The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	0	12292	3983848		Mycobacterium_phage(33.33%)	10	NA	NA
WP_001025141.1|152_464_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_001045993.1|456_2109_+	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_000649780.1|2256_3243_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001094386.1|3326_4772_-	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001095374.1|4821_5715_-	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_000542600.1|6136_6967_+	alpha/beta hydrolase	NA	A0A1B1SFC9	Mycobacterium_phage	29.8	4.8e-14
WP_000997200.1|7043_8564_+	catalase	NA	A0A2K9L0T1	Tupanvirus	45.1	5.4e-96
WP_000482355.1|9032_10076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049441.1|10275_11082_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000685011.1|11281_12292_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	38.2	4.9e-61
>prophage 2
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	32762	34508	3983848		Moraxella_phage(100.0%)	1	NA	NA
WP_000956372.1|32762_34508_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	29.7	1.3e-69
>prophage 3
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	53478	54456	3983848		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000824433.1|53478_54456_-	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	31.2	1.2e-29
>prophage 4
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	77413	89638	3983848		Bacillus_virus(33.33%)	12	NA	NA
WP_000206303.1|77413_78466_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.1	2.8e-88
WP_059273159.1|78896_79916_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002001037.1|79918_80929_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000614432.1|80925_81690_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.2e-16
WP_000177605.1|81692_82181_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001244448.1|82175_82964_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000965123.1|83062_83872_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001007527.1|84053_84938_+	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	39.0	1.2e-34
WP_000152964.1|84949_86443_+	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	51.1	6.3e-142
WP_000155202.1|86503_87271_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	32.2	1.5e-25
WP_000959831.1|87386_88739_+	methylenetetrahydrofolate reductase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000675786.1|89293_89638_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	39.3	2.0e-14
>prophage 5
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	108346	108787	3983848		Vibrio_phage(100.0%)	1	NA	NA
WP_000193121.1|108346_108787_-	HD domain-containing protein	NA	A0A0B5H2U9	Vibrio_phage	35.5	6.2e-13
>prophage 6
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	112039	112534	3983848		Haemophilus_phage(100.0%)	1	NA	NA
WP_001987702.1|112039_112534_+	phage antirepressor KilAC domain-containing protein	NA	Q7Y5W2	Haemophilus_phage	54.9	3.5e-28
>prophage 7
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	121149	126336	3983848		Leptospira_phage(66.67%)	3	NA	NA
WP_000459542.1|121149_121893_-	efflux system response regulator transcription factor AdeR	NA	W8CYM9	Bacillus_phage	30.2	7.5e-27
WP_001169094.1|122038_123229_+	multidrug efflux RND transporter periplasmic adaptor subunit AdeA	NA	S5VL44	Leptospira_phage	22.4	8.1e-07
WP_000987613.1|123225_126336_+	multidrug efflux RND transporter permease subunit AdeB	NA	S5VTK5	Leptospira_phage	24.4	6.1e-62
>prophage 8
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	146641	152921	3983848		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000842122.1|146641_147751_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	6.8e-32
WP_064851197.1|147980_149675_-	hypothetical protein	NA	A0A076G822	Escherichia_phage	37.5	2.0e-104
WP_000040089.1|150034_151198_+	catalase family protein	NA	NA	NA	NA	NA
WP_101329616.1|151275_151641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136790.1|152453_152921_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	52.4	2.3e-37
>prophage 9
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	168479	169100	3983848		Planktothrix_phage(100.0%)	1	NA	NA
WP_000904336.1|168479_169100_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.9	7.7e-17
>prophage 10
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	178689	179475	3983848		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001024687.1|178689_179475_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	1.4e-10
>prophage 11
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	201583	205009	3983848		Burkholderia_virus(50.0%)	4	NA	NA
WP_000222732.1|201583_202870_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	8.1e-37
WP_001167102.1|202909_203191_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_000011848.1|203174_204173_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000117516.1|204169_205009_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	9.0e-37
>prophage 12
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	210362	211712	3983848		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_001186395.1|210362_211712_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.7	1.2e-30
>prophage 13
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	233831	234923	3983848		Pandoravirus(100.0%)	1	NA	NA
WP_000918448.1|233831_234923_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.1	1.4e-77
>prophage 14
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	257411	259169	3983848		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000567280.1|257411_259169_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.2	2.8e-19
>prophage 15
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	267802	271406	3983848		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000572403.1|267802_268912_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.5	5.5e-82
WP_000035228.1|268987_269731_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001023028.1|269837_271406_-	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	65.5	2.4e-115
>prophage 16
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	293689	299146	3983848		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_000070798.1|293689_295063_+	AarF/ABC1/UbiB kinase family protein	NA	M1HE59	Acanthocystis_turfacea_Chlorella_virus	25.7	5.5e-07
WP_002000226.1|295292_296576_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001053235.1|296597_297803_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000993538.1|297922_299146_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	36.6	7.2e-51
>prophage 17
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	302319	302592	3983848		Burkholderia_phage(100.0%)	1	NA	NA
WP_001043034.1|302319_302592_-	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	65.2	1.3e-24
>prophage 18
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	305944	311057	3983848		Lake_Baikal_phage(50.0%)	6	NA	NA
WP_000331712.1|305944_306331_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.0	6.0e-52
WP_000581594.1|306361_306682_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	2.0e-24
WP_001015254.1|306767_307286_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196572.1|307324_309184_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.4	8.0e-102
WP_001137383.1|309202_309541_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_059273160.1|309587_311057_-	guanylate cyclase	NA	A0A218MLZ2	uncultured_virus	29.3	5.5e-21
>prophage 19
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	321756	328401	3983848		uncultured_virus(33.33%)	5	NA	NA
WP_001117472.1|321756_322491_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	41.3	1.2e-48
WP_001295038.1|322523_324254_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	6.7e-18
WP_000953840.1|324266_325409_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000881926.1|325416_326355_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000719393.1|326367_328401_-	Zn-dependent oligopeptidase	NA	A0A1V0SID3	Klosneuvirus	29.7	3.1e-75
>prophage 20
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	332890	335476	3983848		Acinetobacter_phage(100.0%)	1	NA	NA
WP_138140468.1|332890_335476_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.6	4.0e-43
>prophage 21
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	347374	347677	3983848		Burkholderia_phage(100.0%)	1	NA	NA
WP_000205997.1|347374_347677_-	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
>prophage 22
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	350818	353163	3983848	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000033178.1|350818_351322_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	6.5e-06
WP_001983908.1|351328_352453_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_001177528.1|352449_353163_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	47.6	1.1e-51
>prophage 23
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	361200	365720	3983848		Bacillus_phage(33.33%)	5	NA	NA
WP_001070734.1|361200_362928_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.6	5.0e-58
WP_000669684.1|362924_363353_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_000264037.1|363368_364004_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_000023433.1|364053_364941_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.6	7.4e-13
WP_000057212.1|364937_365720_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.7	5.7e-17
>prophage 24
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	382089	388623	3983848		Bacillus_phage(33.33%)	6	NA	NA
WP_000922240.1|382089_383937_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	9.0e-29
WP_000966086.1|383936_384377_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_000705521.1|384485_385511_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001016343.1|385549_385924_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000164254.1|386026_386725_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	43.1	1.9e-32
WP_000119795.1|387132_388623_+	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.7	2.4e-08
>prophage 25
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	400650	401817	3983848		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001209544.1|400650_401817_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
>prophage 26
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	412693	413623	3983848	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_001091151.1|412693_413623_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
>prophage 27
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	424224	425457	3983848	integrase	Moraxella_phage(100.0%)	1	417473:417487	425889:425903
417473:417487	attL	CAAAATTTAGCTTAA	NA	NA	NA	NA
WP_000108020.1|424224_425457_-|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	43.3	6.5e-84
WP_000108020.1|424224_425457_-|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	43.3	6.5e-84
425889:425903	attR	TTAAGCTAAATTTTG	NA	NA	NA	NA
>prophage 28
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	432633	433377	3983848		Planktothrix_phage(100.0%)	1	NA	NA
WP_001132006.1|432633_433377_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
>prophage 29
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	443129	444206	3983848		Planktothrix_phage(100.0%)	1	NA	NA
WP_001986595.1|443129_444206_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-35
>prophage 30
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	456956	457442	3983848		Fowlpox_virus(100.0%)	1	NA	NA
WP_000066032.1|456956_457442_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
>prophage 31
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	463268	466832	3983848		Streptomyces_phage(100.0%)	1	NA	NA
WP_001160989.1|463268_466832_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	34.6	6.7e-174
>prophage 32
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	471715	473302	3983848		Lactococcus_phage(100.0%)	1	NA	NA
WP_000558747.1|471715_473302_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.4e-25
>prophage 33
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	476773	477616	3983848		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000610147.1|476773_477103_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.2	5.8e-24
WP_000138008.1|477187_477616_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.1	2.6e-40
>prophage 34
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	486872	487667	3983848		Bacillus_virus(100.0%)	1	NA	NA
WP_000114460.1|486872_487667_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.1	9.8e-33
>prophage 35
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	511989	513480	3983848		Streptococcus_phage(100.0%)	1	NA	NA
WP_000113406.1|511989_513480_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	29.4	4.2e-21
>prophage 36
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	521047	523916	3983848		Tupanvirus(50.0%)	2	NA	NA
WP_001107594.1|521047_521980_+	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.7	2.2e-44
WP_000211581.1|521954_523916_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.5	5.0e-94
>prophage 37
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	528135	535320	3983848		Planktothrix_phage(50.0%)	7	NA	NA
WP_001130362.1|528135_528867_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-35
WP_000418064.1|528869_529535_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000937460.1|529524_530160_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002017921.1|530248_530362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025680.1|530471_530756_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000107128.1|530899_531859_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000115408.1|531855_535320_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.5	8.6e-33
>prophage 38
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	539673	540285	3983848		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001124846.1|539673_540285_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.9	2.2e-48
>prophage 39
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	543535	551198	3983848	transposase	Enterobacteria_phage(25.0%)	8	NA	NA
WP_001091151.1|543535_544465_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_001990041.1|545043_547188_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.1	5.2e-137
WP_001145693.1|547242_548652_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_000482091.1|548967_549447_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	50.3	1.8e-34
