP_000449182.1|1841611_1841794_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
1841433:1841451	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_001098749.1|1841796_1842000_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000375136.1|1847486_1848146_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_000904442.1|1848236_1848566_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048233.1|1848562_1848841_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000116288.1|1848935_1850126_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|1850183_1850501_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000665217.1|1850545_1850959_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847791.1|1851131_1851794_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|1851889_1852348_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_001295354.1|1852379_1854434_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_001261235.1|1854556_1855003_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000875061.1|1855012_1857175_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000841914.1|1857137_1857767_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|1857985_1858495_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000750419.1|1858851_1859904_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877158.1|1859978_1860431_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156526.1|1860616_1862377_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 101
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1867043	1868951	5397521		Tupanvirus(100.0%)	1	NA	NA
WP_000053123.1|1867043_1868951_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 102
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1884886	1896019	5397521	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090514.1|1884886_1885654_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193847.1|1885860_1888473_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|1888738_1889941_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1890109_1891510_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977914.1|1892111_1893200_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462687.1|1893384_1894575_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|1894796_1895444_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1895470_1896019_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 103
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1910724	1915265	5397521		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1910724_1912473_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705700.1|1912509_1914774_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1914980_1915265_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 104
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1920351	1921440	5397521		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057127.1|1920351_1921440_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.3e-80
>prophage 105
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1925538	1928753	5397521		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|1925538_1927821_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1928012_1928753_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 106
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1935061	1961654	5397521	transposase,tRNA,protease	Stx2-converting_phage(20.0%)	19	NA	NA
WP_000213102.1|1935061_1935679_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	3.8e-77
WP_000850292.1|1935689_1938134_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	3.3e-220
WP_000886683.1|1938372_1939665_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067741.1|1939755_1941099_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	6.2e-80
WP_001370278.1|1941109_1941721_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077046.1|1941875_1946060_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.3e-86
WP_000228473.1|1946194_1946689_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537420.1|1947233_1948199_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043587.1|1948321_1950088_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202187.1|1950088_1951810_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001241678.1|1951851_1952556_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1952840_1953059_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001341423.1|1953740_1954415_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|1954411_1954759_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|1954778_1956335_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000934041.1|1956460_1958737_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1958767_1959088_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1959410_1959635_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188139.1|1959707_1961654_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 107
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1970950	1972669	5397521		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|1970950_1972669_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 108
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1976256	1978994	5397521		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255167.1|1976256_1977087_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1977083_1977407_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|1977532_1978048_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1978265_1978994_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 109
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	1982331	1991481	5397521		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149708.1|1982331_1983459_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	6.0e-28
WP_000389260.1|1983499_1983988_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|1984047_1984893_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105443.1|1984889_1985843_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|1985852_1986986_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126052.1|1987080_1988193_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1988543_1989020_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684320.1|1989107_1990010_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|1990070_1990793_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1990776_1991064_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1991223_1991481_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 110
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2000047	2001250	5397521		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2000047_2001250_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 111
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2012585	2014457	5397521		Planktothrix_phage(100.0%)	1	NA	NA
WP_001370314.1|2012585_2014457_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 112
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2017775	2026117	5397521		Synechococcus_phage(33.33%)	6	NA	NA
WP_001295294.1|2017775_2018438_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	3.3e-26
WP_001370343.1|2018568_2019468_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209377.1|2019473_2021906_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114235.1|2022051_2022867_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168796.1|2023018_2024284_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|2024524_2026117_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 113
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2031114	2036339	5397521		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|2031114_2031630_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|2031682_2031748_-	protein YliM	NA	NA	NA	NA	NA
WP_001370348.1|2031982_2032870_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|2033168_2033672_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|2034075_2034822_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|2034960_2035620_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|2035616_2036339_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 114
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2039878	2054690	5397521		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|2039878_2040139_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430053.1|2040403_2042686_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|2042727_2043405_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|2043478_2043745_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|2044009_2044270_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443508.1|2044498_2045584_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|2045724_2046687_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218655.1|2046714_2048865_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_001145128.1|2048984_2049467_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007101.1|2049698_2051063_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001370323.1|2051291_2051963_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|2051965_2052961_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996092.1|2052953_2054690_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 115
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2066001	2066910	5397521		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|2066001_2066910_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 116
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2073391	2074681	5397521		Klosneuvirus(100.0%)	1	NA	NA
WP_001399447.1|2073391_2074681_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 117
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2085036	2091609	5397521		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891685.1|2085036_2086095_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|2086097_2086787_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113004.1|2086786_2087560_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|2087725_2087875_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|2088003_2088792_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096864.1|2088859_2090332_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|2090592_2091609_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 118
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2095962	2099482	5397521		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|2095962_2097015_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|2097330_2097711_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|2097824_2098766_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|2098762_2099482_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 119
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2135378	2136170	5397521		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|2135378_2136170_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 120
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2139548	2142490	5397521		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|2139548_2141030_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000628032.1|2141071_2142490_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	8.9e-61
>prophage 121
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2147806	2149019	5397521	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_164502361.1|2147806_2149019_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 122
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2155539	2161520	5397521		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000087947.1|2155539_2157588_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	1.9e-27
WP_001344323.1|2157596_2158169_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001370345.1|2158161_2160846_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186093.1|2160842_2161520_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	1.2e-26
>prophage 123
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2168081	2168846	5397521		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|2168081_2168846_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 124
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2173127	2176941	5397521	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|2173127_2174792_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023106.1|2174994_2176941_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 125
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2181707	2183372	5397521		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|2181707_2183372_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 126
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2187506	2188547	5397521		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|2187506_2188547_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 127
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2196443	2199976	5397521		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|2196443_2197169_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|2197286_2198222_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367854.1|2198305_2199976_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	5.2e-76
>prophage 128
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2206914	2209497	5397521	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001370324.1|2206914_2209497_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.5e-183
>prophage 129
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2216507	2218946	5397521		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|2216507_2217596_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|2217734_2218946_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 130
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2223761	2224407	5397521		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|2223761_2224145_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|2224197_2224407_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 131
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2239832	2241947	5397521		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|2239832_2240261_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|2240381_2241947_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 132
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2245056	2246879	5397521		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029813.1|2245056_2246277_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
WP_000502941.1|2246249_2246879_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 133
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2261425	2267468	5397521		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|2261425_2262241_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096742.1|2262237_2263371_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077734.1|2263586_2267468_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
>prophage 134
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2278909	2282053	5397521		Leptospira_phage(100.0%)	1	NA	NA
WP_000573965.1|2278909_2282053_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	9.8e-60
>prophage 135
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2285198	2295296	5397521		Bacillus_phage(33.33%)	5	NA	NA
WP_000770959.1|2285198_2285882_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	3.9e-30
WP_000253818.1|2285871_2287320_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103165.1|2288056_2289958_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.0e-27
WP_001160804.1|2289985_2290447_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_001289076.1|2290466_2295296_+	PAAR domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	39.3	1.6e-16
>prophage 136
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2300371	2388830	5397521	tail,portal,head,tRNA,transposase,protease,capsid,terminase,integrase	Enterobacteria_phage(45.71%)	76	2308852:2308898	2341200:2341246
WP_000420919.1|2300371_2301508_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383947.1|2301776_2304014_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662369.1|2304000_2306973_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|2306973_2307864_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|2308046_2308808_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2308852:2308898	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2309320_2310274_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226375.1|2310460_2311945_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|2312490_2313159_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885574.1|2313213_2313798_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_077633707.1|2313797_2314769_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	89.3	2.1e-37
