The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	657890	667781	4246605		Synechococcus_phage(50.0%)	9	NA	NA
WP_014417100.1|657890_659183_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_014417101.1|659258_659978_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	1.7e-47
WP_014417102.1|659977_660232_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_014417103.1|660228_660912_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014417104.1|660895_663124_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	4.2e-158
WP_014417105.1|663099_664530_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_014417106.1|664621_665662_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	1.8e-63
WP_007408902.1|665658_666246_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_014417107.1|666242_667781_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	3.3e-77
>prophage 2
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	1217459	1229476	4246605	terminase,portal,holin	uncultured_Caudovirales_phage(40.0%)	20	NA	NA
WP_087920760.1|1217459_1218596_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1218585_1218720_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_014417515.1|1218862_1219816_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1219853_1220231_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_014417516.1|1220340_1220946_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_014417517.1|1221068_1221659_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1221807_1222146_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_014417518.1|1222336_1222516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417519.1|1222505_1223333_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	50.0	5.8e-20
WP_014417520.1|1223232_1224033_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_014417522.1|1224297_1224639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1224628_1224832_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_012117362.1|1224938_1225451_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.9e-22
WP_014417523.1|1225563_1226223_+|terminase	terminase	terminase	A0A1B1P867	Bacillus_phage	33.3	3.4e-07
WP_014417525.1|1226600_1226972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610833.1|1226976_1227174_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_014417526.1|1227230_1227992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1228043_1228307_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1228320_1228584_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_007407257.1|1228597_1229476_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 3
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	1484831	1498444	4246605	tail,integrase	Bacillus_phage(66.67%)	11	1482314:1482328	1497776:1497790
1482314:1482328	attL	AACAGAACCGTTATC	NA	NA	NA	NA
WP_101293903.1|1484831_1491677_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	69.0	0.0e+00
WP_101293904.1|1492422_1493556_-	GIY-YIG nuclease family protein	NA	J7KF35	Aeromonas_phage	57.1	2.6e-10
WP_101293905.1|1493730_1494609_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	25.3	3.3e-13
WP_072589059.1|1494734_1494944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101293906.1|1494989_1495274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589061.1|1495372_1495582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589062.1|1495578_1495875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293907.1|1496103_1496583_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	68.4	1.3e-56
WP_014471786.1|1496579_1496741_-	XkdX family protein	NA	NA	NA	NA	NA
WP_101293908.1|1496741_1497125_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	66.7	3.2e-37
WP_101293909.1|1497121_1498444_-	hypothetical protein	NA	Q9ZXE1	Bacillus_phage	71.8	2.0e-51
1497776:1497790	attR	AACAGAACCGTTATC	NA	NA	NA	NA
>prophage 4
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	1826891	1833105	4246605		Bacillus_phage(50.0%)	7	NA	NA
WP_014417834.1|1826891_1827284_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	5.0e-30
WP_007611605.1|1827243_1829346_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|1829363_1830353_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_014417835.1|1830401_1831022_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	5.4e-47
WP_007410370.1|1831071_1831830_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
WP_014417836.1|1831863_1832088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014721211.1|1832136_1833105_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 5
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	1843041	1881847	4246605	tail,integrase,holin	Bacillus_phage(82.76%)	39	1843543:1843560	1878463:1878480
WP_014417844.1|1843041_1843530_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	89.4	5.2e-85
1843543:1843560	attL	ATATAAAGAGATTGCAGA	NA	NA	NA	NA
WP_076982784.1|1844416_1844506_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_041481757.1|1844741_1844945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417846.1|1845074_1845848_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_014417847.1|1846075_1846408_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	1.1e-41
