The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025268	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4643559	269655	326298	4643559	integrase,transposase,holin	Acinetobacter_phage(22.22%)	48	272432:272447	332170:332185
WP_001254938.1|269655_270807_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
272432:272447	attL	TGCTGATGAAGGCTGT	NA	NA	NA	NA
WP_010723085.1|273153_274170_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274377_275781_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|275767_276700_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|276808_277855_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|279076_279415_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|279437_279788_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001136613.1|281329_282238_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_101348544.1|282252_284220_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|284446_285829_+	MFS transporter	NA	NA	NA	NA	NA
WP_101348545.1|285840_287451_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287455_288214_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|288352_289357_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290551_291283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291373_292000_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292271_292970_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|292996_293851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|293969_294194_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|294190_294631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|294747_296148_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|296432_296843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|296821_297778_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|297787_299986_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|299982_300939_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070700.1|300935_301625_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|302042_302657_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|302904_303234_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|303546_304257_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|304225_305869_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|305858_308384_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|308409_309078_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|309135_309723_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|309797_310340_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|311163_311391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|311425_311566_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|311565_311829_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|312192_312294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020224.1|313408_314296_+	attachment protein	NA	NA	NA	NA	NA
WP_085947771.1|314342_315504_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001299021.1|316777_317371_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|317382_317619_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|317727_319053_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|319278_320133_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001102108.1|320658_321378_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_032289499.1|321388_322816_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|322808_323504_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|323746_324415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|324627_326298_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
332170:332185	attR	ACAGCCTTCATCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP025268	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4643559	518188	581147	4643559	protease,lysis,terminase,integrase,transposase,tRNA	Enterobacteria_phage(50.0%)	65	563805:563851	585106:585152
WP_001295836.1|518188_518812_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|518782_519469_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_101348558.1|519465_521880_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|522310_526591_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|526630_526999_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|527689_527950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|529181_530276_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|530344_531271_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|531500_531983_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|532060_532876_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|532965_534747_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|534759_535536_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|535635_536514_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|536682_538137_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|538196_539558_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|539614_540916_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_101348559.1|540937_542083_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
WP_000540997.1|542310_543096_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_101348560.1|543106_544342_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|544363_545413_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|545729_547397_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|547406_548666_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|548676_549492_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|549488_550382_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|550576_551644_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|551640_552150_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|552267_552990_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|552992_553487_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|553660_555046_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|555081_555603_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|555710_555923_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|555924_556791_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|557261_557804_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|558023_558716_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|558746_561350_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|561328_562369_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|562379_562895_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|562897_563530_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
563805:563851	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|563864_565028_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|565147_565411_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|565733_565829_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|565891_567053_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|567364_567697_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|567744_567894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|567951_569478_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|569942_570494_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|570503_571301_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|571417_571519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|571515_571971_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|571970_572141_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|572133_572424_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|572420_572783_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|572779_572920_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|573005_573389_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|573786_574803_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|574807_575875_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|576447_576663_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|576662_577160_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|577376_577559_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|577649_577943_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|578233_578644_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|578929_579136_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|579300_579495_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|579883_580429_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|580403_581147_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
585106:585152	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP025268	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4643559	805315	817274	4643559	integrase,protease	Enterobacteria_phage(80.95%)	22	796816:796830	820714:820728
796816:796830	attL	CTGGAAGATGGCCTG	NA	NA	NA	NA
WP_000533640.1|805315_806386_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|806363_806582_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|806621_806789_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|806877_807159_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|807350_807899_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|807895_808117_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|808508_808700_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|808672_808855_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186891.1|808851_809532_-	YqaJ viral recombinase family protein	NA	C6ZCV3	Enterobacteria_phage	100.0	3.5e-132
WP_000100844.1|809528_810314_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|810319_810616_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|810690_810834_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_157825722.1|810802_810967_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	98.1	9.0e-26
WP_000065374.1|811039_811408_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|811590_811791_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|812057_812540_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|812540_812864_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|813328_813763_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|813778_814618_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_101348571.1|814730_815444_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	97.9	3.8e-129
WP_000088605.1|815705_816329_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_000027050.1|816413_817274_+	class A broad-spectrum beta-lactamase TEM-116	NA	Q38058	Escherichia_phage	100.0	3.5e-161
820714:820728	attR	CTGGAAGATGGCCTG	NA	NA	NA	NA
>prophage 4
NZ_CP025268	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4643559	1208876	1219103	4643559	plate,tail,portal	Shigella_phage(33.33%)	16	NA	NA