WP_001230348.1|2316932_2317532_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_085947772.1|2317700_2318914_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000515724.1|2318934_2322276_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_000090891.1|2322336_2322969_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|2322905_2323649_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152565.1|2323654_2324353_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000847371.1|2324352_2324682_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_000840238.1|2324678_2327240_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.7	0.0e+00
WP_000459457.1|2327232_2327667_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479147.1|2327648_2328071_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_001370356.1|2328086_2328827_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_024200945.1|2328834_2329230_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_032212787.1|2329226_2329805_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	86.5	2.3e-79
WP_000752996.1|2329816_2330170_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000158902.1|2330181_2330577_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_000063297.1|2330618_2331644_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.2e-189
WP_001358596.1|2331698_2332031_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_000123282.1|2332040_2333360_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.7	6.3e-226
WP_001370283.1|2333340_2334942_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000198151.1|2334938_2335151_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	95.7	1.6e-27
WP_001027188.1|2335147_2337073_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_029594360.1|2337047_2337572_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.7	2.2e-89
WP_164502361.1|2337629_2338843_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001443983.1|2338899_2339181_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|2339279_2339498_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|2339545_2339824_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001370298.1|2340022_2341186_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	9.8e-199
WP_000805418.1|2341512_2342145_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2341200:2341246	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001396973.1|2342147_2342663_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691047.1|2342673_2343681_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001370299.1|2343693_2346303_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000776558.1|2347244_2347787_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|2348267_2349134_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2349135_2349348_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|2349455_2349977_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|2350012_2351398_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_000256002.1|2351571_2352066_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212252.1|2352068_2352791_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_001295318.1|2352908_2353418_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815538.1|2353414_2354482_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855398.1|2354620_2355514_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001325209.1|2355510_2356326_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000495365.1|2356336_2357596_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000580865.1|2357605_2359273_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000703894.1|2359589_2360639_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001370308.1|2360660_2361896_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_000540996.1|2361906_2362692_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001370319.1|2362919_2364065_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
WP_001370313.1|2364086_2365388_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000006887.1|2365444_2366806_-	allantoinase AllB	NA	NA	NA	NA	NA
WP_000401125.1|2366865_2368320_-	putative allantoin permease	NA	NA	NA	NA	NA
WP_000765839.1|2368488_2369367_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_024230874.1|2369466_2370243_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001370296.1|2370255_2372037_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	6.0e-38
WP_000141275.1|2372126_2372942_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|2373019_2373502_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460145.1|2373731_2374658_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001158006.1|2374726_2375821_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000879785.1|2376822_2377314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000561833.1|2381918_2384333_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|2384329_2385016_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001295836.1|2384986_2385610_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_000148959.1|2385599_2386409_+	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295322.1|2386469_2387324_+	chaperedoxin	NA	NA	NA	NA	NA
WP_001323739.1|2387386_2388166_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001157535.1|2388152_2388830_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 137
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2393369	2396430	5397521		uncultured_virus(50.0%)	2	NA	NA
WP_000083976.1|2393369_2395874_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.4e-114
WP_001370330.1|2396088_2396430_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	9.3e-41
>prophage 138
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2404674	2413236	5397521		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801843.1|2404674_2405634_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250088.1|2405630_2406593_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|2406828_2407473_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|2407653_2409528_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|2409637_2410243_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|2410242_2410572_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122007.1|2410624_2412556_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|2412684_2413236_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 139
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2420244	2423394	5397521		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|2420244_2423394_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 140
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2432229	2435776	5397521		Bacillus_phage(100.0%)	2	NA	NA
WP_001256203.1|2432229_2434011_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	8.9e-42
WP_001235626.1|2434003_2435776_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	5.7e-49
>prophage 141
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2439099	2439795	5397521		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|2439099_2439795_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 142
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2442923	2447970	5397521	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|2442923_2443196_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|2443404_2445759_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|2445946_2447221_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122252.1|2447346_2447970_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 143
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2471676	2480657	5397521	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|2471676_2472147_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150466.1|2472235_2473339_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.9e-53
WP_000543535.1|2473342_2473792_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001370344.1|2473942_2474482_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|2474780_2475665_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974815.1|2475841_2476189_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|2476317_2477289_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|2477299_2479147_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|2479174_2479507_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|2479529_2480657_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 144
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2487609	2497581	5397521		Bacillus_phage(60.0%)	6	NA	NA
WP_000893623.1|2487609_2488905_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113924.1|2488962_2489652_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	8.2e-36
WP_001221312.1|2489841_2491044_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.4e-06
WP_000698922.1|2491040_2494184_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|2494309_2495494_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001298537.1|2496669_2497581_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 145
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2501870	2502986	5397521		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|2501870_2502986_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 146
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2510401	2511559	5397521		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|2510401_2511559_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 147
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2518525	2519293	5397521		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939372.1|2518525_2519293_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 148
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2524592	2525702	5397521		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842084.1|2524592_2525702_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
>prophage 149
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2528981	2530942	5397521		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013519.1|2528981_2529995_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	4.1e-44
WP_000044318.1|2529991_2530942_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
>prophage 150
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2536352	2541809	5397521	transposase	Enterobacteria_phage(33.33%)	3	NA	NA
WP_000805871.1|2536352_2537435_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	4.1e-191
WP_024025881.1|2537557_2540656_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.3	0.0e+00
WP_085948186.1|2540652_2541809_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 151
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2546440	2547340	5397521		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952507.1|2546440_2547340_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
>prophage 152
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2550342	2552229	5397521		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010255.1|2550342_2552229_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	4.1e-53
>prophage 153
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2560605	2565143	5397521		Tupanvirus(50.0%)	4	NA	NA
WP_000692737.1|2560605_2561655_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.1e-71
WP_000750340.1|2561741_2562698_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|2562694_2563666_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|2563658_2565143_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 154
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2577229	2587705	5397521	holin	Escherichia_phage(33.33%)	5	NA	NA
WP_072097009.1|2577229_2581213_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	1.4e-124
WP_000131044.1|2581785_2583819_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|2583947_2584535_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089103.1|2584548_2586021_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159108.1|2586034_2587705_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	3.1e-60
>prophage 155
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2593279	2596584	5397521		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046304.1|2593279_2594605_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474082.1|2594713_2594950_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001399107.1|2594961_2595555_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|2595714_2596584_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
>prophage 156
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2612761	2623359	5397521	transposase	Acinetobacter_phage(40.0%)	9	NA	NA
WP_085948186.1|2612761_2613917_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000070692.1|2614138_2614828_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643328.1|2614824_2615781_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667013.1|2615777_2617976_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.8e-37
WP_000121328.1|2617985_2618942_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|2618920_2619331_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000893273.1|2619647_2620901_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|2620912_2622016_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749879.1|2622303_2623359_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
>prophage 157
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2628036	2629176	5397521		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528863.1|2628036_2629176_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	3.1e-32
>prophage 158
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2634254	2638173	5397521		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543899.1|2634254_2635028_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729706.1|2635213_2635474_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|2635476_2635755_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2635910_2636651_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2636621_2637389_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2637594_2638173_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 159
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2645530	2651998	5397521		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_101329706.1|2645530_2649781_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	2.9e-22
WP_000103286.1|2649856_2651998_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	6.3e-26
>prophage 160
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2662959	2665749	5397521		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000614345.1|2662959_2665749_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	1.1e-81
>prophage 161
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2676226	2684079	5397521		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001297205.1|2676226_2676958_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|2677022_2677490_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|2677486_2678209_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|2678242_2678998_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644675.1|2679069_2680428_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_101329707.1|2680475_2681246_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2681323_2682124_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648545.1|2682364_2683279_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997002.1|2683275_2684079_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	1.6e-38
>prophage 162
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2690739	2691771	5397521		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593995.1|2690739_2691771_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 163
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2704730	2708846	5397521		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294778.1|2704730_2708213_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569433.1|2708249_2708846_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.5	2.1e-27