WP_014417848.1|1846400_1847651_+	UV-damage repair protein uvrX	NA	O64031	Bacillus_phage	91.1	2.0e-221
WP_014417849.1|1847814_1848975_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.0	8.4e-33
WP_014721218.1|1849126_1849387_-	collagen-like protein	NA	NA	NA	NA	NA
WP_014417851.1|1849741_1849993_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	86.7	5.2e-33
WP_014417852.1|1850013_1850406_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	97.7	7.1e-61
WP_014417853.1|1850520_1851564_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	56.4	7.9e-91
WP_014417854.1|1851739_1854298_-	Pre-neck appendage protein	NA	D6R401	Bacillus_phage	37.1	3.5e-140
WP_014417855.1|1854339_1855158_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	68.6	8.1e-107
WP_014417856.1|1855648_1858282_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	70.4	0.0e+00
WP_014417857.1|1858296_1859058_-	hypothetical protein	NA	A0A1P8CWP8	Bacillus_phage	78.8	4.7e-109
WP_014417858.1|1859102_1865987_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	78.3	0.0e+00
WP_014417859.1|1866050_1866677_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	28.9	3.1e-18
WP_041481759.1|1866750_1867164_-	hypothetical protein	NA	O64047	Bacillus_phage	45.5	5.1e-25
WP_041481760.1|1867249_1867429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417860.1|1867491_1868064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014721221.1|1868209_1868395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417861.1|1868444_1869464_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3U2P3	Fusobacterium_phage	35.8	3.9e-50
WP_014417862.1|1869477_1869894_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.2	3.1e-46
WP_014417863.1|1869893_1870379_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.9	4.8e-59
WP_076983899.1|1870461_1870662_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	64.8	1.2e-11
WP_014417865.1|1870995_1872330_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	34.4	1.3e-26
WP_014417866.1|1872329_1872686_-	hypothetical protein	NA	O64055	Bacillus_phage	78.0	2.6e-46
WP_014470099.1|1872757_1873225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417867.1|1873245_1874037_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	36.8	5.2e-18
WP_014417868.1|1874075_1874801_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.2	1.9e-27
WP_014417869.1|1874797_1875304_-	hypothetical protein	NA	O64060	Bacillus_phage	68.5	6.8e-64
WP_014417870.1|1875300_1875966_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	53.6	5.3e-48
WP_041481761.1|1875962_1876283_-	hypothetical protein	NA	U5J9I5	Bacillus_phage	38.8	2.6e-16
WP_041481804.1|1876279_1876588_-	hypothetical protein	NA	A0A0H3UZ42	Geobacillus_virus	42.9	4.3e-13
WP_014417871.1|1876723_1877257_-	hypothetical protein	NA	A0A0K2FLE1	Brevibacillus_phage	40.8	6.6e-25
WP_014417872.1|1877309_1878302_-	hypothetical protein	NA	E0YJ30	Lactococcus_phage	31.6	2.0e-35
WP_014417873.1|1878326_1878869_-	hypothetical protein	NA	NA	NA	NA	NA
1878463:1878480	attR	TCTGCAATCTCTTTATAT	NA	NA	NA	NA
WP_101294002.1|1878893_1879094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417875.1|1880404_1881847_-	hypothetical protein	NA	U5J9V5	Bacillus_phage	39.5	3.5e-89
>prophage 6
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	1907300	1913478	4246605		Bacillus_phage(85.71%)	12	NA	NA
WP_014417898.1|1907300_1908392_-	acyltransferase	NA	A9YX16	Burkholderia_phage	24.6	1.6e-09
WP_041481764.1|1908695_1909139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417899.1|1909226_1909430_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	78.8	1.2e-22
WP_014417900.1|1909485_1909701_+	helix-turn-helix transcriptional regulator	NA	O64085	Bacillus_phage	42.3	2.7e-09
WP_014417901.1|1909789_1910236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481765.1|1910273_1910606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417902.1|1910733_1912086_+	hypothetical protein	NA	O64086	Bacillus_phage	42.0	1.9e-89
WP_050979331.1|1912117_1912345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481766.1|1912373_1912598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417903.1|1912612_1912795_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	1.7e-25
WP_014417904.1|1912865_1913117_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	3.2e-22
WP_014417905.1|1913346_1913478_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	9.4e-18
>prophage 7
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	1916503	1974776	4246605	integrase,tRNA	Bacillus_phage(90.48%)	91	1916417:1916435	1946731:1946749
1916417:1916435	attL	TGAATAAAAATAAAATAAA	NA	NA	NA	NA
WP_041481768.1|1916503_1916716_+	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	76.9	6.0e-22
WP_041481769.1|1916730_1916961_+	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	7.2e-21
WP_014417908.1|1917173_1918232_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	75.4	3.0e-154
WP_014417909.1|1918308_1919658_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.4	3.7e-189
WP_014417910.1|1919678_1920662_+|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	77.4	7.4e-139
WP_021493552.1|1920882_1921104_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