WP_000108365.1|549731_549953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132044.1|550058_550376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498477.1|550460_550682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136759.1|550769_551198_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	2.1e-26
>prophage 40
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	557442	566524	3983848		Staphylococcus_phage(33.33%)	7	NA	NA
WP_001183739.1|557442_559137_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	2.2e-26
WP_001990034.1|559248_559842_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053639.1|560010_561183_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001072761.1|561207_562809_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	3.9e-20
WP_000121720.1|562818_563622_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000461798.1|563633_565625_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_001288905.1|565621_566524_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	39.6	7.9e-47
>prophage 41
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	582626	583388	3983848		Bacillus_phage(100.0%)	1	NA	NA
WP_000101935.1|582626_583388_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	45.2	3.2e-09
>prophage 42
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	600760	601963	3983848		Bacillus_virus(100.0%)	1	NA	NA
WP_001166815.1|600760_601963_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.6	6.4e-28
>prophage 43
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	656287	695915	3983848	transposase	Escherichia_phage(30.0%)	37	NA	NA
WP_085940413.1|656287_657377_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000070792.1|657983_658385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542525.1|658480_659425_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001000091.1|659424_660306_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	1.1e-37
WP_000591252.1|660357_661380_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000916831.1|661376_663188_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_001118704.1|663200_663635_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001000631.1|663639_663765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000821714.1|663936_664476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196271.1|665009_665546_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000475274.1|665584_669190_-	urea carboxylase	NA	NA	NA	NA	NA
WP_000217385.1|669192_669846_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_001090541.1|669861_670602_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_001202390.1|670915_672079_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	5.3e-11
WP_000921216.1|672331_672763_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_001133095.1|672822_673383_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001117238.1|674060_674363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000414792.1|674559_674910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465125.1|675043_675952_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_001067858.1|676014_676719_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000555098.1|677994_678279_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000781558.1|678281_678638_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
WP_000753551.1|678730_680290_+|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_000155092.1|680933_681818_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|681873_683349_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|683747_684932_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|684980_685166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|685385_685667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|685647_686421_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|687819_689361_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|689765_690605_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|690598_690946_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|691109_691901_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_002075262.1|691958_692591_-	type B-3 chloramphenicol O-acetyltransferase CatB8	NA	A0A2R8FE91	Brazilian_cedratvirus	40.1	3.5e-25
WP_014454105.1|692683_693238_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001067858.1|693833_694538_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|695210_695915_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 44
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	711011	712499	3983848		Burkholderia_virus(100.0%)	1	NA	NA
WP_001260530.1|711011_712499_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.9	6.1e-60
>prophage 45
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	732360	733290	3983848	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_001091151.1|732360_733290_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
>prophage 46
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	739941	740745	3983848		Iragoides_fasciata_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_000912071.1|739941_740745_-	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.0e-05
>prophage 47
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	744509	753256	3983848	protease,tRNA	Moraxella_phage(25.0%)	8	NA	NA
WP_000636263.1|744509_745520_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
WP_001136722.1|745665_745881_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000209409.1|745907_746354_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	2.5e-17
WP_002000697.1|746444_747872_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000758326.1|748018_748984_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	3.8e-15
WP_000580181.1|748995_749646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000665946.1|749746_751636_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000334670.1|751714_753256_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.8	1.5e-85
>prophage 48
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	759428	762516	3983848		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	4	NA	NA
WP_002000703.1|759428_760598_-	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	3.4e-50
WP_000126912.1|760683_760896_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.5e-12
WP_000108398.1|761270_761516_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001285359.1|761649_762516_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.3	2.1e-44
>prophage 49
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	777489	778503	3983848		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001093417.1|777489_778503_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	46.7	2.2e-77
>prophage 50
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	784329	786814	3983848		Bacillus_phage(66.67%)	3	NA	NA
WP_001257360.1|784329_785688_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	24.8	7.6e-17
WP_001221447.1|785684_786347_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.1	5.0e-22
WP_000783090.1|786454_786814_-	NirD/YgiW/YdeI family stress tolerance protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	3.3e-12
>prophage 51
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	794509	797560	3983848	tRNA	Phage_TP(33.33%)	4	NA	NA
WP_000845862.1|794509_795880_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	62.9	2.6e-126
WP_001196299.1|795882_796146_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	49.4	1.5e-17
WP_101329618.1|796382_796712_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000438614.1|796783_797560_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	3.1e-23
>prophage 52
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	802476	815211	3983848		Leptospira_phage(20.0%)	10	NA	NA
WP_001027056.1|802476_805656_+	multidrug efflux RND transporter permease subunit AdeG	NA	S5VTK5	Leptospira_phage	21.5	3.3e-63
WP_000633124.1|805668_807117_+	multidrug efflux RND transporter outer membrane subunit AdeH	NA	NA	NA	NA	NA
WP_000457893.1|807157_808411_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
WP_000523677.1|808570_809398_+	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_000782592.1|809457_810687_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001147934.1|810936_811623_+	DUF3820 family protein	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.8e-35
WP_017897439.1|811767_812403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128669.1|812696_813632_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_001010536.1|813628_814402_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000110166.1|814398_815211_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
>prophage 53
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	818515	819085	3983848		Synechococcus_phage(100.0%)	1	NA	NA
WP_002000723.1|818515_819085_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.5	1.9e-22
>prophage 54
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	836861	838244	3983848		Pandoravirus(100.0%)	1	NA	NA
WP_000994841.1|836861_838244_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.4	1.5e-41
>prophage 55
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	845475	847939	3983848		Sinorhizobium_phage(50.0%)	2	NA	NA
WP_001198539.1|845475_846714_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.3	1.6e-90
WP_001254962.1|846763_847939_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
>prophage 56
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	856263	874706	3983848		Acinetobacter_phage(100.0%)	12	NA	NA
WP_000872622.1|856263_857805_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
WP_033915478.1|857801_859604_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	99.8	0.0e+00
WP_000566784.1|859909_860485_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
WP_000960548.1|860580_863280_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000281127.1|863359_866092_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_001982145.1|866447_867497_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608304.1|867506_868313_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_000066126.1|868322_869018_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164226.1|869028_870012_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_001076817.1|870018_872394_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_000893683.1|872395_873895_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001187844.1|874157_874706_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 57
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	887443	892042	3983848		Bacillus_phage(33.33%)	4	NA	NA
WP_001095752.1|887443_889039_-	acinetobactin export ABC transporter permease/ATP-binding subunit BarB	NA	W8CYL7	Bacillus_phage	44.8	4.4e-24
WP_031967279.1|889035_890619_-	acinetobactin export ABC transporter permease/ATP-binding subunit BarA	NA	G9BWD6	Planktothrix_phage	31.8	1.7e-12
WP_001176134.1|890638_890794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000603876.1|890890_892042_-	acinetobactin biosynthesis histidine decarboxylase BasG	NA	A7J7V4	Paramecium_bursaria_Chlorella_virus	33.7	6.1e-52
>prophage 58
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	902545	909781	3983848		Brazilian_cedratvirus(33.33%)	5	NA	NA
WP_000582115.1|902545_903316_-	ferric acinetobactin ABC transporter ATP-binding protein BauE	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	1.1e-17
WP_001223274.1|903312_904260_-	ferric acinetobactin ABC transporter permease subunit BauC	NA	NA	NA	NA	NA
WP_085916975.1|904259_905243_-	ferric acinetobactin ABC transporter permease subunit BauD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	41.6	1.1e-62
WP_000939834.1|905832_907863_+	acinetobactin non-ribosomal peptide synthetase subunit BasB	NA	NA	NA	NA	NA
WP_000910253.1|907933_909781_-	acinetobactin non-ribosomal peptide synthetase subunit BasA	NA	A0A2K9KZV5	Tupanvirus	24.7	2.1e-38
>prophage 59
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	921185	921392	3983848		Escherichia_phage(100.0%)	1	NA	NA
WP_000816060.1|921185_921392_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	50.0	2.4e-07
>prophage 60
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	931557	937305	3983848	transposase	Vibrio_phage(50.0%)	4	NA	NA
WP_001202896.1|931557_933231_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.0	1.3e-31
WP_001202883.1|933497_935162_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-25
WP_002048759.1|935327_936260_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	43.0	2.2e-60
WP_000695007.1|936378_937305_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	37.0	1.2e-53
>prophage 61
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	965806	969838	3983848		Xanthomonas_phage(33.33%)	5	NA	NA
WP_000550750.1|965806_966637_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.6e-12
WP_001023216.1|966751_967519_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	2.0e-54
WP_000846423.1|967621_967993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480885.1|968140_968563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197256.1|968689_969838_+	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	36.8	1.0e-62
>prophage 62
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	973031	974420	3983848		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000993080.1|973031_974420_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.2	9.5e-100
>prophage 63
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	977655	987283	3983848	protease	Bodo_saltans_virus(25.0%)	7	NA	NA
WP_000897185.1|977655_978618_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.8	5.9e-24
WP_002000060.1|978764_979622_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	7.6e-15
WP_000372632.1|979680_981051_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_001050723.1|981074_982454_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_001238909.1|982554_983586_-	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.2	5.0e-61
WP_000339846.1|984041_985421_-	amino acid permease	NA	NA	NA	NA	NA
WP_000469457.1|985561_987283_-	alpha-keto acid decarboxylase family protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.1	4.6e-27
>prophage 64
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	991216	992590	3983848		Klosneuvirus(100.0%)	1	NA	NA
WP_000117540.1|991216_992590_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.2e-24
>prophage 65