>prophage 164
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2717674	2718433	5397521		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2717674_2718433_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 165
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2730317	2731742	5397521	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|2730317_2731742_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 166
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2735671	2736016	5397521		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2735671_2736016_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 167
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2741927	2742725	5397521		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2741927_2742725_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 168
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2747967	2754773	5397521	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001399192.1|2747967_2750397_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	5.1e-40
WP_001294703.1|2750470_2751001_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396034.1|2751015_2751720_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2751897_2752353_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937425.1|2752389_2753316_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2753354_2754773_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 169
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2762658	2766896	5397521	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_164502361.1|2762658_2763871_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000805451.1|2764262_2765057_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000905383.1|2765068_2765920_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000339944.1|2765993_2766896_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 170
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2770158	2776781	5397521		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|2770158_2771085_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651602.1|2771193_2771856_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2771896_2772433_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000996827.1|2772638_2775029_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189608.1|2775230_2776781_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 171
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2784333	2785758	5397521		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2784333_2785758_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 172
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2794385	2794937	5397521		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|2794385_2794937_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 173
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2799182	2800226	5397521		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2799182_2800226_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 174
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2826199	2827924	5397521		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425658.1|2826199_2827924_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 175
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2840626	2841325	5397521		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|2840626_2841325_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 176
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2847688	2853111	5397521		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035664.1|2847688_2850040_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.0e-37
WP_001117011.1|2850204_2853111_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 177
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2860843	2862243	5397521		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|2860843_2861686_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_024174212.1|2861763_2862243_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	4.0e-29
>prophage 178
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2870081	2875742	5397521		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|2870081_2871596_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2871626_2872769_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|2872897_2874115_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001297614.1|2874188_2875742_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 179
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2881212	2882361	5397521		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2881212_2882361_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 180
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2886804	2889621	5397521	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286853.1|2886804_2889621_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.0	2.3e-76
>prophage 181
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2896661	2909656	5397521		uncultured_Caudovirales_phage(16.67%)	12	NA	NA
WP_000681368.1|2896661_2897828_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_024174211.1|2898079_2899324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001173014.1|2899453_2900947_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	1.2e-28
WP_001274825.1|2900966_2901728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935262.1|2902282_2902492_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|2902595_2903726_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2903814_2905731_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|2906107_2906512_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|2906537_2907251_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2907399_2907966_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094683.1|2908000_2908588_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|2908702_2909656_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 182
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2917922	2984469	5397521	tail,tRNA,transposase,terminase,holin,integrase	Enterobacteria_phage(31.11%)	70	2939159:2939172	2985437:2985450
WP_001223181.1|2917922_2918609_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|2919008_2919149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|2919244_2919961_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920343.1|2920020_2921373_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|2921430_2922855_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|2922854_2923544_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|2923556_2924030_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|2924240_2925110_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|2925106_2925754_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_024174210.1|2925805_2926318_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068679.1|2926464_2926791_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409459.1|2926880_2928818_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2929028_2930696_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|2931002_2932235_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029696.1|2932255_2933638_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|2933686_2934655_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|2934760_2935405_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105889.1|2935432_2936449_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566153.1|2936480_2936630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224877.1|2936904_2937624_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|2937703_2938927_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477794.1|2938978_2940301_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	3.0e-79
2939159:2939172	attL	GACGCTGTAATCAA	NA	NA	NA	NA
WP_001295412.1|2940427_2941207_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143248.1|2941464_2943015_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088395.1|2942986_2943850_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563078.1|2943962_2944745_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299187.1|2944741_2945815_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|2945936_2946098_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2946224_2946830_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|2947222_2948809_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|2949028_2949277_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001143789.1|2949437_2950079_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	1.4e-106
WP_077633702.1|2950160_2950790_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	8.7e-77
WP_001118085.1|2950857_2951439_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001023428.1|2951549_2951819_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_101329708.1|2951820_2953134_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001216289.1|2953198_2953822_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	2.5e-68
WP_001130973.1|2953889_2954585_-	hypothetical protein	NA	Q6H9T2	Enterobacteria_phage	99.6	8.6e-126
WP_085947772.1|2954610_2955823_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_077760350.1|2955816_2956218_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.7	5.6e-61
WP_001303046.1|2956509_2956875_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|2956916_2957141_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2957222_2957537_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|2958062_2958248_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_032212794.1|2958464_2958962_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	3.8e-91
WP_024164617.1|2958961_2959177_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_085948186.1|2959602_2960759_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_025380439.1|2960881_2962732_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.4	0.0e+00
WP_001370417.1|2963303_2963735_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	99.3	3.5e-69
WP_000799669.1|2964177_2965236_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	2.9e-181
WP_000917724.1|2965386_2965590_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|2965854_2966781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131907.1|2966767_2967316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|2967328_2967670_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001299344.1|2967687_2968677_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001223334.1|2968686_2969202_-	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_085948186.1|2969370_2970526_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000767113.1|2971314_2971704_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|2971700_2972027_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|2972023_2972677_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_024025783.1|2972676_2973171_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
WP_000620698.1|2973981_2974206_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_164502361.1|2974365_2975579_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000515839.1|2976660_2977212_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.9	2.2e-100
WP_001191671.1|2977204_2977465_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	1.2e-40
WP_001311077.1|2977562_2978255_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000008189.1|2979175_2979712_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	4.8e-100
WP_001242716.1|2979702_2980065_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_000206721.1|2980064_2980685_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	92.7	3.6e-115
WP_001218283.1|2983251_2984469_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.5	1.7e-238
2985437:2985450	attR	GACGCTGTAATCAA	NA	NA	NA	NA
>prophage 183
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2992660	2993940	5397521		Salmonella_phage(50.0%)	2	NA	NA
WP_001370442.1|2992660_2993200_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	1.1e-27
WP_000799911.1|2993202_2993940_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 184
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	2997167	3002532	5397521		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|2997167_2998190_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091570.1|2998328_2999243_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410142.1|2999457_3000819_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919567.1|3000867_3002532_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 185
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3022554	3023511	5397521	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181167.1|3022554_3023511_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.3e-60
>prophage 186
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3031023	3031578	5397521		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|3031023_3031578_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 187
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3038146	3039607	5397521		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|3038146_3039607_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 188
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3048734	3050411	5397521		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|3048734_3049331_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|3049808_3050411_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 189
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3053774	3062001	5397521		Escherichia_phage(33.33%)	7	NA	NA
WP_000338800.1|3053774_3054755_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	55.0	1.2e-101
WP_001338066.1|3054762_3054885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168569.1|3054966_3055839_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000177022.1|3056008_3058084_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
WP_000504876.1|3058076_3059420_+	McrC family protein	NA	NA	NA	NA	NA
WP_000148644.1|3059416_3059803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040178.1|3059853_3062001_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
>prophage 190
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3073519	3077951	5397521		Tupanvirus(50.0%)	2	NA	NA
WP_001022619.1|3073519_3074989_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001300770.1|3076931_3077951_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
>prophage 191
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3083080	3092094	5397521	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_001294543.1|3083080_3084583_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|3084701_3085784_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584118.1|3085783_3086884_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|3087150_3088662_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|3088795_3089239_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416382.1|3089238_3092094_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 192
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3100438	3106535	5397521		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013029.1|3100438_3101374_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	6.5e-52
WP_000148581.1|3101386_3101848_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|3101920_3102307_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|3102512_3105209_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|3105349_3105403_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181322.1|3105587_3106535_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	1.8e-12
>prophage 193
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3110174	3112936	5397521		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|3110174_3112313_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|3112471_3112936_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 194
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3117252	3123740	5397521		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|3117252_3118251_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595987.1|3118283_3119279_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001370425.1|3119265_3120288_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205810.1|3120301_3121804_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_101329711.1|3121943_3122900_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|3123209_3123740_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 195