WP_014417911.1|1921269_1921569_+	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	51.0	3.6e-20
WP_021493551.1|1921643_1921889_+	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_041481771.1|1922257_1922440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481772.1|1922436_1922652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417912.1|1922648_1922825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417914.1|1923387_1923687_+	hypothetical protein	NA	A0A0S2SXU1	Bacillus_phage	35.2	9.1e-08
WP_014417915.1|1924443_1924746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417916.1|1924781_1925018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021493536.1|1925208_1925424_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	91.5	6.1e-30
WP_041481774.1|1925437_1925812_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	62.6	1.2e-36
WP_014417917.1|1925931_1926144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481775.1|1926162_1926411_+	hypothetical protein	NA	F8UBL6	Clostridium_phage	46.2	1.7e-12
WP_014417918.1|1926452_1926815_+	hypothetical protein	NA	A0A140HLN5	Bacillus_phage	48.1	1.7e-32
WP_014417919.1|1927166_1927964_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	60.1	6.1e-75
WP_050979332.1|1928125_1928491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417920.1|1928602_1929415_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	86.3	1.1e-137
WP_014417921.1|1929484_1930159_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	95.1	3.9e-75
WP_014417922.1|1930230_1930446_+	hypothetical protein	NA	O64132	Bacillus_phage	85.5	7.4e-28
WP_014417923.1|1930682_1931153_+	hypothetical protein	NA	D9J0I1	Brochothrix_phage	35.5	8.7e-13
WP_014417924.1|1931414_1932239_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	60.8	1.1e-84
WP_014417925.1|1932235_1933981_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.0	8.9e-220
WP_014417927.1|1934551_1934929_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	1.3e-51
WP_041481776.1|1935459_1935834_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	78.2	6.8e-53
WP_014417928.1|1935861_1936776_+	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	89.5	3.4e-154
WP_014417929.1|1936865_1937837_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	59.8	4.8e-114
WP_014417930.1|1937879_1938350_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	89.7	7.4e-81
WP_014417931.1|1938364_1939882_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	71.7	1.2e-212
WP_014417932.1|1939897_1941034_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	90.2	1.1e-205
WP_014417933.1|1941033_1942761_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	80.7	5.8e-272
WP_014417934.1|1942773_1946703_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	81.6	0.0e+00
WP_014417935.1|1946729_1947437_+	3D domain-containing protein	NA	A0A1P8CX16	Bacillus_phage	36.3	8.7e-25
1946731:1946749	attR	TGAATAAAAATAAAATAAA	NA	NA	NA	NA
WP_014417936.1|1947448_1947652_+	YorP family protein	NA	O64150	Bacillus_phage	80.6	1.0e-26
WP_014417938.1|1947811_1948309_+	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	78.8	2.5e-71
WP_014417939.1|1948348_1948696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481777.1|1948820_1949090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017697084.1|1949121_1949400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417940.1|1949450_1949669_+	hypothetical protein	NA	O64155	Bacillus_phage	61.4	1.9e-15
WP_014417943.1|1950449_1950713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481779.1|1951007_1951214_+	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	48.1	4.5e-06
WP_020954083.1|1951413_1951593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417945.1|1952065_1952473_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	62.7	9.7e-37
WP_014417946.1|1952487_1952835_+	hypothetical protein	NA	O64164	Bacillus_phage	91.3	1.4e-52
WP_021493488.1|1952879_1953185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021493487.1|1953211_1953583_+	hypothetical protein	NA	A0A1B1IUA0	uncultured_Mediterranean_phage	32.9	5.1e-08
WP_014417948.1|1953620_1953950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417949.1|1953975_1954353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417950.1|1954359_1954572_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	78.6	2.5e-28
WP_014417951.1|1954587_1954926_+	hypothetical protein	NA	O64167	Bacillus_phage	90.3	4.9e-50
WP_014417953.1|1955084_1955330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014721253.1|1955322_1955457_+	hypothetical protein	NA	O64168	Bacillus_phage	93.2	8.1e-17
WP_004399360.1|1955477_1955672_+	hypothetical protein	NA	O64169	Bacillus_phage	100.0	7.6e-32
WP_009967463.1|1955722_1955923_+	hypothetical protein	NA	O64170	Bacillus_phage	100.0	2.1e-32
WP_156476656.1|1955997_1956147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417955.1|1956165_1956522_+	hypothetical protein	NA	O64171	Bacillus_phage	45.9	4.2e-20
WP_014417956.1|1956518_1956914_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	84.0	2.8e-57
WP_014417957.1|1956876_1958976_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	61.6	0.0e+00