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	999316	1002154	3983848		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000413587.1|999316_1002154_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	5.6e-22
>prophage 66
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1009129	1011892	3983848		Tupanvirus(100.0%)	1	NA	NA
WP_000480989.1|1009129_1011892_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	3.7e-18
>prophage 67
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1018077	1019334	3983848		Phage_21(100.0%)	1	NA	NA
WP_000542119.1|1018077_1019334_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	2.4e-17
>prophage 68
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1024954	1029824	3983848		Stx2-converting_phage(50.0%)	4	NA	NA
WP_000667917.1|1024954_1026274_+	D-alanyl-D-alanine carboxypeptidase PBP6B	NA	B6DZZ7	Stx2-converting_phage	39.2	1.4e-36
WP_000193163.1|1026373_1027660_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000123995.1|1027795_1028278_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000063728.1|1028381_1029824_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	33.1	6.5e-59
>prophage 69
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1035627	1036764	3983848		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000718061.1|1035627_1036764_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	29.6	1.1e-24
>prophage 70
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1040141	1092055	3983848	tRNA,terminase,capsid,tail,holin,integrase	Acinetobacter_phage(65.79%)	62	1041110:1041125	1093934:1093949
WP_001988581.1|1040141_1041188_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
1041110:1041125	attL	CACCGGCCATAGGGGC	NA	NA	NA	NA
WP_000537617.1|1041291_1042896_+|integrase	site-specific integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.1	1.4e-91
WP_000200051.1|1042898_1043090_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	83.9	4.4e-24
WP_000566934.1|1043151_1043742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958559.1|1043989_1044319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002016874.1|1044339_1044570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189398.1|1044741_1045059_-	hypothetical protein	NA	A0A1W5PUJ8	Salmonella_phage	58.5	9.6e-24
WP_001019749.1|1045059_1045605_-	N-acetylmuramidase	NA	A0A0B5KTG8	Acinetobacter_phage	89.4	1.1e-91
WP_000200151.1|1045663_1045888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999700.1|1045868_1046162_-|holin	holin	holin	NA	NA	NA	NA
WP_000371015.1|1046230_1046956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141976.1|1046955_1047279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018917.1|1047279_1057299_-|tail	tail protein	tail	A0A0R6PIC9	Moraxella_phage	37.2	1.6e-10
WP_000920736.1|1057365_1058037_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	46.8	1.2e-39
WP_000778488.1|1058020_1058776_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	57.4	4.5e-88
WP_000175075.1|1058782_1059481_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
WP_000985763.1|1059490_1059841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281459.1|1059895_1060237_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000191304.1|1060354_1064320_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	44.7	3.7e-165
WP_000720591.1|1064380_1064782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966689.1|1064862_1065267_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	88.8	1.0e-62
WP_000838146.1|1065331_1065514_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_001185622.1|1065844_1066378_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	59.9	6.3e-44
WP_000094300.1|1066422_1067352_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	40.8	5.3e-54
WP_000121166.1|1067459_1067672_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	75.4	1.3e-21
WP_001132270.1|1067673_1068072_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	71.2	4.0e-51
WP_000539752.1|1068073_1068442_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	4.8e-51
WP_000248324.1|1068413_1068818_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	92.5	4.9e-65
WP_001197735.1|1068826_1069240_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	76.6	5.6e-56
WP_000008492.1|1069196_1069586_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	9.5e-66
WP_000767881.1|1069590_1070256_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	67.4	5.2e-72
WP_000214195.1|1070320_1071277_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	5.6e-168
WP_000770060.1|1071304_1072072_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	94.1	8.1e-117
WP_000159880.1|1072185_1072500_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	48.5	3.4e-13
WP_000166323.1|1072568_1073081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741600.1|1073373_1074477_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	83.4	5.9e-177
WP_001286349.1|1074478_1075930_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	90.2	1.2e-259
WP_000102065.1|1075926_1077354_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	88.4	1.2e-251
WP_000729373.1|1077343_1077814_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.7	2.6e-73
WP_000372127.1|1077872_1078514_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.2	4.4e-124
WP_000377939.1|1078482_1078950_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.8	4.4e-65
WP_000359988.1|1078939_1079113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000837652.1|1079427_1080198_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	60.8	1.4e-89
WP_001989822.1|1080383_1080614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214487.1|1080794_1081358_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
WP_001279874.1|1081379_1081664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203140.1|1081673_1082081_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
WP_001293626.1|1082077_1082479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039747.1|1082465_1082648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000779000.1|1082644_1083043_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	1.5e-26
WP_000755976.1|1083054_1083921_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	43.7	1.4e-72
WP_000631609.1|1083917_1084376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049976.1|1084372_1085476_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	56.1	1.4e-29
WP_000612880.1|1085472_1086327_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_000108908.1|1086323_1086650_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	36.0	3.2e-06
WP_001178948.1|1086668_1086983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000204996.1|1087101_1087350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000354979.1|1087467_1088244_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_000812681.1|1088461_1088650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747792.1|1088652_1088973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990508.1|1088987_1090022_+	ERF family protein	NA	L0P6F6	Lactobacillus_phage	36.7	3.9e-13
WP_001023799.1|1090702_1092055_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	33.1	8.3e-40
1093934:1093949	attR	CACCGGCCATAGGGGC	NA	NA	NA	NA
>prophage 71
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1095932	1097066	3983848		Streptococcus_phage(100.0%)	1	NA	NA
WP_000573844.1|1095932_1097066_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	1.6e-68
>prophage 72
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1102766	1106440	3983848		Tupanvirus(50.0%)	3	NA	NA
WP_000885644.1|1102766_1103354_-	lipocalin family protein	NA	A0A2K9L4H1	Tupanvirus	33.5	2.5e-17
WP_001004983.1|1103447_1105469_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_000222200.1|1105648_1106440_+	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	8.8e-26
>prophage 73
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1116142	1125125	3983848		Streptococcus_phage(50.0%)	9	NA	NA
WP_000160699.1|1116142_1116835_-	ribonuclease III	NA	M1H9B8	Acanthocystis_turfacea_Chlorella_virus	37.0	2.6e-21
WP_001224039.1|1116806_1117181_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_000344900.1|1117204_1118032_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000035781.1|1118102_1119920_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.7e-19
WP_000094834.1|1120094_1120547_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002000087.1|1120667_1122059_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	4.7e-22
WP_000367539.1|1122274_1123918_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000842540.1|1123972_1124389_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000470763.1|1124525_1125125_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.1	1.1e-33
>prophage 74
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1130735	1131797	3983848		Bacillus_virus(100.0%)	1	NA	NA
WP_000027499.1|1130735_1131797_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	9.7e-28
>prophage 75
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1134815	1146017	3983848		Bacillus_phage(16.67%)	11	NA	NA
WP_000157724.1|1134815_1135526_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.7	5.7e-40
WP_001984660.1|1135554_1136238_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.4	6.7e-30
WP_000771345.1|1136251_1136668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001153972.1|1136759_1137446_+	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_001293534.1|1137463_1137925_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_001050713.1|1138046_1138616_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_002017037.1|1138686_1139277_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	36.3	3.7e-21
WP_000175547.1|1139386_1140187_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000916029.1|1140183_1140501_-	NIF3 1	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	29.4	6.5e-12
WP_050674945.1|1140895_1142062_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	28.8	3.1e-27
WP_000471081.1|1142183_1146017_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	55.0	6.3e-109
>prophage 76
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1156442	1157414	3983848		Klosneuvirus(100.0%)	1	NA	NA
WP_000067971.1|1156442_1157414_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	9.4e-46
>prophage 77
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1167655	1175537	3983848		Prochlorococcus_phage(20.0%)	7	NA	NA
WP_000071984.1|1167655_1168726_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	6.5e-80
WP_000975536.1|1168722_1169352_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.4e-26
WP_000114076.1|1169415_1170225_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001286615.1|1170243_1171260_-	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	26.5	7.1e-12
WP_001984639.1|1171396_1172380_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_000472705.1|1172332_1174765_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	31.4	1.3e-27
WP_000049403.1|1174850_1175537_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	35.2	7.6e-34
>prophage 78
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1179852	1180932	3983848		Streptococcus_phage(100.0%)	1	NA	NA
WP_001203182.1|1179852_1180932_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	49.7	4.1e-90
>prophage 79
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1187210	1196381	3983848		Shigella_phage(33.33%)	7	NA	NA
WP_001022410.1|1187210_1188191_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	45.9	1.5e-67
WP_000494036.1|1188190_1188571_+	GtrA family protein	NA	NA	NA	NA	NA
WP_001188108.1|1188580_1190227_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_000116444.1|1190278_1192993_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.4	8.7e-97
WP_000025985.1|1193358_1194291_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_000646179.1|1194308_1195058_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_002000102.1|1195493_1196381_-	tyrosine recombinase XerC	NA	A0A2L1IV36	Escherichia_phage	32.4	2.7e-15
>prophage 80
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1204145	1206184	3983848		Tupanvirus(50.0%)	2	NA	NA
WP_000059537.1|1204145_1205120_-	EF-P lysine aminoacylase GenX	NA	A0A2K9KZX5	Tupanvirus	29.3	2.6e-27
WP_000706093.1|1205116_1206184_-	4-phosphoerythronate dehydrogenase	NA	M1NSB9	Streptococcus_phage	29.2	9.2e-18
>prophage 81
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1210473	1211631	3983848		Streptococcus_phage(100.0%)	1	NA	NA
WP_000869504.1|1210473_1211631_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	3.0e-38
>prophage 82
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1218314	1222313	3983848		Tupanvirus(100.0%)	1	NA	NA
WP_001071463.1|1218314_1222313_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.3	3.0e-69
>prophage 83
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1226370	1228643	3983848	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_000271249.1|1226370_1227276_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.6	6.2e-92
WP_002063109.1|1227866_1228643_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.0	7.1e-36
>prophage 84
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1236667	1238651	3983848		uncultured_virus(100.0%)	2	NA	NA
WP_001274623.1|1236667_1238302_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.9	8.1e-175
WP_000065579.1|1238360_1238651_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.3e-16
>prophage 85
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1256505	1260156	3983848		Burkholderia_virus(50.0%)	4	NA	NA
WP_001984607.1|1256505_1257837_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.8	3.1e-39
WP_001043188.1|1257953_1258376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278011.1|1258398_1259067_-	methyltransferase	NA	NA	NA	NA	NA
WP_001229847.1|1259307_1260156_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.4	1.2e-25
>prophage 86
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1264479	1267160	3983848		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001286662.1|1264479_1266375_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.4	1.4e-106
WP_000235573.1|1266509_1267160_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	A0A140HEP8	Marsac_virus	25.1	4.1e-05
>prophage 87
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1274221	1274854	3983848		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000380747.1|1274221_1274854_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	35.5	3.5e-17