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3165281	3166445	5397521		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943960.1|3165281_3166445_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
>prophage 196
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3170377	3183408	5397521	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076328.1|3170377_3172819_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	8.4e-67
WP_001177644.1|3172857_3173283_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3173487_3174786_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089298.1|3174889_3175087_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3175168_3176173_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3176175_3177435_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|3177520_3178801_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3178876_3179185_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|3179270_3180221_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001370456.1|3180213_3182061_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	1.3e-59
WP_000990308.1|3182070_3183408_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 197
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3187444	3187990	5397521		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3187444_3187990_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 198
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3195971	3196949	5397521		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3195971_3196949_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 199
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3201869	3202403	5397521		Morganella_phage(100.0%)	1	NA	NA
WP_001238375.1|3201869_3202403_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	8.0e-47
>prophage 200
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3206773	3208766	5397521		Vibrio_phage(50.0%)	2	NA	NA
WP_000729116.1|3206773_3208429_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3208472_3208766_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 201
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3217100	3223245	5397521	integrase	Stx2-converting_phage(50.0%)	4	3209008:3209021	3236860:3236873
3209008:3209021	attL	TGCCCAAAATTTGG	NA	NA	NA	NA
WP_001218843.1|3217100_3218366_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001341423.1|3219356_3220031_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|3220027_3220375_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_000603950.1|3222696_3223245_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
3236860:3236873	attR	CCAAATTTTGGGCA	NA	NA	NA	NA
>prophage 202
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3228485	3229475	5397521		Salmonella_phage(100.0%)	1	NA	NA
WP_000953032.1|3228485_3229475_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
>prophage 203
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3242396	3247661	5397521	transposase	Stx2-converting_phage(60.0%)	5	NA	NA
WP_000422707.1|3242396_3242822_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_094185360.1|3243080_3244236_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_001171554.1|3245348_3245729_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3245725_3246073_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997984.1|3246122_3247661_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
>prophage 204
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3253418	3256630	5397521	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856834.1|3253418_3254876_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
WP_001295082.1|3255112_3256630_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 205
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3277826	3279329	5397521		Burkholderia_virus(100.0%)	1	NA	NA
WP_001370445.1|3277826_3279329_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	1.8e-56
>prophage 206
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3284265	3285054	5397521		Cedratvirus(100.0%)	1	NA	NA
WP_001193397.1|3284265_3285054_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 207
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3290632	3292248	5397521		Bacillus_virus(50.0%)	2	NA	NA
WP_001039799.1|3290632_3291391_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
WP_000611423.1|3291567_3292248_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	4.2e-08
>prophage 208
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3298483	3304852	5397521		Staphylococcus_phage(50.0%)	5	NA	NA
WP_000235232.1|3298483_3300016_+	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	5.3e-19
WP_000507106.1|3299994_3300975_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001297586.1|3300985_3301681_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171691.1|3301664_3302594_+	allose kinase	NA	NA	NA	NA	NA
WP_001066010.1|3302866_3304852_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	1.3e-147
>prophage 209
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3310018	3312166	5397521		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3310018_3312166_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 210
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3321562	3323521	5397521		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078252.1|3321562_3323521_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.5e-90
>prophage 211
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3329106	3330456	5397521		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3329106_3330456_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 212
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3334273	3337887	5397521		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|3334273_3334810_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357734.1|3335064_3337887_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	0.0e+00
>prophage 213
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3342094	3399242	5397521	tail,tRNA,head,portal,transposase,capsid,terminase,holin,integrase	Enterobacteria_phage(37.7%)	67	3338606:3338620	3355018:3355032
3338606:3338620	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_001147328.1|3342094_3343174_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|3343226_3344642_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000891404.1|3345873_3346116_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543822.1|3346249_3347287_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332271.1|3347375_3348473_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_001217539.1|3348534_3348783_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_085948186.1|3349230_3350386_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001121225.1|3350643_3351294_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001370118.1|3352535_3352652_-|tail	phage tail fiber C-terminal domain-containing protein	tail	NA	NA	NA	NA
WP_164502361.1|3352635_3353849_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_024174195.1|3353854_3354118_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.2	2.5e-33
WP_032212803.1|3354119_3355433_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
3355018:3355032	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
WP_001230379.1|3355497_3356097_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_032212804.1|3356163_3359556_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	87.8	0.0e+00
WP_077696211.1|3359791_3360427_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_001370115.1|3360372_3361116_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_001299882.1|3361121_3361820_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847401.1|3361819_3362149_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_032212771.1|3362145_3364758_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000533440.1|3364738_3365152_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|3365178_3365601_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|3365614_3366367_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683137.1|3366374_3366770_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_024025847.1|3366766_3367345_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000753019.1|3367356_3367710_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|3367721_3368117_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_024025845.1|3368158_3369184_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_001299443.1|3369239_3369572_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_032212710.1|3369581_3370901_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.6e-232
WP_024026143.1|3370881_3372483_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000198153.1|3372479_3372686_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|3372682_3374608_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3374582_3375128_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3375514_3375739_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3375820_3376135_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3376660_3376846_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539792.1|3377073_3377220_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3377219_3377789_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3378059_3378593_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731221.1|3378643_3378988_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|3378992_3379208_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143128.1|3379357_3381220_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.5	0.0e+00
WP_001339373.1|3382042_3382195_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_085947772.1|3382879_3384093_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001370152.1|3384531_3385521_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_001370224.1|3385572_3385830_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	9.5e-22
WP_000203855.1|3385826_3387227_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
WP_000988265.1|3387223_3388123_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	8.8e-139
WP_000061545.1|3388133_3388958_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	78.4	1.2e-89
WP_000618008.1|3388954_3389179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626861.1|3389175_3389370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001087349.1|3389366_3390533_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	61.1	3.6e-116
WP_000514175.1|3390529_3391114_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	2.1e-56
WP_001231956.1|3391141_3391339_-	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|3391434_3392088_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000135680.1|3392545_3392908_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|3392973_3393798_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_101329727.1|3394136_3395349_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	1.0e-166
WP_000543621.1|3395440_3395776_+	hypothetical protein	NA	U5P0T3	Shigella_phage	97.3	5.7e-59
WP_001242740.1|3395766_3396117_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145671.1|3396113_3396587_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_000829413.1|3396733_3397201_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_001014294.1|3397202_3397394_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001094871.1|3397396_3398131_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001061339.1|3398130_3398703_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093921.1|3398739_3399021_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
WP_000390069.1|3399068_3399242_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	96.5	2.2e-22
>prophage 214
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3404573	3405182	5397521		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3404573_3405182_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 215
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3414411	3415527	5397521		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179162.1|3414411_3415527_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 216
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3440886	3444570	5397521		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|3440886_3444570_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 217
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3460630	3462220	5397521		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|3460630_3462220_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 218
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3467588	3469352	5397521		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|3467588_3467861_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000941125.1|3468047_3468638_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|3468680_3469352_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 219
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3478714	3487043	5397521		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|3478714_3482938_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_001370153.1|3483014_3487043_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 220
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3491159	3494212	5397521		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|3491159_3492344_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|3493261_3494212_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 221
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3502795	3504640	5397521		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591366.1|3502795_3504640_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 222
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3521731	3528978	5397521		Serratia_phage(33.33%)	5	NA	NA
WP_101329714.1|3521731_3524029_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|3524079_3524400_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004448.1|3524414_3525494_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174084.1|3525802_3528304_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|3528315_3528978_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 223
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3546276	3550780	5397521		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|3546276_3547608_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|3547674_3548601_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|3548693_3549179_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|3549263_3549509_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|3549934_3550780_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 224
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3562354	3567215	5397521		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|3562354_3563053_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|3563049_3564423_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|3564528_3565203_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|3565351_3566335_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001295522.1|3566594_3567215_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 225
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3581978	3585029	5397521		Escherichia_phage(100.0%)	1	NA	NA
WP_077637985.1|3581978_3585029_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.2	7.2e-07
>prophage 226
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3602036	3604812	5397521		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001370187.1|3602036_3602915_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	1.6e-47
WP_000196715.1|3603087_3603984_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022286.1|3604023_3604812_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
>prophage 227
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3608696	3611167	5397521		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190579.1|3608696_3609746_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
WP_001188776.1|3609757_3611167_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 228