WP_041481780.1|1958959_1959298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481781.1|1959361_1960357_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	81.5	1.4e-150
WP_014417959.1|1960353_1960596_+	NrdH-redoxin	NA	A0A1P8CX24	Bacillus_phage	73.4	1.3e-28
WP_041481782.1|1960588_1960837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417960.1|1960823_1961180_+|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	3.7e-08
WP_014417961.1|1961232_1961661_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.1	4.4e-72
WP_014417962.1|1961856_1962156_+	hypothetical protein	NA	O64180	Bacillus_phage	56.3	2.3e-19
WP_014417963.1|1962927_1963575_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_014417964.1|1963625_1964477_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	39.0	3.2e-50
WP_014417965.1|1964476_1964983_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	40.4	6.2e-33
WP_014417966.1|1965110_1965476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417967.1|1965534_1965903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417968.1|1966120_1966498_+	hypothetical protein	NA	R4JDR8	Bacillus_phage	88.0	9.6e-63
WP_014417969.1|1966490_1967483_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	47.2	1.3e-21
WP_014417970.1|1967613_1967955_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	72.6	3.3e-22
WP_031303942.1|1968288_1969233_+	HNH endonuclease	NA	A0A1B1P765	Bacillus_phage	41.8	2.0e-16
WP_014417972.1|1969234_1970062_+	metallophosphoesterase	NA	O64184	Bacillus_phage	91.3	2.5e-156
WP_014417973.1|1970071_1970293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481809.1|1970363_1970699_+	hypothetical protein	NA	F8WPK8	Bacillus_phage	64.2	5.5e-38
WP_014417974.1|1970740_1970980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157829253.1|1971142_1971319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157829254.1|1971362_1971524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481810.1|1971816_1972257_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	72.3	9.5e-38
WP_014417976.1|1972237_1972786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417977.1|1972786_1972960_+	hypothetical protein	NA	O64190	Bacillus_phage	91.2	5.4e-21
WP_014417978.1|1972956_1973388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470254.1|1973618_1973858_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_014417980.1|1973955_1974492_+	hypothetical protein	NA	O64195	Bacillus_phage	92.6	2.0e-90
WP_014417981.1|1974506_1974776_+	hypothetical protein	NA	S5MC08	Brevibacillus_phage	55.8	7.4e-25
>prophage 8
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	2302946	2368462	4246605	plate,head,terminase,integrase,tRNA,protease,tail,capsid,portal,coat,holin	Bacillus_phage(41.03%)	75	2319650:2319668	2359392:2359410
WP_014418179.1|2302946_2304437_-	glycosyltransferase	NA	A0A1V0SGA9	Hokovirus	30.0	9.5e-05
WP_014418180.1|2304821_2305418_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_040221738.1|2305626_2306154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014418181.1|2306348_2307512_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	49.1	1.2e-68
WP_040221739.1|2307557_2307980_-|holin	holin	holin	D6R405	Bacillus_phage	87.2	3.6e-58
WP_014418183.1|2308029_2308215_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	72.1	5.8e-21
WP_040221740.1|2308214_2308577_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	56.3	4.6e-30
WP_014418184.1|2308573_2310397_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	35.7	1.1e-79
WP_014418185.1|2310411_2312976_-	peptidase G2	NA	D6R401	Bacillus_phage	79.8	0.0e+00
WP_014418186.1|2313029_2314733_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	57.6	2.3e-180
WP_014418187.1|2314747_2315587_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.3	1.2e-92
WP_014418188.1|2315580_2320068_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	32.4	7.9e-63
2319650:2319668	attL	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
WP_014418189.1|2320265_2320643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418190.1|2320708_2321317_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	35.5	3.7e-24
WP_014418191.1|2321331_2321715_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014418192.1|2321711_2322110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418193.1|2322106_2322424_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.2	3.4e-13
WP_014418194.1|2322413_2322716_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.2	3.6e-12
WP_014418195.1|2322733_2323213_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	60.8	1.6e-09
WP_014418196.1|2323235_2324528_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.7	1.8e-92
WP_014418197.1|2324566_2325193_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	77.7	2.5e-84
WP_014418198.1|2325155_2326436_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	62.8	2.1e-154
WP_014418200.1|2326624_2328334_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	63.0	6.4e-207
WP_014418201.1|2328330_2328846_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.3	7.0e-32
WP_032863623.1|2329071_2329437_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	2.3e-29