>prophage 88
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1298761	1300264	3983848		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000526259.1|1298761_1300264_-	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.2	2.6e-18
>prophage 89
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1303987	1307640	3983848		Tupanvirus(50.0%)	3	NA	NA
WP_000114637.1|1303987_1304878_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.9e-17
WP_001048573.1|1304892_1306059_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000082613.1|1306206_1307640_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	9.4e-42
>prophage 90
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1322029	1323916	3983848		Vibrio_phage(100.0%)	1	NA	NA
WP_001281941.1|1322029_1323916_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.3e-38
>prophage 91
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1331726	1332998	3983848	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000566837.1|1331726_1332998_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.2	6.9e-97
>prophage 92
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1348871	1351751	3983848	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_000128713.1|1348871_1351751_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	3.7e-146
>prophage 93
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1355849	1357037	3983848		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002001094.1|1355849_1357037_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.3	4.9e-44
>prophage 94
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1367202	1368057	3983848		Pandoravirus(100.0%)	1	NA	NA
WP_001143941.1|1367202_1368057_+	SPFH/Band 7/PHB domain protein	NA	S4VVY8	Pandoravirus	29.3	4.0e-08
>prophage 95
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1402215	1403151	3983848		Klosneuvirus(100.0%)	1	NA	NA
WP_002027092.1|1402215_1403151_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	29.4	1.5e-08
>prophage 96
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1406699	1407914	3983848		Salmonella_phage(100.0%)	1	NA	NA
WP_000003701.1|1406699_1407914_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.9	1.3e-28
>prophage 97
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1419552	1432924	3983848		Bacillus_phage(20.0%)	8	NA	NA
WP_000658903.1|1419552_1424073_-	Hpt domain-containing protein	NA	W8CYM9	Bacillus_phage	39.3	4.3e-16
WP_000505931.1|1424219_1426298_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.0	1.6e-18
WP_000729757.1|1426344_1426881_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_000101096.1|1426941_1427304_-	response regulator	NA	A0A220YL79	Alteromonas_virus	31.3	8.7e-13
WP_033915473.1|1427327_1427711_-	response regulator	NA	Q8QKV4	Ectocarpus_siliculosus_virus	28.6	5.4e-05
WP_000110261.1|1428032_1428632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260821.1|1428691_1429810_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000264364.1|1429825_1432924_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	27.6	1.9e-95
>prophage 98
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1445725	1455465	3983848		Bacillus_virus(25.0%)	9	NA	NA
WP_001114562.1|1445725_1446550_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.7	3.2e-26
WP_001192454.1|1446569_1446860_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001984816.1|1446870_1447224_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000022555.1|1447365_1447797_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_001280092.1|1448052_1449888_-	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	39.4	2.3e-21
WP_000070856.1|1450066_1451425_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.0	2.2e-24
WP_000371518.1|1451487_1452501_+	methyltransferase	NA	NA	NA	NA	NA
WP_000004971.1|1452522_1453983_+	amino acid permease	NA	NA	NA	NA	NA
WP_000512707.1|1454259_1455465_+	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	58.4	1.4e-126
>prophage 99
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1459615	1459969	3983848		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000457787.1|1459615_1459969_-	quaternary ammonium transporter	NA	I3WVW1	Acinetobacter_phage	59.8	6.1e-27
>prophage 100
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1497674	1501153	3983848		Diadromus_pulchellus_ascovirus(33.33%)	3	NA	NA
WP_000199593.1|1497674_1498847_+	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.3	2.5e-32
WP_001160208.1|1498960_1500403_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.9	2.6e-44
WP_000680577.1|1500466_1501153_-	response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
>prophage 101
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1515704	1517483	3983848	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_000986451.1|1515704_1517483_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
>prophage 102
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1530030	1531299	3983848		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_000194116.1|1530030_1531299_-	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	25.2	4.6e-08
>prophage 103
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1535154	1540960	3983848	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_000667231.1|1535154_1536288_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
WP_000051669.1|1536386_1536716_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_001270222.1|1536767_1538669_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_001984787.1|1538677_1539643_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_000006958.1|1539706_1540960_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
>prophage 104
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1548926	1550261	3983848		Indivirus(50.0%)	2	NA	NA
WP_000587647.1|1548926_1549364_-	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	1.3e-10
WP_000543478.1|1549364_1550261_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	28.8	6.7e-22
>prophage 105
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1573669	1574098	3983848	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000003709.1|1573669_1574098_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	2.9e-31
>prophage 106
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1580496	1581399	3983848		Mollivirus(100.0%)	1	NA	NA
WP_000344603.1|1580496_1581399_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	22.3	3.1e-06
>prophage 107
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1598939	1603749	3983848	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_000792523.1|1598939_1600883_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	39.7	7.5e-10
WP_000218140.1|1601171_1602623_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_001986628.1|1602705_1603749_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.9	1.1e-47
>prophage 108
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1618392	1623013	3983848		Lactococcus_phage(50.0%)	2	NA	NA
WP_000803911.1|1618392_1620825_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	3.3e-71
WP_000266465.1|1620958_1623013_+	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	20.8	3.3e-32
>prophage 109
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1648412	1649960	3983848		Klebsiella_phage(100.0%)	1	NA	NA
WP_000537113.1|1648412_1649960_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	40.9	1.2e-74
>prophage 110
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1663522	1664104	3983848		Orpheovirus(100.0%)	1	NA	NA
WP_001084310.1|1663522_1664104_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.2	9.1e-12
>prophage 111
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1667764	1670807	3983848		Planktothrix_phage(50.0%)	3	NA	NA
WP_002019647.1|1667764_1668583_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.5e-23
WP_000471151.1|1668709_1668895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000047385.1|1668986_1670807_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	27.6	8.8e-45
>prophage 112
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1674377	1674980	3983848		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001121174.1|1674377_1674980_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	8.7e-42
>prophage 113
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1701588	1702803	3983848		Klosneuvirus(100.0%)	1	NA	NA
WP_000437496.1|1701588_1702803_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.4e-25
>prophage 114
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1713217	1717403	3983848		Salmonella_phage(100.0%)	3	NA	NA
WP_001143890.1|1713217_1713793_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	58.4	9.2e-41
WP_001061828.1|1713986_1716137_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000790119.1|1716173_1717403_-	MFS transporter	NA	S4TR35	Salmonella_phage	22.3	4.6e-13
>prophage 115
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1721575	1722808	3983848		Catovirus(100.0%)	1	NA	NA
WP_000077814.1|1721575_1722808_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.3e-103
>prophage 116
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1740600	1743894	3983848		Liberibacter_phage(50.0%)	3	NA	NA
WP_000015937.1|1740600_1741230_+	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	30.6	6.8e-13
WP_000135049.1|1741302_1741581_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001117590.1|1741788_1743894_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.3	5.3e-09
>prophage 117
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1751090	1751681	3983848		Lactococcus_phage(100.0%)	1	NA	NA
WP_000846931.1|1751090_1751681_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.7	8.9e-15
>prophage 118
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1787580	1790739	3983848		Leptospira_phage(100.0%)	1	NA	NA
WP_000353977.1|1787580_1790739_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VL66	Leptospira_phage	21.0	2.7e-25
>prophage 119
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1797174	1800412	3983848		Streptococcus_phage(50.0%)	2	NA	NA
WP_000090021.1|1797174_1798836_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.4	5.8e-43
WP_000221160.1|1799134_1800412_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.3	5.3e-12
>prophage 120
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1807139	1809379	3983848		Bacillus_phage(100.0%)	2	NA	NA
WP_000060753.1|1807139_1807904_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	2.8e-29
WP_000051217.1|1807921_1809379_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.4	2.0e-15
>prophage 121
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1824786	1828498	3983848		Enterobacteria_phage(50.0%)	3	NA	NA
WP_001985820.1|1824786_1825890_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	37.0	5.0e-27
WP_000581864.1|1826121_1826565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001181667.1|1826620_1828498_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.9	8.7e-72
>prophage 122
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1850286	1853235	3983848		Klosneuvirus(50.0%)	2	NA	NA
WP_000380901.1|1850286_1851579_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.2e-25
WP_001987724.1|1851690_1853235_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	6.6e-17
>prophage 123
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1856720	1859947	3983848		Salmonella_phage(50.0%)	3	NA	NA
WP_001215082.1|1856720_1857302_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	57.6	9.6e-38
WP_000980460.1|1857353_1858718_-	MFS transporter	NA	NA	NA	NA	NA
WP_000680210.1|1858864_1859947_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.2	2.6e-89
>prophage 124
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1863625	1873834	3983848	holin	uncultured_Mediterranean_phage(25.0%)	5	NA	NA
WP_000083356.1|1863625_1866457_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	0.0e+00
WP_000865808.1|1866471_1868127_-	AAA family ATPase	NA	X2KLG0	Campylobacter_phage	24.4	8.1e-21
WP_000016117.1|1868209_1869916_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	3.7e-13
WP_000733005.1|1870908_1871808_+	porin Omp33-36	NA	NA	NA	NA	NA
WP_001139472.1|1871866_1873834_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	9.9e-26
>prophage 125
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1877094	1880592	3983848		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001089744.1|1877094_1880592_+	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	24.0	1.0e-12
>prophage 126
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1884824	1889192	3983848	transposase	uncultured_virus(50.0%)	4	NA	NA
WP_000343018.1|1884824_1886033_-|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_001019415.1|1886134_1886548_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000806360.1|1886653_1887196_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001002960.1|1887242_1889192_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.9	1.1e-93
>prophage 127
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1894888	1902510	3983848		Pseudomonas_phage(33.33%)	6	NA	NA
WP_096640204.1|1894888_1895984_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	4.4e-07
WP_000731728.1|1896376_1897144_+	putative porin	NA	NA	NA	NA	NA
WP_000161616.1|1897188_1898889_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.3	2.1e-64
WP_169538932.1|1898889_1899555_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_000119870.1|1899556_1900894_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000956023.1|1901043_1902510_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	1.9e-90
>prophage 128
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1912538	1913231	3983848		Bacillus_virus(100.0%)	1	NA	NA
WP_000557460.1|1912538_1913231_-	M23 family metallopeptidase	NA	G3MBP9	Bacillus_virus	39.3	4.5e-18
>prophage 129
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1928898	1931179	3983848		Tupanvirus(50.0%)	2	NA	NA
WP_001025107.1|1928898_1929810_+	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	28.7	1.1e-08
WP_042782585.1|1930096_1931179_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	3.6e-22
>prophage 130
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1943506	1953682	3983848		uncultured_Caudovirales_phage(80.0%)	7	NA	NA
WP_000195974.1|1943506_1945390_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.6	1.7e-99
WP_001021718.1|1945404_1945986_-	esterase	NA	NA	NA	NA	NA
WP_001139636.1|1946198_1947542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223885.1|1947574_1948306_-	hypothetical protein	NA	A0A2H4JCF6	uncultured_Caudovirales_phage	61.3	3.0e-76