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3615245	3618032	5397521		uncultured_virus(100.0%)	1	NA	NA
WP_000250048.1|3615245_3618032_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	1.9e-70
>prophage 229
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3631718	3632333	5397521		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|3631718_3632333_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 230
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3641123	3644410	5397521		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|3641123_3641900_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|3641902_3642418_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|3642421_3642691_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|3642769_3644410_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 231
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3658841	3660671	5397521		Catovirus(100.0%)	1	NA	NA
WP_024026058.1|3658841_3660671_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	4.3e-84
>prophage 232
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3668157	3672016	5397521		Bacillus_phage(100.0%)	3	NA	NA
WP_000383411.1|3668157_3670320_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
WP_001213575.1|3670403_3671120_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|3671119_3672016_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 233
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3690493	3696637	5397521		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|3690493_3691624_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|3691628_3692303_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|3692280_3693162_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226587.1|3693180_3694248_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000006625.1|3694247_3695510_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|3695506_3696637_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 234
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3700679	3706091	5397521		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3700679_3701009_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|3701139_3702405_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|3702538_3704023_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238890.1|3704069_3706091_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 235
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3714564	3716211	5397521		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012598.1|3714564_3716211_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	4.8e-66
>prophage 236
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3729511	3735364	5397521		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|3729511_3730402_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|3730426_3731392_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387752.1|3731396_3732902_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|3732909_3733329_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|3733495_3735364_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 237
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3738532	3739525	5397521		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|3738532_3739525_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 238
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3751477	3754839	5397521		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|3751477_3752848_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|3753009_3754839_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 239
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3760369	3764210	5397521		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|3760369_3761410_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|3761496_3762456_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|3762455_3763346_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3763436_3764210_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 240
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3773717	3779253	5397521	transposase	Stx2-converting_phage(75.0%)	6	NA	NA
WP_001066419.1|3773717_3775274_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|3775293_3775641_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|3775637_3776312_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000116772.1|3776545_3777019_-	protein CbrB	NA	NA	NA	NA	NA
WP_000488366.1|3777085_3777751_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000019346.1|3777915_3779253_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 241
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3789450	3796819	5397521		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3789450_3789708_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3789671_3790031_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3790047_3790188_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|3790417_3790498_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|3790794_3792198_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3792202_3793303_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3793302_3794376_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|3794404_3796819_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 242
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3801525	3802674	5397521		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705005.1|3801525_3802674_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 243
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3807101	3808055	5397521		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3807101_3807515_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3807626_3808055_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 244
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3814407	3823568	5397521		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087189.1|3814407_3816123_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	4.3e-41
WP_000828500.1|3816119_3817613_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	26.2	2.7e-31
WP_000511291.1|3817659_3818109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|3818217_3818565_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3818554_3818917_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|3818913_3819411_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|3819418_3820603_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|3821020_3821110_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|3821675_3821774_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168488.1|3821879_3823568_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	2.7e-56
>prophage 245
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3830990	3832325	5397521		Moraxella_phage(100.0%)	1	NA	NA
WP_001058151.1|3830990_3832325_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 246
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3844443	3845835	5397521		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3844443_3845835_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 247
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3850956	3857707	5397521		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|3850956_3853065_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3853083_3853359_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3853413_3854037_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001399398.1|3854294_3855977_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	5.7e-22
WP_001370189.1|3855973_3856591_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001370188.1|3856882_3857707_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 248
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3861080	3865643	5397521		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3861080_3861539_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050159.1|3861516_3862737_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	3.8e-44
WP_001298959.1|3862908_3863577_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|3863793_3864030_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3864050_3864218_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114543.1|3864315_3865125_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|3865163_3865643_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 249
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3873081	3875175	5397521		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364782.1|3873081_3874107_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
WP_000064013.1|3874191_3875175_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 250
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3878574	3888081	5397521		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587764.1|3878574_3879507_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001213834.1|3879720_3880917_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646013.1|3880926_3881952_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
WP_000982106.1|3882190_3883225_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	29.6	3.4e-09
WP_000483859.1|3883211_3884171_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|3884174_3885458_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|3885467_3887012_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3887256_3887688_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3887829_3888081_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 251
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3910187	3919931	5397521	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_136719529.1|3910187_3910946_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.9	1.2e-16
WP_000460276.1|3911077_3911479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015193.1|3911492_3915764_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.8	4.3e-26
WP_000779792.1|3915992_3916601_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|3916698_3918090_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582456.1|3918086_3919931_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 252
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3950977	3951973	5397521		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|3950977_3951973_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 253
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3956197	3956410	5397521		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3956197_3956410_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 254
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3960064	3962398	5397521		Escherichia_phage(100.0%)	1	NA	NA
WP_000013959.1|3960064_3962398_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 255
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	3972444	3974429	5397521		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196496.1|3972444_3973428_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
WP_000107042.1|3973424_3974429_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
>prophage 256
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4020926	4021574	5397521		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|4020926_4021574_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 257
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4026455	4028590	5397521		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|4026455_4026881_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|4026893_4028183_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|4028236_4028590_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 258
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4031935	4033978	5397521		Indivirus(100.0%)	1	NA	NA
WP_001370219.1|4031935_4033978_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	2.3e-46
>prophage 259
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4047583	4053480	5397521		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000149120.1|4047583_4050319_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001343434.1|4050318_4051443_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001259383.1|4051515_4051791_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.1e-15
WP_000593555.1|4051787_4052147_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|4052266_4052668_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173673.1|4052673_4053480_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
>prophage 260
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4061373	4065505	5397521		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|4061373_4062039_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|4062259_4062505_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106567.1|4062606_4064805_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.0	7.2e-118
WP_000964718.1|4064878_4065505_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 261
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4068508	4071327	5397521		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|4068508_4069177_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|4069169_4070228_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|4070472_4071327_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 262
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4077060	4078543	5397521		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082110.1|4077060_4077828_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|4077829_4078543_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 263
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4082084	4083895	5397521		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|4082084_4083155_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073599.1|4083151_4083895_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 264
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4103904	4106352	5397521		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4103904_4106352_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 265
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4115580	4116807	5397521		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|4115580_4116807_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 266
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4121186	4123580	5397521		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081874.1|4121186_4123580_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 267
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4129614	4130493	5397521		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|4129614_4130493_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 268
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4137056	4140823	5397521		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|4137056_4137776_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|4137772_4139125_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|4139200_4140823_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 269
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4157798	4158635	5397521		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|4157798_4158635_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 270
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4182863	4192404	5397521		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|4182863_4183427_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963792.1|4183512_4184733_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|4184799_4186890_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|4186940_4187573_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|4187874_4188279_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|4188333_4189203_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|4189256_4189475_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057359.1|4189468_4190491_-	hydrolase	NA	NA	NA	NA	NA
WP_000634793.1|4190490_4192404_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 271
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4197974	4203548	5397521		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|4197974_4198361_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|4198360_4198720_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|4198727_4199015_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|4199140_4199515_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|4199611_4200082_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|4200178_4202293_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|4202363_4203548_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 272