WP_032863621.1|2329743_2330463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863619.1|2330485_2331298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863616.1|2331487_2331700_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	43.9	3.8e-08
WP_032863614.1|2332240_2332453_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	1.6e-11
WP_032863612.1|2332993_2333509_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	1.6e-28
WP_025852602.1|2333528_2333714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025852606.1|2333961_2334627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025852608.1|2334789_2335047_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	40.5	2.5e-06
WP_025852610.1|2335082_2335286_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	70.3	2.8e-21
WP_040221743.1|2335598_2336027_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	1.7e-44
WP_141233183.1|2336262_2337210_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.2	1.9e-54
WP_032859408.1|2337094_2337796_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_082029678.1|2337993_2338731_-	hypothetical protein	NA	A0A2P1JU03	Anoxybacillus_phage	42.4	4.8e-42
WP_025852621.1|2338750_2339671_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	64.0	4.5e-90
WP_032859263.1|2339667_2339856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014721404.1|2339957_2340155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418217.1|2340151_2340409_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.8	1.1e-09
WP_014418218.1|2340405_2340978_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.9	4.7e-61
WP_014418219.1|2341035_2341764_-	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	68.7	6.1e-90
WP_032863594.1|2341760_2342075_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.3	1.9e-11
WP_025852635.1|2342087_2342306_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014418220.1|2342459_2342837_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	45.3	1.1e-10
WP_014418221.1|2343208_2344405_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	43.9	2.5e-80
WP_014418222.1|2344448_2345753_-	purine permease	NA	NA	NA	NA	NA
WP_014418223.1|2345749_2346334_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014418224.1|2346666_2348169_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_014721409.1|2348280_2350200_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
WP_014418226.1|2350303_2350495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153548.1|2350661_2350814_+	YpzG family protein	NA	NA	NA	NA	NA
WP_014418227.1|2350854_2352021_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003153541.1|2352554_2352854_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_014418228.1|2352933_2353482_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003153539.1|2353570_2353807_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007409498.1|2353890_2353986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418229.1|2354119_2355358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418230.1|2355377_2357624_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	26.9	1.6e-08
WP_012117833.1|2357722_2358229_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_007612169.1|2358367_2358781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014418231.1|2358810_2359278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153532.1|2359464_2359647_+	hypothetical protein	NA	NA	NA	NA	NA
2359392:2359410	attR	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
WP_014418232.1|2359685_2360054_-	YppE family protein	NA	NA	NA	NA	NA
WP_014418233.1|2360099_2360345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153525.1|2360550_2360655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014418234.1|2360698_2361661_-	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
WP_014418235.1|2361702_2362311_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	33.7	1.7e-21
WP_032863588.1|2362349_2365133_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_012117839.1|2365210_2365702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007612187.1|2365698_2366358_-	endonuclease III	NA	NA	NA	NA	NA
WP_003153516.1|2366376_2367075_-	DnaD domain-containing protein	NA	NA	NA	NA	NA
WP_003153515.1|2367169_2368462_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	7.9e-56
>prophage 9
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	2445389	2451642	4246605		Staphylococcus_phage(66.67%)	9	NA	NA
WP_007409428.1|2445389_2445983_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_014418279.1|2445972_2446728_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	1.7e-10
WP_003153376.1|2446935_2447025_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_014418280.1|2447112_2447634_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2447699_2448074_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2448190_2448655_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_014418281.1|2448687_2449884_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_007409425.1|2449898_2450546_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_014418282.1|2450526_2451642_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	4.4e-55
>prophage 10
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	3118316	3225709	4246605	plate,terminase,integrase,tail,capsid,portal,holin	Bacillus_phage(48.39%)	128	3182957:3182976	3225820:3225839