WP_002000764.1|1948286_1949882_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	75.3	7.6e-226
WP_002000762.1|1950007_1950310_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	79.1	8.8e-35
WP_001987787.1|1950319_1953682_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	75.4	0.0e+00
>prophage 131
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1963243	1972915	3983848		Bacillus_phage(50.0%)	9	NA	NA
WP_000650776.1|1963243_1963954_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.0e-33
WP_000273190.1|1963963_1965322_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	1.3e-29
WP_162492350.1|1965391_1966534_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000043212.1|1966825_1967584_+	AcfC family putative adhesin	NA	NA	NA	NA	NA
WP_001191147.1|1967654_1968074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921706.1|1968204_1969425_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	29.2	2.8e-18
WP_000011216.1|1969853_1970705_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000174479.1|1970701_1971550_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_000074561.1|1971700_1972915_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	5.7e-48
>prophage 132
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1977874	1984589	3983848		Staphylococcus_phage(50.0%)	7	NA	NA
WP_001131393.1|1977874_1978996_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.7	1.2e-52
WP_001007829.1|1979007_1979478_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.2e-34
WP_000084188.1|1979481_1979931_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_000807406.1|1979946_1980864_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_000380673.1|1980841_1981357_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_000108584.1|1981373_1982738_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.6	1.7e-32
WP_000334189.1|1982750_1984589_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.5	8.4e-128
>prophage 133
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1991981	1993520	3983848		Catovirus(100.0%)	1	NA	NA
WP_000421600.1|1991981_1993520_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.2	8.4e-89
>prophage 134
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	1997211	1998324	3983848		Gordonia_phage(100.0%)	1	NA	NA
WP_001246956.1|1997211_1998324_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	25.9	4.7e-09
>prophage 135
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2010575	2018818	3983848		Tupanvirus(20.0%)	10	NA	NA
WP_002017318.1|2010575_2011220_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	40.2	1.9e-26
WP_000193600.1|2011549_2012443_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001177091.1|2012458_2013061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917863.1|2013097_2013817_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	35.8	3.1e-38
WP_000418559.1|2014009_2014213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349494.1|2014498_2015338_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	36.7	4.6e-41
WP_001285411.1|2015353_2016619_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.0e-79
WP_075873895.1|2016724_2017846_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_101329625.1|2018006_2018465_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000490267.1|2018659_2018818_+	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	60.8	6.2e-08
>prophage 136
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2022918	2027649	3983848		Tupanvirus(50.0%)	6	NA	NA
WP_000069845.1|2022918_2023947_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.7	6.5e-45
WP_000143934.1|2023949_2025374_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001985074.1|2025334_2025457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770104.1|2025464_2025839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843085.1|2025822_2026725_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001025223.1|2026845_2027649_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.3	7.8e-38
>prophage 137
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2031060	2032173	3983848		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_001119029.1|2031060_2032173_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.3	1.9e-29
>prophage 138
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2040951	2042247	3983848		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000073454.1|2040951_2042247_+	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	64.8	4.2e-150
>prophage 139
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2047816	2048779	3983848	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000691201.1|2047816_2048779_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
>prophage 140
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2064713	2065049	3983848		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_000993572.1|2064713_2065049_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
>prophage 141
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2069044	2080116	3983848		Tupanvirus(20.0%)	10	NA	NA
WP_000613985.1|2069044_2070976_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	1.6e-65
WP_001009202.1|2071226_2071784_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_000987632.1|2071867_2072260_-	cytochrome b562	NA	NA	NA	NA	NA
WP_000093729.1|2072297_2074766_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	7.6e-116
WP_000550810.1|2074818_2075901_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_169518437.1|2075915_2076665_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	31.9	1.1e-30
WP_000964768.1|2077161_2078559_-	chromosomal replication initiator protein DnaA	NA	A0A1B1IPE6	uncultured_Mediterranean_phage	31.0	5.2e-05
WP_000831329.1|2079228_2079363_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_001240374.1|2079392_2079785_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000251652.1|2079795_2080116_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	49.4	6.3e-15
>prophage 142
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2085975	2092139	3983848		uncultured_virus(33.33%)	6	NA	NA
WP_000214980.1|2085975_2086503_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	3.6e-15
WP_000052269.1|2086717_2088043_-	guanine deaminase	NA	NA	NA	NA	NA
WP_000991547.1|2088099_2089155_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000823200.1|2089446_2090607_-	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	44.5	2.6e-95
WP_001256727.1|2090628_2090994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447698.1|2091182_2092139_-	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.8	1.3e-31
>prophage 143
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2096670	2097183	3983848		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000994663.1|2096670_2097183_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
>prophage 144
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2101864	2105053	3983848	protease	Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000714225.1|2101864_2102782_-|protease	matrixin family metalloprotease	protease	W6JIV8	Anomala_cuprea_entomopoxvirus	46.9	7.6e-05
WP_001062604.1|2103112_2105053_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	2.2e-147
>prophage 145
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2109127	2110899	3983848		Tupanvirus(50.0%)	2	NA	NA
WP_000123594.1|2109127_2110198_+	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	9.8e-12
WP_014538288.1|2110413_2110899_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.7	3.3e-15
>prophage 146
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2118827	2121665	3983848	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001281041.1|2118827_2121665_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.9	1.0e-76
>prophage 147
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2125632	2126433	3983848		Bacillus_virus(100.0%)	1	NA	NA
WP_000183286.1|2125632_2126433_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.9	4.3e-28
>prophage 148
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2149174	2155607	3983848		Streptococcus_phage(33.33%)	5	NA	NA
WP_033915475.1|2149174_2151358_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	33.7	1.5e-19
WP_001159773.1|2151376_2151805_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_000872580.1|2151809_2152910_-	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_001175104.1|2153268_2154543_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	28.1	5.4e-25
WP_001017078.1|2154566_2155607_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	47.3	3.6e-75
>prophage 149
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2160841	2164131	3983848		Klosneuvirus(100.0%)	3	NA	NA
WP_000471755.1|2160841_2161876_+	polysaccharide biosynthesis protein	NA	A0A1V0SJP4	Klosneuvirus	33.5	6.5e-37
WP_000866952.1|2161878_2162988_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000734323.1|2163000_2164131_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	50.0	1.5e-106
>prophage 150
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2168358	2169234	3983848		Bacillus_phage(100.0%)	1	NA	NA
WP_000591428.1|2168358_2169234_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.9	1.2e-60
>prophage 151
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2172273	2173290	3983848		Tupanvirus(100.0%)	1	NA	NA
WP_001062903.1|2172273_2173290_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.2	6.1e-80
>prophage 152
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2194978	2197765	3983848		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_033915474.1|2194978_2197765_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	51.7	1.1e-277
>prophage 153
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2216673	2218323	3983848		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000969580.1|2216673_2218323_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.8	4.0e-81
>prophage 154
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2221413	2234974	3983848	transposase	Burkholderia_virus(20.0%)	9	NA	NA
WP_017816154.1|2221413_2222766_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.0	3.8e-53
WP_086263473.1|2222858_2223425_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000253583.1|2223488_2223905_-	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
WP_000446790.1|2224663_2225380_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	28.2	7.3e-19
WP_002048759.1|2225449_2226382_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	43.0	2.2e-60
WP_000279933.1|2227045_2228935_+	fatty acyl-AMP ligase	NA	A0A1V0SBX8	Catovirus	22.7	1.0e-11
WP_099959821.1|2228985_2230761_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001030690.1|2230757_2231018_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_001060972.1|2231014_2234974_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.3	4.5e-110
>prophage 155
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2243903	2244746	3983848		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000957989.1|2243903_2244746_+	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.5	1.0e-11
>prophage 156
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2248894	2250463	3983848		Hokovirus(100.0%)	1	NA	NA
WP_000210750.1|2248894_2250463_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	4.3e-24
>prophage 157
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2255545	2257336	3983848	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_001090284.1|2255545_2257336_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.5	1.3e-16
>prophage 158
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2262095	2262884	3983848		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001112013.1|2262095_2262884_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	2.8e-16
>prophage 159
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2277336	2280915	3983848		Pandoravirus(33.33%)	4	NA	NA
WP_000633612.1|2277336_2277906_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	26.4	5.1e-07
WP_002017176.1|2277956_2279087_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.0	2.8e-25
WP_000755281.1|2279107_2280262_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001196539.1|2280384_2280915_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	3.8e-17
>prophage 160
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2292621	2293548	3983848		Lactococcus_phage(100.0%)	1	NA	NA
WP_162520283.1|2292621_2293548_+	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	52.4	9.6e-72
>prophage 161
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2297693	2300072	3983848		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000102049.1|2297693_2300072_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.2	2.8e-115
>prophage 162
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2305198	2316304	3983848		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_001986939.1|2305198_2305804_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
WP_000575778.1|2306148_2307741_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
WP_000193996.1|2307812_2308280_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000927792.1|2308325_2308970_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000364292.1|2309052_2310372_+	MFS transporter	NA	NA	NA	NA	NA
WP_000202252.1|2310525_2312745_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	3.2e-81
WP_000411991.1|2313042_2314722_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.7e-34
WP_001187001.1|2314760_2315144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001985514.1|2315238_2315649_+	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
WP_000122443.1|2315776_2316304_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
>prophage 163
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2323544	2324255	3983848	transposase	Vibriophage(100.0%)	1	NA	NA
WP_000736396.1|2323544_2324255_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
>prophage 164
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2329183	2331535	3983848		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000034564.1|2329183_2330035_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_000953322.1|2330047_2331535_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
>prophage 165
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2335534	2343575	3983848		Staphylococcus_phage(40.0%)	9	NA	NA