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4223425	4224897	5397521	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004454.1|4223425_4224373_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|4224387_4224897_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 273
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4235232	4239386	5397521		Bacillus_virus(50.0%)	4	NA	NA
WP_000078310.1|4235232_4235991_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.5e-19
WP_001370241.1|4235998_4237102_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019674.1|4237111_4238293_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|4238360_4239386_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 274
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4245890	4246775	5397521		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258890.1|4245890_4246775_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	3.8e-25
>prophage 275
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4258096	4259140	5397521		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4258096_4259140_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 276
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4275636	4278161	5397521	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497724.1|4275636_4276704_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001370190.1|4276793_4278161_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 277
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4282127	4282625	5397521	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|4282127_4282625_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 278
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4286329	4291062	5397521		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|4286329_4287820_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|4287867_4288557_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209021.1|4288553_4289429_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979880.1|4289425_4289890_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445157.1|4289949_4291062_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 279
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4297811	4312594	5397521		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|4297811_4298741_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|4298836_4301173_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|4301402_4302056_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|4302052_4302781_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|4302777_4303410_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|4303623_4303896_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|4303892_4304747_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183675.1|4304792_4305272_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|4305389_4305677_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|4305699_4307133_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224098.1|4307180_4307906_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669787.1|4307912_4308470_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|4308438_4309014_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|4309010_4309577_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|4309597_4310584_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922859.1|4310597_4311575_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|4311784_4312594_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 280
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4316662	4318140	5397521		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|4316662_4316941_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|4317168_4318140_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 281
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4324768	4327641	5397521	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|4324768_4326703_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|4326792_4327641_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 282
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4331724	4338363	5397521		Dickeya_phage(50.0%)	4	NA	NA
WP_000207685.1|4331724_4333068_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|4333698_4334151_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|4334178_4335666_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133060.1|4335690_4338363_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 283
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4343844	4345734	5397521		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|4343844_4345734_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 284
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4351561	4359354	5397521		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|4351561_4351864_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449043.1|4351914_4352358_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|4352337_4352856_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001343556.1|4352983_4353619_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147624.1|4353691_4354732_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|4354845_4355421_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|4355430_4356021_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246824.1|4356040_4356436_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249142.1|4356393_4358430_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809264.1|4358493_4359354_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.0	2.5e-50
>prophage 285
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4382352	4383498	5397521		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|4382352_4383498_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 286
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4391807	4394102	5397521		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|4391807_4394102_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 287
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4404216	4470014	5397521	tRNA,transposase,protease,holin,integrase	Stx2-converting_phage(26.32%)	57	4410936:4410951	4463078:4463093
WP_000785722.1|4404216_4404621_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031415.1|4404623_4404929_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001297156.1|4404966_4405335_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_001166768.1|4405481_4405865_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422149.1|4405868_4406531_-	DedA family protein	NA	NA	NA	NA	NA
WP_000406488.1|4406875_4407652_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_000755097.1|4408686_4409187_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000358674.1|4409278_4411963_+	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
4410936:4410951	attL	ACGGTGGCGATAACGA	NA	NA	NA	NA
WP_001245991.1|4411959_4413045_+	minor pilin and initiator	NA	NA	NA	NA	NA
WP_001226463.1|4413132_4414431_-	hexuronate transporter ExuT	NA	NA	NA	NA	NA
WP_000187444.1|4414913_4416326_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_001199376.1|4416340_4417828_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_101329717.1|4417910_4418462_+	YgjV family protein	NA	NA	NA	NA	NA
WP_000211655.1|4418466_4419711_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098806.1|4420103_4421069_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
WP_001297165.1|4421351_4422338_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000942583.1|4422416_4423109_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_001295542.1|4423185_4423689_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000018685.1|4423773_4424910_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000550189.1|4425194_4425509_+	type II toxin-antitoxin system toxin HigB	NA	NA	NA	NA	NA
WP_000560266.1|4425505_4425922_+	type II toxin-antitoxin system antitoxin HigA	NA	NA	NA	NA	NA
WP_000121472.1|4425966_4427985_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000695479.1|4428310_4430662_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_000767669.1|4430678_4431749_-	protein YgjJ	NA	NA	NA	NA	NA
WP_001285446.1|4431882_4433316_-	amino acid permease	NA	NA	NA	NA	NA
WP_001219954.1|4433378_4433828_-	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
WP_001082882.1|4433824_4436917_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
WP_000212475.1|4437100_4438084_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|4438302_4438635_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001301395.1|4438676_4440056_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
WP_000094682.1|4440473_4441994_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|4442147_4442771_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065895.1|4443047_4443812_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000290297.1|4444108_4445425_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
WP_000268401.1|4445554_4446151_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
WP_000248065.1|4446243_4447857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270113.1|4448586_4448814_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000335713.1|4448909_4450343_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282106.1|4451355_4451919_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233443.1|4452073_4454434_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
WP_000035067.1|4454451_4454640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101329718.1|4454706_4456245_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	6.7e-296
WP_000612591.1|4456294_4456642_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001066419.1|4456900_4458457_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|4458476_4458824_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4458820_4459495_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_164502361.1|4459599_4460813_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000301248.1|4461083_4461659_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|4461727_4462306_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|4462354_4463395_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
4463078:4463093	attR	ACGGTGGCGATAACGA	NA	NA	NA	NA
WP_000007449.1|4463417_4463873_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|4463895_4465053_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|4465052_4465634_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|4465956_4467015_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|4467024_4468167_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|4468159_4468933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|4468934_4470014_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 288
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4473673	4475215	5397521	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_001370715.1|4473673_4475215_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.8	3.9e-78
>prophage 289
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4478285	4478426	5397521		Escherichia_phage(100.0%)	1	NA	NA
WP_001135714.1|4478285_4478426_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
>prophage 290
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4483696	4484852	5397521	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948186.1|4483696_4484852_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 291
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4492755	4499929	5397521	protease,transposase	Stx2-converting_phage(80.0%)	5	NA	NA
WP_001034023.1|4492755_4496847_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_137413819.1|4497093_4497321_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	78.4	1.4e-24
WP_001341423.1|4497334_4498009_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|4498005_4498353_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|4498372_4499929_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
>prophage 292
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4508694	4512620	5397521		Pseudomonas_phage(66.67%)	5	NA	NA
WP_001243192.1|4508694_4510473_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.2	5.2e-26
WP_001164974.1|4511031_4511277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855068.1|4511370_4511844_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	2.5e-12
WP_001186728.1|4511859_4512336_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692312.1|4512398_4512620_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 293
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4516049	4521408	5397521	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_000437371.1|4516049_4517891_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|4518085_4519831_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|4519941_4520157_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|4520394_4521408_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 294
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4527791	4529030	5397521	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708503.1|4527791_4529030_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.3e-92
>prophage 295
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4534167	4535601	5397521		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869175.1|4534167_4535601_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	2.3e-40
>prophage 296
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4541355	4542569	5397521	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_101329727.1|4541355_4542569_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	1.0e-166
>prophage 297
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4546427	4557389	5397521		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|4546427_4547081_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|4547341_4547512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314167.1|4547569_4548343_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001299419.1|4548485_4549274_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442870.1|4549311_4550472_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	4.5e-87
WP_000831543.1|4550477_4551149_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735279.1|4551296_4552778_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917130.1|4552982_4553612_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	33.0	4.6e-17
WP_000833393.1|4553612_4554035_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|4554059_4554887_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|4554886_4555468_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|4555496_4557389_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 298
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4562346	4573169	5397521		Stx_converting_phage(25.0%)	8	NA	NA
WP_000712658.1|4562346_4562739_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183502.1|4562791_4563274_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_001281881.1|4563818_4566077_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|4566309_4567047_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|4567121_4568534_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095155.1|4568644_4570864_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|4570906_4571164_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000013149.1|4572341_4573169_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 299
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4579245	4580130	5397521		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|4579245_4580130_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 300
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4603477	4604691	5397521	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_164502361.1|4603477_4604691_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 301
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4638391	4643555	5397521	transposase	Klebsiella_phage(25.0%)	7	NA	NA
WP_000692312.1|4638391_4638613_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186728.1|4638675_4639152_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855068.1|4639167_4639641_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	2.5e-12