WP_007408834.1|3118316_3118721_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_007408835.1|3118872_3119310_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	2.2e-47
WP_014418700.1|3119434_3119584_+	YtzI protein	NA	NA	NA	NA	NA
WP_014418701.1|3119580_3120024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152237.1|3120138_3120612_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_007408838.1|3120736_3120964_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.2	1.2e-23
WP_003152233.1|3120960_3121530_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|3121647_3121896_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_025649757.1|3122093_3123425_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014418703.1|3123447_3124488_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_007408842.1|3124545_3124704_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_014418705.1|3124719_3125601_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014418706.1|3125590_3126877_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014418707.1|3126876_3127629_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	2.1e-13
WP_014418708.1|3127649_3128567_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_014418709.1|3128836_3129952_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.6	2.1e-12
WP_014418710.1|3129948_3131412_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.9	2.7e-76
WP_003152221.1|3131499_3132318_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_014418711.1|3132376_3133201_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_014418712.1|3133188_3134925_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_014418713.1|3134921_3136337_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_007613312.1|3136619_3137339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014418714.1|3137495_3137966_+	membrane protein	NA	NA	NA	NA	NA
WP_007410163.1|3145364_3145946_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_014418715.1|3145976_3147506_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	2.7e-07
WP_014418716.1|3147525_3148056_-	membrane protein	NA	NA	NA	NA	NA
WP_014418717.1|3148202_3148691_+	DinB family protein	NA	NA	NA	NA	NA
WP_014721712.1|3148692_3149274_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_014418719.1|3149345_3150554_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_014418720.1|3150571_3152044_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014418721.1|3152244_3152799_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025650408.1|3152959_3153496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014418723.1|3153661_3154330_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_014418724.1|3154364_3155210_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
WP_014418725.1|3155351_3156527_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_014418726.1|3156745_3157387_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014418727.1|3157453_3157774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293927.1|3158070_3158862_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.8	4.9e-16
WP_013351586.1|3158998_3159205_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101293928.1|3159264_3159600_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	7.6e-11
WP_013351583.1|3160052_3160310_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
WP_101293930.1|3160331_3161243_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	90.8	1.9e-157
WP_013351581.1|3161319_3161529_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_095284268.1|3161532_3161721_-	XkdX family protein	NA	NA	NA	NA	NA
WP_033575347.1|3161721_3161991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157829255.1|3162005_3163589_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	52.3	6.7e-57
WP_101293931.1|3163601_3166166_-	peptidase G2	NA	D6R401	Bacillus_phage	74.5	0.0e+00
WP_101293932.1|3166180_3168058_-	endopeptidase	NA	D6R400	Bacillus_phage	31.9	7.7e-52
WP_101293933.1|3168070_3168895_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	48.9	1.0e-64
WP_101293934.1|3168894_3172026_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	45.5	4.1e-74
WP_157829264.1|3172041_3172434_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_101293935.1|3172343_3172709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293936.1|3172771_3173257_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_101293937.1|3173274_3173703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293938.1|3173699_3174056_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_101293939.1|3174052_3174448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293940.1|3174459_3175269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293941.1|3175265_3175604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293942.1|3175618_3175807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293943.1|3175806_3176145_-	hypothetical protein	NA	V5KSC6	Escherichia_phage	54.7	3.7e-13
WP_101293944.1|3176199_3177321_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_101293945.1|3177378_3178110_-	scaffolding protein	NA	NA	NA	NA	NA
WP_101294007.1|3178197_3179718_-|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	21.8	6.7e-14