WP_000738520.1|2335534_2336932_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000543541.1|2337090_2337549_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_017816295.1|2337564_2338650_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	1.1e-47
WP_001083669.1|2338646_2339939_+	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_017816294.1|2339981_2340641_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.1	1.9e-34
WP_000354154.1|2340700_2340919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988710.1|2341049_2341688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017816293.1|2341726_2342134_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000673449.1|2342126_2343575_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
>prophage 166
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2347577	2351735	3983848		Moraxella_phage(50.0%)	3	NA	NA
WP_000939107.1|2347577_2348762_+	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_017816292.1|2348765_2350187_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_099959820.1|2350211_2351735_-	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.1	1.8e-06
>prophage 167
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2357494	2358415	3983848		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000608735.1|2357494_2358415_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	2.3e-33
>prophage 168
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2384705	2391858	3983848		Vibrio_phage(33.33%)	5	NA	NA
WP_001196426.1|2384705_2386982_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	35.2	2.0e-30
WP_000219967.1|2387022_2387652_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_000109464.1|2387717_2388386_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_000209084.1|2388494_2389988_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	30.4	3.0e-35
WP_001029610.1|2390667_2391858_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
>prophage 169
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2395832	2406826	3983848		Tetraselmis_virus(33.33%)	6	NA	NA
WP_000331899.1|2395832_2399921_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.0	3.6e-22
WP_000653927.1|2400007_2404201_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	1.2e-68
WP_000738603.1|2404368_2404734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034851.1|2404947_2405304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996189.1|2405332_2405830_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_001987811.1|2405947_2406826_+	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	30.9	7.8e-07
>prophage 170
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2409903	2411823	3983848		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001294942.1|2409903_2411823_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	2.0e-119
>prophage 171
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2422678	2423593	3983848		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000598899.1|2422678_2423593_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.3	4.0e-38
>prophage 172
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2428659	2429514	3983848		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001178150.1|2428659_2429514_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.3	3.6e-17
>prophage 173
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2449948	2452648	3983848		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000130326.1|2449948_2452648_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	7.2e-27
>prophage 174
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2461070	2466567	3983848		Acinetobacter_phage(50.0%)	4	NA	NA
WP_000065138.1|2461070_2462573_-	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	36.0	2.4e-80
WP_001066569.1|2462582_2463356_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000856572.1|2463509_2464823_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000612218.1|2464947_2466567_-	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.7	1.6e-29
>prophage 175
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2475046	2480587	3983848		Bacillus_phage(50.0%)	2	NA	NA
WP_002000661.1|2475046_2478727_+	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	23.1	4.4e-11
WP_000369435.1|2478835_2480587_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.1	2.6e-17
>prophage 176
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2487311	2488268	3983848		Megavirus(100.0%)	1	NA	NA
WP_001107921.1|2487311_2488268_-	DnaJ domain-containing protein	NA	K7YGN1	Megavirus	49.4	6.7e-12
>prophage 177
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2506007	2512535	3983848		Streptococcus_phage(33.33%)	9	NA	NA
WP_000942274.1|2506007_2506652_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.6	5.3e-21
WP_001138289.1|2506648_2506843_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_014466029.1|2506930_2507569_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000066760.1|2507558_2508764_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_000075984.1|2508841_2509252_+	GFA family protein	NA	NA	NA	NA	NA
WP_000291738.1|2509487_2509868_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.3	3.0e-24
WP_000046495.1|2510296_2510629_-	HopJ type III effector protein	NA	NA	NA	NA	NA
WP_001224256.1|2510881_2511136_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_101329629.1|2511236_2512535_-	ABC transporter	NA	G9E4X0	Ostreococcus_lucimarinus_virus	31.1	2.2e-29
>prophage 178
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2536295	2538590	3983848		Hokovirus(100.0%)	1	NA	NA
WP_000069129.1|2536295_2538590_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.2	4.7e-19
>prophage 179
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2559421	2571899	3983848		Morganella_phage(25.0%)	11	NA	NA
WP_000078878.1|2559421_2560357_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	33.3	1.8e-41
WP_000886284.1|2560476_2561109_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000323476.1|2561254_2563165_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.3e-46
WP_000165735.1|2563197_2563443_+	SlyX family protein	NA	NA	NA	NA	NA
WP_000648652.1|2563490_2564501_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001029768.1|2564600_2564978_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000368721.1|2565125_2565575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024261.1|2565610_2568247_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.5	2.0e-90
WP_000265777.1|2568334_2569093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859452.1|2569230_2569803_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_000050352.1|2569919_2571899_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	28.2	6.0e-63
>prophage 180
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2583024	2584421	3983848		Erwinia_phage(50.0%)	2	NA	NA
WP_000312553.1|2583024_2583534_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	45.1	1.8e-24
WP_001203168.1|2583578_2584421_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	9.2e-98
>prophage 181
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2594738	2595365	3983848		Cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_000106708.1|2594738_2595365_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	30.8	8.9e-13
>prophage 182
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2600110	2600794	3983848		Cyanophage(100.0%)	1	NA	NA
WP_001984475.1|2600110_2600794_-	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	30.1	4.3e-21
>prophage 183
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2605071	2607092	3983848	protease	Agrobacterium_phage(50.0%)	2	NA	NA
WP_000289452.1|2605071_2605677_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
WP_001289250.1|2605778_2607092_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
>prophage 184
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2621069	2622335	3983848		Streptococcus_phage(100.0%)	1	NA	NA
WP_001154159.1|2621069_2622335_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.9	3.6e-98
>prophage 185
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2626141	2631183	3983848		Moraxella_phage(50.0%)	5	NA	NA
WP_000776304.1|2626141_2628325_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	48.8	2.0e-184
WP_000348500.1|2628463_2629762_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000669567.1|2629786_2630338_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000524329.1|2630437_2630638_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000963851.1|2630751_2631183_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.5	6.7e-20
>prophage 186
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2635269	2636562	3983848	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000095264.1|2635269_2636562_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	5.3e-20
>prophage 187
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2646044	2647580	3983848		Catovirus(100.0%)	1	NA	NA
WP_001265376.1|2646044_2647580_+	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	30.6	1.3e-57
>prophage 188
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2658090	2660624	3983848		Salicola_phage(50.0%)	4	NA	NA
WP_000729828.1|2658090_2658348_-	glutaredoxin 3	NA	A0A248SKD6	Salicola_phage	39.7	1.2e-08
WP_000443006.1|2658359_2658776_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001174001.1|2658873_2659932_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000099436.1|2660057_2660624_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.0e-27
>prophage 189
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2663937	2684204	3983848	tRNA,transposase	Planktothrix_phage(14.29%)	14	NA	NA
WP_000165904.1|2663937_2665932_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.3e-36
WP_001124214.1|2665934_2667275_-	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	50.0	9.7e-17
WP_000762831.1|2667382_2668372_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000549819.1|2668391_2668901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101329630.1|2668928_2671553_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.4	4.1e-176
WP_001054470.1|2671739_2672069_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_000422094.1|2672573_2674298_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	5.4e-52
WP_001215920.1|2674297_2674789_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_001165443.1|2674821_2675838_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000510213.1|2676168_2678223_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.9	2.6e-21
WP_000122215.1|2678827_2679391_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001091151.1|2680093_2681023_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_000037366.1|2681543_2682407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008538.1|2682611_2684204_+	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
>prophage 190
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2690556	2691321	3983848	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_001281716.1|2690556_2691321_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.6	2.0e-14
>prophage 191
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2704453	2710590	3983848		Hokovirus(33.33%)	4	NA	NA
WP_000064534.1|2704453_2707261_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.2e-50
WP_002000561.1|2707424_2708348_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.3	4.9e-52
WP_001212164.1|2708370_2709189_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000813062.1|2709198_2710590_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.6	1.4e-29
>prophage 192
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2715196	2716630	3983848		Bacillus_virus(100.0%)	1	NA	NA
WP_169538972.1|2715196_2716630_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	31.1	3.5e-20
>prophage 193
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2720556	2725076	3983848	tRNA	Staphylococcus_phage(33.33%)	3	NA	NA
WP_000253052.1|2720556_2722185_-	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	3.9e-28
WP_001121792.1|2722596_2724519_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.0	9.1e-125
WP_012297364.1|2724524_2725076_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.6	1.9e-11
>prophage 194
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2728577	2737297	3983848	tRNA	Serratia_phage(25.0%)	10	NA	NA
WP_000650943.1|2728577_2729135_+	NADAR family protein	NA	A0A1S6UAJ7	Serratia_phage	45.3	1.1e-33
WP_000803551.1|2729193_2729697_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001207245.1|2729703_2730705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050953.1|2730862_2731843_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	1.5e-35
WP_000703074.1|2731876_2734258_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000126166.1|2734254_2734551_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	39.3	3.5e-12
WP_000897685.1|2734720_2734966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002127429.1|2735060_2735186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054522.1|2735380_2736649_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_001276875.1|2736970_2737297_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.2	2.0e-16
>prophage 195
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2742735	2745507	3983848		uncultured_virus(100.0%)	1	NA	NA
WP_001134660.1|2742735_2745507_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	1.1e-65
>prophage 196
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2769818	2771174	3983848		Pandoravirus(100.0%)	1	NA	NA
WP_000018788.1|2769818_2771174_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.9	2.3e-26
>prophage 197
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2785626	2785899	3983848		uncultured_virus(100.0%)	1	NA	NA
WP_000843456.1|2785626_2785899_-	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	8.3e-08
>prophage 198
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2792667	2793147	3983848		Streptococcus_phage(100.0%)	1	NA	NA
WP_000927482.1|2792667_2793147_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.9	4.5e-25
>prophage 199
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2809110	2810421	3983848		Burkholderia_virus(100.0%)	1	NA	NA
WP_000383637.1|2809110_2810421_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.9	1.5e-49
>prophage 200
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2826277	2826895	3983848		Escherichia_phage(100.0%)	1	NA	NA
WP_000807825.1|2826277_2826895_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	34.8	2.0e-25