WP_032212706.1|4639734_4639980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|4640293_4641507_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001323667.1|4641569_4641848_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000491536.1|4642679_4643555_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	80.8	6.6e-131
>prophage 302
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4654329	4655868	5397521		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|4654329_4655868_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 303
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4679410	4699430	5397521	transposase,integrase	Stx2-converting_phage(60.0%)	21	4684081:4684094	4699620:4699633
WP_001145628.1|4679410_4680049_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
WP_000953521.1|4680340_4681705_+	EspK/GogB family type III secretion system effector	NA	Q9MBM1	Phage_Gifsy-1	29.5	7.3e-52
WP_101329727.1|4682717_4683931_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	1.0e-166
4684081:4684094	attL	TATGAATTTGGTGC	NA	NA	NA	NA
WP_024174206.1|4684219_4684912_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001341423.1|4685008_4685683_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|4685679_4686027_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|4686046_4687603_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000014512.1|4687620_4687779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839246.1|4687863_4688061_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000777666.1|4688072_4688561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854916.1|4688557_4688935_-	toxin	NA	NA	NA	NA	NA
WP_024174207.1|4688981_4689356_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692312.1|4689518_4689740_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000624681.1|4691258_4691609_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000422707.1|4691605_4692031_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_096855415.1|4693535_4693778_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	8.6e-41
WP_001066419.1|4693806_4695363_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|4695382_4695730_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4695726_4696401_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000997984.1|4696509_4698048_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_001218843.1|4698164_4699430_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
4699620:4699633	attR	TATGAATTTGGTGC	NA	NA	NA	NA
>prophage 304
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4725275	4726430	5397521		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4725275_4726430_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 305
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4740723	4741401	5397521		Bacillus_virus(100.0%)	1	NA	NA
WP_000956863.1|4740723_4741401_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	8.4e-09
>prophage 306
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4759406	4760639	5397521		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4759406_4760639_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 307
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4769167	4774540	5397521		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195087.1|4769167_4772041_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	1.8e-262
WP_000951948.1|4772306_4773050_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001343615.1|4773106_4774540_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	5.7e-31
>prophage 308
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4778345	4793736	5397521	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|4778345_4779242_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715231.1|4779265_4779976_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813212.1|4779981_4781715_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|4781805_4782903_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|4782913_4784431_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192815.1|4784473_4785022_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|4785076_4785148_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|4785144_4785270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356278.1|4785271_4786720_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001399354.1|4787155_4789075_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|4789074_4789563_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|4789598_4790966_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001370233.1|4791001_4792318_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|4792335_4793736_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 309
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4818196	4818952	5397521		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|4818196_4818952_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 310
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4824695	4827190	5397521		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|4824695_4825457_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256437.1|4825771_4827190_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 311
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4836821	4843594	5397521		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4836821_4837535_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|4837603_4838293_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4838977_4839508_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|4839520_4841767_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4841917_4842793_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4842799_4843594_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 312
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4849071	4864457	5397521	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138171.1|4849071_4851960_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.8	8.1e-69
WP_001285996.1|4851952_4855495_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.2e-08
WP_000775946.1|4855494_4857321_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237947.1|4857382_4858714_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4858945_4860199_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|4860777_4861875_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|4861951_4862758_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184246.1|4862808_4863252_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001370229.1|4863251_4864457_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
>prophage 313
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4875983	4876739	5397521		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|4875983_4876739_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 314
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4881597	4882446	5397521		Vibrio_phage(100.0%)	1	NA	NA
WP_000100420.1|4881597_4882446_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 315
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4889980	4894095	5397521		Hokovirus(50.0%)	2	NA	NA
WP_000186458.1|4889980_4892737_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	4.9e-55
WP_000046788.1|4892793_4894095_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.1e-38
>prophage 316
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4898127	4903048	5397521		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210891.1|4898127_4899765_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	3.0e-153
WP_000036723.1|4899852_4901151_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001288227.1|4902097_4902238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|4902376_4903048_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 317
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4907460	4908246	5397521		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|4907460_4908246_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 318
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4922965	4924178	5397521	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_101329727.1|4922965_4924178_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	1.0e-166
>prophage 319
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4933286	4935319	5397521		Hokovirus(50.0%)	2	NA	NA
WP_001090329.1|4933286_4934714_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	4.8e-30
WP_001173673.1|4934713_4935319_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 320
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4938431	4942147	5397521		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|4938431_4939193_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4939186_4939813_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272586.1|4939952_4941092_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4941154_4942147_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 321
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4947332	4954472	5397521		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4947332_4947971_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590409.1|4947967_4949230_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_000847985.1|4949226_4950135_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4950330_4951098_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141315.1|4951148_4951805_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	4.3e-50
WP_001272924.1|4951910_4954472_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 322
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4973862	4974873	5397521		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001343660.1|4973862_4974873_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	2.3e-26
>prophage 323
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4982348	4983314	5397521		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|4982348_4983314_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 324
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	4988780	4994340	5397521	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132235.1|4988780_4989278_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.5e-31
WP_000963143.1|4989357_4990419_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4990661_4991162_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|4991289_4993920_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4994154_4994340_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 325
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5007390	5012683	5397521		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|5007390_5008593_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|5008947_5009907_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246504.1|5009916_5012061_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	1.7e-196
WP_000080959.1|5012033_5012441_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.7	2.7e-18
WP_001223227.1|5012437_5012683_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 326
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5016618	5020743	5397521		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|5016618_5017068_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|5017068_5017731_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001370203.1|5017751_5019152_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|5019462_5020743_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 327
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5030337	5030526	5397521		Salmonella_phage(100.0%)	1	NA	NA
WP_072097055.1|5030337_5030526_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	69.2	9.1e-06
>prophage 328
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5036045	5134852	5397521	tail,tRNA,head,transposase,capsid,terminase,holin,integrase	Stx2-converting_phage(40.0%)	85	5028632:5028648	5052260:5052276
5028632:5028648	attL	TTGAAACTTTACAAAAA	NA	NA	NA	NA
WP_001234104.1|5036045_5037257_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000998846.1|5037249_5037471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370696.1|5037479_5038613_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_085948186.1|5039553_5040710_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_024174260.1|5041793_5042189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000413407.1|5042303_5042717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101329722.1|5043112_5044348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424040.1|5046852_5048511_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	98.7	0.0e+00
WP_000844622.1|5048512_5049481_+	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	98.8	2.3e-185
WP_001258395.1|5049480_5050341_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	97.2	8.6e-160
WP_001064807.1|5050567_5050825_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.2e-34
WP_001205467.1|5050824_5051175_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.1	6.8e-55
WP_101329723.1|5051226_5052117_+	DNA adenine methylase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	29.0	4.9e-17
WP_000101315.1|5052163_5053567_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
5052260:5052276	attR	TTTTTGTAAAGTTTCAA	NA	NA	NA	NA
WP_001344632.1|5054197_5054329_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000143014.1|5054771_5056625_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	95.9	0.0e+00
WP_097456468.1|5056908_5057124_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	6.5e-32
WP_000731236.1|5057128_5057473_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|5057523_5058057_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_047091958.1|5058574_5058760_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000736096.1|5058845_5059070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095749.1|5059438_5059666_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000958402.1|5060352_5060916_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001399696.1|5060912_5062574_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000173032.1|5062637_5064575_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001063025.1|5064619_5064841_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|5067367_5067694_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|5067704_5068055_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|5068051_5068498_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|5068494_5068839_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275482.1|5068904_5069621_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	99.2	6.2e-127
WP_000710949.1|5069635_5070010_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|5070105_5070315_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212947.1|5070366_5073609_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|5073601_5073943_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_032212666.1|5073942_5074641_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_032212700.1|5074651_5075395_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_122994351.1|5075340_5075973_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.3	1.2e-97
WP_000649829.1|5076160_5076688_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_032212697.1|5076821_5080295_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.3	0.0e+00
WP_032212696.1|5080361_5080961_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	98.5	1.4e-108
WP_101329724.1|5081025_5082240_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	95.3	9.6e-80