WP_101294008.1|3179788_3181351_-|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	54.5	5.4e-152
WP_101293946.1|3181631_3182183_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	39.1	1.7e-28
3182957:3182976	attL	AACCGCGGTATATCAACGTT	NA	NA	NA	NA
WP_101293947.1|3183147_3183534_-	hypothetical protein	NA	A0A0N7GFF5	Paenibacillus_phage	40.8	8.1e-17
WP_101293948.1|3184004_3185027_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	45.2	8.5e-13
WP_069013240.1|3185125_3185350_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	71.8	6.2e-09
WP_099320080.1|3185480_3186278_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	47.3	8.3e-56
WP_101293949.1|3186277_3188041_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	47.7	1.4e-148
WP_101293950.1|3188402_3188606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101293951.1|3188711_3189449_+	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	34.8	1.3e-23
WP_101293952.1|3189462_3189900_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	69.5	5.2e-52
WP_013351549.1|3190030_3190210_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_101293953.1|3190224_3190581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101293954.1|3190672_3191485_+	hypothetical protein	NA	O64130	Bacillus_phage	62.1	3.4e-97
WP_157829256.1|3191524_3191686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101293955.1|3191811_3192612_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.2	1.2e-70
WP_045208651.1|3192699_3193188_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	43.9	5.5e-18
WP_101293956.1|3193187_3193571_-	RNA polymerase subunit sigma	NA	A0A0N9RZI0	Paenibacillus_phage	45.8	5.1e-19
WP_101293957.1|3193604_3194783_-	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.1	4.4e-146
WP_101293958.1|3194899_3195292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101293959.1|3195274_3195850_-	hypothetical protein	NA	U5PRK9	Bacillus_phage	44.4	7.6e-35
WP_101293960.1|3195846_3196866_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	40.8	1.0e-18
WP_101293961.1|3197065_3197689_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	58.8	8.2e-27
WP_101294009.1|3197658_3198378_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	70.3	6.0e-90
WP_101293963.1|3198614_3199157_-	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	57.1	1.9e-43
WP_157829257.1|3199153_3199300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101294010.1|3199379_3200345_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.6	8.8e-145
WP_101293965.1|3200598_3202698_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.7	0.0e+00
WP_101293966.1|3202694_3203219_-	hypothetical protein	NA	A0A2K9VD13	Lactobacillus_phage	47.9	1.0e-22
WP_094247767.1|3203164_3203563_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.4	8.1e-28
WP_157829258.1|3203556_3203712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293967.1|3203755_3203941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025851618.1|3204182_3204692_-	hypothetical protein	NA	A0A109ZVT6	Bacillus_phage	29.2	2.6e-10
WP_101293969.1|3204692_3205058_-	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	36.8	2.6e-12
WP_072588572.1|3205057_3205309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341157.1|3205309_3205507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293970.1|3205507_3206041_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	41.9	6.0e-10
WP_157829259.1|3206033_3206195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293971.1|3206194_3207256_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	52.0	4.3e-76
WP_101293972.1|3207252_3207549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293973.1|3207549_3209835_-	hypothetical protein	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.5	3.2e-121
WP_157829260.1|3209869_3210019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129093650.1|3210015_3210195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293974.1|3210184_3211144_-	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	36.2	4.6e-45
WP_101293975.1|3211144_3211579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293976.1|3211613_3212393_-	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	51.8	1.2e-51
WP_101293977.1|3212630_3213197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293978.1|3213491_3214100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293979.1|3214407_3215634_-	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	38.0	3.2e-67
WP_101293980.1|3215783_3216029_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	39.7	1.4e-06
WP_101293981.1|3216045_3217041_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.8	1.0e-71
WP_095284384.1|3217175_3218594_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.1	2.2e-128
WP_101293982.1|3218590_3218815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293983.1|3218811_3219321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293984.1|3219317_3220100_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	55.7	6.4e-77
WP_157829261.1|3220119_3220272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293985.1|3220268_3221015_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	55.2	4.4e-59