>prophage 201
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2859132	2859975	3983848		uncultured_marine_virus(100.0%)	1	NA	NA
WP_000134740.1|2859132_2859975_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	34.2	2.0e-23
>prophage 202
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2865037	2874304	3983848		Bacillus_phage(40.0%)	8	NA	NA
WP_000025829.1|2865037_2866321_-	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.4	5.4e-41
WP_000465010.1|2866458_2866593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111540.1|2866648_2869483_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.4	7.7e-181
WP_000143214.1|2869812_2870019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000076440.1|2870015_2870732_+	response regulator transcription factor BfmR	NA	W8CYM9	Bacillus_phage	37.7	3.1e-38
WP_000226704.1|2870821_2872414_+	sensor histidine kinase BfmS	NA	Q8QKV4	Ectocarpus_siliculosus_virus	23.6	1.2e-05
WP_011858483.1|2872436_2872736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147032.1|2872882_2874304_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	2.5e-15
>prophage 203
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2909717	2910287	3983848		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000985728.1|2909717_2910287_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	3.3e-75
>prophage 204
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2930017	2932054	3983848		Ralstonia_phage(100.0%)	1	NA	NA
WP_001018842.1|2930017_2932054_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.3	6.0e-119
>prophage 205
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2937777	2943233	3983848		Klosneuvirus(33.33%)	6	NA	NA
WP_000131430.1|2937777_2939058_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	7.6e-19
WP_000054334.1|2939059_2940217_+	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	25.5	4.6e-31
WP_000055843.1|2940213_2940963_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000016597.1|2940963_2941608_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_059273170.1|2941671_2942595_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000093856.1|2942636_2943233_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.2	4.2e-20
>prophage 206
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2947671	2951700	3983848		Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
WP_000191300.1|2947671_2948406_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	2.2e-18
WP_001279871.1|2948490_2948727_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	1.1e-11
WP_000522216.1|2948917_2949391_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_001247938.1|2949436_2950204_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_000985175.1|2950301_2950976_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000096538.1|2951040_2951700_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.9	2.8e-41
>prophage 207
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2956024	2956975	3983848		Tupanvirus(100.0%)	1	NA	NA
WP_001133287.1|2956024_2956975_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.9	3.3e-43
>prophage 208
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2961962	2963828	3983848		Caulobacter_phage(100.0%)	1	NA	NA
WP_001007229.1|2961962_2963828_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.1	7.1e-58
>prophage 209
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2967829	2969198	3983848		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_001029798.1|2967829_2968306_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	4.2e-23
WP_000047853.1|2968441_2968933_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.3	3.7e-30
WP_001979799.1|2968934_2969198_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.0	2.4e-20
>prophage 210
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2973324	2975963	3983848		Vibrio_phage(50.0%)	2	NA	NA
WP_101329632.1|2973324_2974977_+	BCCT family carnitine transporter	NA	A0A2I7QNT1	Vibrio_phage	23.1	4.6e-08
WP_000214723.1|2974988_2975963_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	29.1	7.3e-30
>prophage 211
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2980939	2982565	3983848		Agrobacterium_phage(100.0%)	1	NA	NA
WP_000834616.1|2980939_2982565_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	6.6e-92
>prophage 212
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2989337	2992761	3983848		Streptococcus_phage(50.0%)	2	NA	NA
WP_000113824.1|2989337_2991476_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.1	2.1e-50
WP_001029610.1|2991570_2992761_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
>prophage 213
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	2997251	3001501	3983848		Orpheovirus(50.0%)	2	NA	NA
WP_001276144.1|2997251_2998199_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	3.2e-62
WP_000127823.1|2998468_3001501_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	45.0	8.5e-77
>prophage 214
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3008780	3012915	3983848		Bacillus_phage(66.67%)	3	NA	NA
WP_000093035.1|3008780_3010820_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	3.2e-112
WP_000868152.1|3010844_3011297_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	57.5	2.0e-46
WP_001102845.1|3011496_3012915_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	1.3e-40
>prophage 215
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3022224	3025821	3983848		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000698785.1|3022224_3025821_-	AAA family ATPase	NA	Q5ULP4	Lactobacillus_virus	27.4	3.4e-08
>prophage 216
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3038730	3057645	3983848	integrase	Acinetobacter_phage(47.06%)	30	3032367:3032380	3048552:3048565
3032367:3032380	attL	TCAACCAATTGTGT	NA	NA	NA	NA
WP_000947476.1|3038730_3039882_+|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	62.8	8.4e-134
WP_000240808.1|3039866_3040550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119263.1|3040560_3040731_-	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	71.4	1.2e-12
WP_000805206.1|3040857_3041220_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_000644004.1|3041232_3041913_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_001095305.1|3042083_3042452_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	38.4	1.3e-08
WP_001072364.1|3042448_3042778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350170.1|3042836_3043097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020752532.1|3043182_3043986_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	32.8	2.8e-27
WP_000105905.1|3044026_3044359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000922095.1|3044574_3044850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000550612.1|3044861_3045551_-	helix-turn-helix domain-containing protein	NA	A0A0R6PCY1	Moraxella_phage	37.1	5.0e-25
WP_000335919.1|3045677_3045911_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000818521.1|3045943_3046318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290738.1|3046351_3046552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|3046548_3046734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000575725.1|3046730_3047186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205618.1|3047182_3047821_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	46.2	1.1e-47
WP_020752533.1|3047826_3049497_+	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	45.9	1.8e-153
3048552:3048565	attR	TCAACCAATTGTGT	NA	NA	NA	NA
WP_020752534.1|3049493_3050540_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	4.5e-110
WP_001110396.1|3050536_3051487_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
WP_000544506.1|3051479_3052229_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
WP_001031749.1|3052225_3052360_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_000648413.1|3052346_3052769_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_095357150.1|3052818_3053181_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_002052057.1|3053252_3054323_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	59.6	4.6e-110
WP_000124473.1|3054399_3055443_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_000994866.1|3055439_3056204_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
WP_000990950.1|3056200_3056734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136753.1|3057189_3057645_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
>prophage 217
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3070850	3079096	3983848	terminase,tail	Escherichia_phage(50.0%)	10	NA	NA
WP_001183519.1|3070850_3071309_+	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
WP_001237356.1|3071320_3071548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157185.1|3071620_3072526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001108875.1|3072528_3073332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130711.1|3073324_3073525_+	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	42.4	2.2e-05
WP_000014220.1|3073536_3074049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001162227.1|3074068_3076060_+|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000996674.1|3076132_3077671_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001243268.1|3077685_3077964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272164.1|3077965_3079096_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	32.0	1.1e-21
>prophage 218
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3085473	3087878	3983848		Enterobacteria_phage(50.0%)	4	NA	NA
WP_000210194.1|3085473_3086370_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	46.2	4.3e-45
WP_000229653.1|3086576_3086828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015563.1|3087373_3087649_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000119670.1|3087611_3087878_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	51.2	5.2e-15
>prophage 219
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3100360	3119128	3983848		Acinetobacter_phage(30.0%)	22	NA	NA
WP_000190166.1|3100360_3100759_+	hypothetical protein	NA	G4WT78	Acinetobacter_phage	69.7	7.8e-47
WP_000852825.1|3100758_3101529_+	hypothetical protein	NA	G4WT79	Acinetobacter_phage	80.0	6.5e-82
WP_000852568.1|3101556_3101751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000098517.1|3101909_3103445_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	3.6e-31
WP_000863709.1|3103444_3104098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002096209.1|3104171_3106124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000209670.1|3106123_3107575_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	45.4	1.9e-82
WP_000951724.1|3107725_3108355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000067934.1|3108351_3109431_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	31.9	2.6e-36
WP_000373973.1|3109646_3110360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000067916.1|3110518_3111418_-	hypothetical protein	NA	G9L6D8	Escherichia_phage	48.9	1.1e-40
WP_000594623.1|3111619_3111868_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000030339.1|3111955_3112750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627457.1|3112749_3113448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|3113440_3113659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001279704.1|3113780_3114068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766533.1|3114064_3114835_+	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	98.4	1.7e-151
WP_000602528.1|3114960_3115320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072150.1|3115703_3116402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001215499.1|3116555_3117854_-	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.4	2.3e-156
WP_000022554.1|3117850_3118351_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.8	6.3e-46
WP_000332614.1|3118492_3119128_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	57.4	3.0e-69
>prophage 220
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3122291	3123155	3983848		Yellowstone_lake_mimivirus(100.0%)	1	NA	NA
WP_000109893.1|3122291_3123155_+	DNA adenine methylase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	26.5	6.9e-16
>prophage 221
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3141029	3141959	3983848	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_001091151.1|3141029_3141959_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
>prophage 222
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3150177	3158092	3983848	holin	Vibrio_phage(66.67%)	5	NA	NA
WP_001021934.1|3150177_3151836_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
WP_001286309.1|3151931_3153404_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001985959.1|3153396_3154032_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000243382.1|3154285_3155908_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.6	1.8e-20
WP_000179784.1|3156025_3158092_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
>prophage 223
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3168894	3169476	3983848		Raoultella_phage(100.0%)	1	NA	NA
WP_000074692.1|3168894_3169476_+	nicotinamide mononucleotide transporter	NA	A0A2H4YHF9	Raoultella_phage	28.6	1.4e-07
>prophage 224
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3177423	3186454	3983848		Mycobacterium_phage(25.0%)	8	NA	NA
WP_000988614.1|3177423_3178248_+	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	31.3	5.2e-13
WP_000009973.1|3178263_3179058_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
WP_000735778.1|3179073_3179865_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_001040562.1|3179878_3181345_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000140233.1|3181383_3183024_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.8	9.1e-25
WP_002000879.1|3183200_3184376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371873.1|3184438_3185737_-	MFS transporter	NA	NA	NA	NA	NA
WP_000117812.1|3185971_3186454_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.7	3.7e-19
>prophage 225
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3197046	3200733	3983848		Dickeya_phage(100.0%)	1	NA	NA
WP_000105333.1|3197046_3200733_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
>prophage 226
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3214483	3217801	3983848		Mycobacterium_phage(50.0%)	4	NA	NA
WP_000197531.1|3214483_3215509_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	31.0	6.5e-05