WP_001005353.1|1208876_1209185_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1209359_1210034_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1210124_1210325_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1210368_1210926_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_101348579.1|1211101_1211281_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	2.3e-14
WP_000104929.1|1211270_1212638_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1212649_1212832_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1212831_1213305_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1213231_1214023_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1214013_1214598_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1214601_1215231_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_024184299.1|1216218_1216713_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1216784_1217339_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1217445_1218279_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|1218512_1218677_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1218779_1219103_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
>prophage 5
NZ_CP025268	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4643559	1411381	1475328	4643559	lysis,tail,integrase,transposase,tRNA	Escherichia_phage(40.62%)	62	1402040:1402058	1432416:1432434
1402040:1402058	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000628058.1|1411381_1412614_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1412868_1413852_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1414329_1415703_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1415831_1416767_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1416818_1418054_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1418055_1418271_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1418349_1418559_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1418551_1418746_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1418802_1419612_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1419604_1422205_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1422306_1422582_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1422656_1422827_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1422826_1423048_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1423489_1423978_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1423974_1424130_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1424583_1425060_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1425183_1425480_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1425502_1425925_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1425937_1426795_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1426801_1427548_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1427570_1428131_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1428218_1428404_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1428600_1430058_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1430195_1430459_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1430439_1430799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|1430906_1431107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033544729.1|1432564_1433545_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
1432416:1432434	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_101348721.1|1433867_1437230_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1437229_1437805_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1437902_1438493_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1438809_1439043_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1439111_1439225_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157926.1|1439564_1439738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|1440003_1440438_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1440578_1441712_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|1442078_1445603_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1445876_1446143_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1446139_1446562_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1446672_1447662_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|1447869_1450509_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1450505_1450691_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1450698_1451025_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1451196_1452102_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1452337_1453837_+	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_101348587.1|1453894_1456168_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1456415_1458461_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1458745_1459675_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1459686_1459974_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1459982_1460729_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1460743_1461241_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1461248_1462319_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1462315_1463083_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1463082_1463871_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1463872_1465300_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1465289_1465712_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1465711_1466917_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1466943_1468257_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1468357_1469308_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_101348588.1|1469289_1469880_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1469983_1470049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|1472739_1474013_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001254932.1|1474176_1475328_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 6
NZ_CP025268	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4643559	1634271	1653482	4643559	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1634271_1635732_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1635820_1637104_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1637708_1637822_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1637890_1638124_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1638440_1639031_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1639128_1639704_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1639703_1640666_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1640616_1641186_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1641574_1641808_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1641865_1642276_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1642427_1642601_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1642772_1642928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1643006_1643072_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1643074_1643263_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1643273_1643486_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1643848_1644346_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1644342_1644876_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1644872_1645184_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1645188_1645404_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1646157_1646373_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1646673_1646886_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1646940_1647030_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1647307_1648060_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|1648073_1649123_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|1649124_1649403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1649469_1649721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1649937_1650093_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1650164_1650452_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1650451_1650691_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1650715_1651021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1651223_1651556_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1651992_1652142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1652438_1652669_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1652752_1653160_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1653326_1653482_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 7
NZ_CP025268	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4643559	2111264	2119935	4643559		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2111264_2112368_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2112375_2113623_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2113619_2114177_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2114176_2115058_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2115115_2116015_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2116014_2117100_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2117472_2118366_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2118540_2119935_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 8
NZ_CP025268	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4643559	2469334	2480544	4643559	integrase,tail	Enterobacteria_phage(50.0%)	16	2467309:2467325	2484219:2484235
2467309:2467325	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2469334_2470267_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2470578_2471736_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2471888_2472251_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2472247_2473168_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2473164_2474496_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_101348627.1|2475110_2475551_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.4	1.0e-52
WP_011443597.1|2475577_2476096_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2476145_2476421_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2476420_2476915_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2476911_2477280_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2477637_2478000_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2478065_2478890_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2479017_2479554_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2479544_2479907_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2479906_2480212_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2480343_2480544_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2484219:2484235	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