WP_101293986.1|3221043_3221424_-	hypothetical protein	NA	R4JDR8	Bacillus_phage	87.8	5.7e-63
WP_101293987.1|3221442_3221811_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	46.6	9.5e-23
WP_101293988.1|3221807_3222173_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.2	7.4e-12
WP_095284400.1|3222169_3222385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293989.1|3222429_3222753_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	38.9	4.4e-08
WP_157829262.1|3222742_3222907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293990.1|3223139_3223559_-	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	59.5	1.4e-35
WP_101293991.1|3223555_3224503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101293992.1|3224650_3225709_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.7	2.2e-16
3225820:3225839	attR	AACGTTGATATACCGCGGTT	NA	NA	NA	NA
>prophage 11
NZ_CP025308	Bacillus velezensis strain Lzh-a42 chromosome, complete genome	4246605	3889210	3938507	4246605	coat,protease	Staphylococcus_phage(16.67%)	51	NA	NA
WP_003151043.1|3889210_3889870_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3889975_3890164_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_007407650.1|3890201_3890621_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015240784.1|3891004_3892384_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407653.1|3892448_3892949_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003151035.1|3892988_3894290_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|3894450_3894675_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_012118695.1|3894877_3895651_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_014721962.1|3895950_3896226_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014419136.1|3896226_3896781_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_014419137.1|3896878_3897799_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	2.9e-36
WP_014419138.1|3897795_3898749_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014419139.1|3898738_3899575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014419140.1|3899565_3900363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014721963.1|3900331_3901255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3901303_3901483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014419142.1|3901636_3902500_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_014419143.1|3902546_3903446_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.7e-07
WP_014419144.1|3903561_3904539_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3904575_3905547_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014419145.1|3905803_3906568_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_021494773.1|3906687_3907467_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014419147.1|3907483_3908683_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014419148.1|3908695_3909877_-	MFS transporter	NA	NA	NA	NA	NA
WP_014419149.1|3909873_3911292_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_014419150.1|3911309_3912071_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	2.2e-21
WP_003151000.1|3912067_3912778_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014721966.1|3912767_3913382_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_014419152.1|3913543_3914782_-	MFS transporter	NA	NA	NA	NA	NA
WP_014419153.1|3915004_3916207_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	7.1e-27
WP_012118711.1|3916239_3917658_-	amino acid permease	NA	NA	NA	NA	NA
WP_014419154.1|3917682_3919365_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014419155.1|3919436_3920984_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014419156.1|3921191_3922478_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_014419157.1|3922709_3923645_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	9.8e-24
WP_014419158.1|3923646_3924345_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	3.2e-35
WP_014419159.1|3924536_3925403_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_014419160.1|3925423_3926128_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025649399.1|3926193_3927120_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
WP_003150986.1|3927478_3927934_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014419162.1|3927930_3928779_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
WP_014419163.1|3928799_3929747_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	1.3e-68
WP_014419164.1|3929749_3930487_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_014419165.1|3930514_3931519_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014419166.1|3931520_3932264_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007614529.1|3932253_3933375_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014419167.1|3933374_3934238_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014419168.1|3934238_3935408_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_014419169.1|3935430_3936855_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014419170.1|3936859_3937630_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.4	2.9e-05
WP_014419171.1|3937910_3938507_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