WP_001023386.1|5082241_5082511_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_115801847.1|5082617_5082707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370516.1|5082726_5085075_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001370486.1|5085666_5089068_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_000938111.1|5089444_5090806_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000162574.1|5092560_5093043_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|5093174_5093651_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|5093640_5093931_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|5093992_5094334_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|5094482_5096144_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|5096229_5097108_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001307957.1|5097230_5097824_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_024026167.1|5097878_5099165_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|5099185_5099977_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|5100143_5101505_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|5101642_5101891_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|5101909_5102458_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|5102488_5103256_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|5103297_5103645_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|5103721_5104204_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001212391.1|5105435_5105954_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001370532.1|5106103_5106469_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|5106677_5107748_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|5107758_5108880_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|5108922_5110083_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|5110181_5110229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|5110332_5110674_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197674.1|5110944_5111682_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079092.1|5111816_5112797_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040122.1|5112793_5113525_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|5113654_5116228_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|5122001_5123300_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|5123296_5123620_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|5123665_5125021_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082964.1|5125134_5127795_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001370531.1|5127826_5128525_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|5128593_5129013_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|5129219_5130257_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|5130304_5130994_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|5131298_5131682_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|5131737_5132325_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001370459.1|5132427_5133309_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|5133517_5134852_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 329
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5140605	5144348	5397521		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|5140605_5142405_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002528.1|5142420_5143395_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|5143667_5144348_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 330
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5147807	5148068	5397521		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|5147807_5148068_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 331
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5152186	5163494	5397521		Bacillus_phage(50.0%)	7	NA	NA
WP_000970075.1|5152186_5156074_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_001298980.1|5156649_5158077_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_001215866.1|5158241_5158955_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_101329725.1|5158944_5160279_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|5160339_5160678_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883083.1|5160722_5161913_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919163.1|5162240_5163494_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 332
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5169252	5170764	5397521		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493439.1|5169252_5170764_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	2.8e-12
>prophage 333
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5185928	5192385	5397521		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|5185928_5187143_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|5187170_5187557_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|5187573_5187897_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|5187992_5188508_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196586.1|5188524_5190375_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.4	3.6e-102
WP_001124469.1|5190376_5190712_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|5190723_5190924_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133580.1|5191101_5192385_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
>prophage 334
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5202270	5202702	5397521		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|5202270_5202702_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 335
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5211531	5218016	5397521		Escherichia_phage(66.67%)	7	NA	NA
WP_000937933.1|5211531_5212902_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|5213063_5214530_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|5214598_5216176_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|5216270_5216810_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_001295476.1|5216825_5217344_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|5217654_5217846_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017551.1|5217863_5218016_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	6.4e-18
>prophage 336
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5224262	5228264	5397521		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|5224262_5224901_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|5224900_5225938_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|5226262_5226889_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|5226974_5228264_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 337
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5249296	5250010	5397521		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|5249296_5250010_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 338
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5268070	5269021	5397521		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|5268070_5269021_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 339
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5287669	5292753	5397521		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|5287669_5288539_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|5288752_5289178_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001399260.1|5289164_5289614_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838944.1|5289820_5290396_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|5290491_5291391_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_024026008.1|5291448_5292753_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	2.1e-08
>prophage 340
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5296231	5297023	5397521		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|5296231_5297023_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 341
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5300040	5311734	5397521		Streptococcus_phage(40.0%)	11	NA	NA
WP_000021016.1|5300040_5301138_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
WP_001297645.1|5301271_5302183_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|5302185_5302554_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096647.1|5302658_5303510_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|5303551_5304061_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623149.1|5304101_5305829_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_032210422.1|5305873_5306131_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|5306514_5307486_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|5307670_5308432_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|5308661_5309648_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|5309718_5311734_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 342
NZ_CP022407	Escherichia coli O121:H19 strain 16-9255 chromosome, complete genome	5397521	5314950	5396607	5397521	tRNA,transposase,protease,holin,integrase	Escherichia_phage(61.54%)	95	5307285:5307300	5359528:5359543
5307285:5307300	attL	GTTCAACCAGTTCAAC	NA	NA	NA	NA
WP_000695657.1|5314950_5316366_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001341599.1|5316416_5316788_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001296278.1|5316810_5317155_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000497400.1|5317789_5319979_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_000376337.1|5320028_5321231_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186369.1|5321566_5322805_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_000490072.1|5322945_5323272_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000903101.1|5323386_5324643_-	ion channel protein	NA	NA	NA	NA	NA
WP_000170346.1|5324846_5325812_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|5326031_5326358_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000985336.1|5326379_5327627_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000173242.1|5327641_5328727_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000366042.1|5328726_5329764_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000955921.1|5329788_5332278_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000646844.1|5332280_5333138_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001295458.1|5333150_5333885_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000544359.1|5333899_5335597_-	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_000785937.1|5335973_5337212_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|5337276_5337348_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484404.1|5337703_5338624_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_000639883.1|5338976_5339219_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867625.1|5339295_5339571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825604.1|5339866_5340499_+	YfdX family protein	NA	NA	NA	NA	NA
WP_000106759.1|5341011_5342262_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_001283499.1|5342315_5344010_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|5344079_5345024_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001370527.1|5345097_5346240_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001399259.1|5346295_5349889_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	8.6e-36
WP_000991370.1|5349893_5350508_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_000435167.1|5350923_5352087_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001123013.1|5352086_5353625_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000426427.1|5353732_5355061_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000556048.1|5355078_5356416_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_001300996.1|5356633_5357569_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_001218308.1|5357934_5359104_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|5359087_5359270_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994804.1|5359348_5359735_-	DUF1627 domain-containing protein	NA	A0A2L1IV77	Escherichia_phage	100.0	4.6e-52
5359528:5359543	attR	GTTGAACTGGTTGAAC	NA	NA	NA	NA
WP_001291844.1|5359770_5359983_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000609349.1|5360223_5360892_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	95.2	1.1e-104
WP_000002101.1|5360940_5361225_-	ASCH domain-containing protein	NA	A0A0P0ZDM1	Stx2-converting_phage	97.9	7.7e-49
WP_000969524.1|5361224_5361485_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
WP_000628763.1|5361481_5362357_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	86.1	5.4e-141
WP_000224734.1|5362870_5363068_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_085948186.1|5363152_5364308_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_172952818.1|5364349_5364487_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	81.0	8.6e-14
WP_164502361.1|5364532_5365746_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001014298.1|5366115_5366307_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|5366308_5366716_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000812196.1|5366712_5367321_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	93.6	1.0e-82
WP_001370500.1|5367317_5367482_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_001111288.1|5367492_5367789_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_000073097.1|5367812_5368400_-	hypothetical protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
WP_000536228.1|5368396_5369077_-	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000613346.1|5369085_5369274_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|5369270_5369384_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_001198858.1|5369376_5369517_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065353.1|5369589_5369958_-	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
WP_157830745.1|5370138_5370624_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	93.7	3.2e-79
WP_164502361.1|5370661_5371874_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_101329727.1|5372025_5373238_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	1.0e-166
WP_001370067.1|5373399_5373741_-	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_000708836.1|5374189_5375047_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.7	5.8e-39
WP_000885926.1|5375194_5375536_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000250472.1|5375596_5376304_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	1.5e-133
WP_001180318.1|5376382_5376610_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438537.1|5376716_5377016_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_001244621.1|5377038_5377311_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000431329.1|5377373_5378261_+	replication protein	NA	G9L680	Escherichia_phage	99.7	2.8e-145
WP_001248397.1|5378257_5380651_+	DNA helicase	NA	G9L681	Escherichia_phage	99.7	0.0e+00
WP_001036028.1|5380647_5380917_+	hypothetical protein	NA	G9L682	Escherichia_phage	100.0	2.9e-45
WP_000818843.1|5380989_5381196_+	hypothetical protein	NA	G9L683	Escherichia_phage	100.0	2.7e-27
WP_000103680.1|5381340_5381556_+	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001229012.1|5381729_5382146_+	recombination protein NinB	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000573864.1|5382138_5382741_+	HNH endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_000153293.1|5382737_5383265_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
WP_001254258.1|5383261_5383456_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000201604.1|5383712_5384078_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	96.7	3.7e-43
WP_000178727.1|5384343_5385018_+	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.8	6.2e-113
WP_001004008.1|5385092_5385815_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_001108009.1|5385814_5386420_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	98.0	2.4e-95
WP_000144767.1|5386416_5386611_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|5386603_5387038_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|5387286_5387439_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|5387821_5388781_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|5388792_5389062_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_101329728.1|5389548_5391486_+	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.5	0.0e+00
WP_000143462.1|5391621_5391801_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290216.1|5391841_5392114_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	3.1e-23
WP_000284510.1|5392190_5392406_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087714.1|5392410_5392944_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056887.1|5393218_5393788_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	2.6e-104
WP_000455406.1|5393787_5393937_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_012816791.1|5394164_5394350_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001109019.1|5394577_5395129_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_164502361.1|5395393_5396607_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