WP_001987747.1|3215769_3216408_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_002075186.1|3216440_3217064_-	arylesterase	NA	NA	NA	NA	NA
WP_001136089.1|3217108_3217801_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.6e-31
>prophage 227
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3229886	3236016	3983848	tRNA	Catovirus(50.0%)	5	NA	NA
WP_001128171.1|3229886_3231449_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	7.2e-88
WP_000479765.1|3231638_3233081_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_002011285.1|3233339_3233471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140408.1|3233463_3234372_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_000019502.1|3234402_3236016_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.2	2.6e-40
>prophage 228
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3262853	3265283	3983848		Moraxella_phage(100.0%)	1	NA	NA
WP_001292274.1|3262853_3265283_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	62.7	8.4e-277
>prophage 229
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3276268	3288616	3983848		Acinetobacter_phage(95.65%)	24	NA	NA
WP_000004579.1|3276268_3276991_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
WP_101329635.1|3276987_3277395_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000654846.1|3277395_3277647_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000698529.1|3277648_3278581_-	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_001207474.1|3278577_3279699_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000064463.1|3279710_3280034_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_000656405.1|3280026_3280317_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_001101038.1|3280316_3280760_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000051960.1|3280953_3281196_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_000845537.1|3281202_3281406_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_001129676.1|3281544_3282048_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000048052.1|3282049_3283057_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_000370485.1|3283108_3283324_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000052252.1|3283338_3284091_-	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000703023.1|3284195_3284384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048916.1|3284394_3284715_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_001180660.1|3284776_3285049_+	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000602535.1|3285120_3285345_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_000064627.1|3285337_3286219_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_001003671.1|3286221_3287022_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000647826.1|3287018_3287357_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_000462878.1|3287349_3287742_+	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000100162.1|3287741_3288143_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_001277128.1|3288139_3288616_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 230
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3292574	3321248	3983848	terminase,capsid	Acinetobacter_phage(93.55%)	38	NA	NA
WP_001136773.1|3292574_3293030_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
WP_000378523.1|3293090_3293525_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_000435230.1|3293493_3294135_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000729387.1|3294193_3294709_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_001132930.1|3294668_3295961_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000301495.1|3296000_3297341_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_000146970.1|3297350_3298457_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000004550.1|3298453_3298684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291451.1|3298699_3298852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589038.1|3298903_3299218_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_000056390.1|3299304_3300096_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000852265.1|3300109_3301060_+	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000524488.1|3301104_3301440_+	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000008459.1|3301443_3301824_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524257.1|3301824_3302193_+	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000540685.1|3302261_3302459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235282.1|3302466_3302760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248411.1|3302811_3303222_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000539749.1|3303193_3303562_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_001984404.1|3303518_3303962_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_001277696.1|3303963_3304182_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749909.1|3304290_3304812_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000064593.1|3304908_3305262_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000002408.1|3305261_3306440_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000094278.1|3306492_3307410_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_001185585.1|3307479_3307995_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000335868.1|3308497_3308797_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|3308805_3309264_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000721572.1|3309368_3310049_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_001275792.1|3310050_3310314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|3310441_3314752_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_000721057.1|3314842_3315430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277448.1|3315522_3315921_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000368388.1|3315920_3316427_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000835160.1|3316423_3316786_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000598554.1|3316778_3320204_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000433907.1|3320271_3320661_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_001019739.1|3320702_3321248_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
>prophage 231
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3326864	3328238	3983848	integrase	Moraxella_phage(100.0%)	1	3324112:3324125	3333563:3333576
3324112:3324125	attL	CTTAAAGCCGAATA	NA	NA	NA	NA
WP_000046989.1|3326864_3328238_-|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
WP_000046989.1|3326864_3328238_-|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
3333563:3333576	attR	TATTCGGCTTTAAG	NA	NA	NA	NA
>prophage 232
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3337825	3338662	3983848		Streptococcus_phage(100.0%)	1	NA	NA
WP_001275986.1|3337825_3338662_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	4.0e-45
>prophage 233
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3343455	3348283	3983848		Bradyrhizobium_phage(50.0%)	2	NA	NA
WP_000084042.1|3343455_3344835_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
WP_000277826.1|3345067_3348283_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.8e-25
>prophage 234
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3352203	3353793	3983848		Planktothrix_phage(100.0%)	1	NA	NA
WP_000550783.1|3352203_3353793_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.2e-19
>prophage 235
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3357673	3362184	3983848		Acaryochloris_phage(33.33%)	4	NA	NA
WP_001982681.1|3357673_3358336_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_001084867.1|3358320_3359355_-	dihydroorotase	NA	NA	NA	NA	NA
WP_000013374.1|3359504_3360767_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
WP_001986427.1|3360825_3362184_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
>prophage 236
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3370757	3407722	3983848	integrase,transposase	Enterobacteria_phage(33.33%)	30	3397932:3397991	3415051:3415871
WP_001091151.1|3370757_3371687_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_101329641.1|3371768_3374819_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	52.1	9.3e-265
WP_001040882.1|3374889_3379587_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	4.4e-40
WP_000949377.1|3379614_3380472_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_002001052.1|3380859_3381585_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000049772.1|3381756_3382236_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000773506.1|3382363_3382630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000899851.1|3382745_3383033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|3383125_3384055_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_000735013.1|3384446_3384917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416092.1|3385155_3385515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001055.1|3385896_3387255_-	amino acid permease	NA	NA	NA	NA	NA
WP_000691959.1|3387399_3388845_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000428073.1|3388864_3390196_-	APC family permease	NA	NA	NA	NA	NA
WP_000191922.1|3390390_3391098_-	cache protein	NA	NA	NA	NA	NA
WP_001277433.1|3391163_3391883_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001041177.1|3391942_3392713_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_001140775.1|3392741_3394172_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002001056.1|3394491_3394914_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001058613.1|3395049_3396285_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.2e-23
WP_000972689.1|3396281_3397376_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000042084.1|3397774_3397984_+	hypothetical protein	NA	NA	NA	NA	NA
3397932:3397991	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|3397995_3398700_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_029642339.1|3398729_3399269_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.8	1.2e-85
WP_000027057.1|3399451_3400312_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|3400382_3401087_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000904905.1|3404110_3404770_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
WP_001067858.1|3404781_3405486_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000454193.1|3406155_3406506_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|3406708_3407722_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
3415051:3415871	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCGCCAACTTGCCTGAATCGCTGGATATTTTGCAATAATTGATTTACTAAACTCACCTAAGTCTGTATCCGGTTTTGGCAGTACCCAAGGAGCTGTACGTTGGAATACAAACAATTCTTTGGCTTTAGGTTGAATTTGGGGCACAAACTGGATGGCAGATGCACCTGTACCAATTACAGCAATGCGTTTTCCAGTTAATTCATAATCATGATTCCATTTCGCTGAATGGAACATTTCACCTGTAAAGGTATCTAAACCTTCAAGACGTGGAATCTGGGCTTCGGTAATTGGGCCTGTAGCAAAAATAACAGTTCGAGATAGATATTGACCAGTAGTTGTATCAAGTACCCACAAATGGTGTGATTCATCCCAAGCAGCATTGAGTAGTTCGTTGTTAAACTCAATTTTAGACGTAATATTAAACTCGTTACTTACATCTTCTAAATAGCTTAAGATTTCCGGTTGACGCGCAAATAAGTGACTCCATTTTGCACTAGGCGCAAACGAATAAGAATACAAAGCTGACGGTACATCACAGCCACAGCCCGGATAGGTGTTTTCACGCCAAGTGCCACCCACACGTCCTGCTTTTTCAATAATTTTATAGTTGGTATAGCCAACTTGGTCGAGACGAATCGCTGCGGCGATACCGGAAATTCCGGCACCGACAATAAAGGTATCGTAAATATGGCTAGGTGAATTGACAGCTTTTTTTGCTGATGCATTTGTTTTCATTTGAGCAGTCATATGGGTACTACCTATA	NA	NA	NA	NA
>prophage 237
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3412463	3415046	3983848	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001067855.1|3412463_3413168_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|3414341_3415046_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 238
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3424530	3437495	3983848	tRNA	Moraxella_phage(20.0%)	11	NA	NA
WP_000729980.1|3424530_3425850_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_001077405.1|3425961_3426960_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001111760.1|3427003_3427561_-	cytochrome b	NA	NA	NA	NA	NA
WP_000735756.1|3427799_3428189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495836.1|3428254_3428821_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000906487.1|3428890_3429145_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|3429391_3430672_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000199457.1|3430737_3433374_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_001188823.1|3433643_3434669_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000155680.1|3434944_3436111_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000517792.1|3436175_3437495_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
>prophage 239
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3443371	3447604	3983848		Planktothrix_phage(33.33%)	3	NA	NA
WP_001237344.1|3443371_3444178_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001210050.1|3444479_3447059_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_000941316.1|3447115_3447604_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
>prophage 240
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3461493	3469409	3983848		Lactococcus_phage(50.0%)	6	NA	NA
WP_170832522.1|3461493_3463080_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	3.0e-25
WP_000058246.1|3463320_3463539_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_001133994.1|3463575_3464163_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_000024050.1|3464227_3464443_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_001987180.1|3464635_3465211_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_060853576.1|3465551_3469409_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.1	6.4e-45
>prophage 241
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3480524	3520880	3983848	capsid,tRNA,transposase	Acinetobacter_phage(36.84%)	45	NA	NA
WP_000377582.1|3480524_3482996_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	1.0e-96
WP_001020651.1|3483071_3483473_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000331914.1|3483500_3483908_+	GFA family protein	NA	NA	NA	NA	NA
WP_001088962.1|3484500_3484857_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000980495.1|3485336_3485666_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	63.8	3.1e-33
WP_000253377.1|3486107_3486701_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000825869.1|3486751_3486976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998196.1|3487200_3487395_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_001283231.1|3487387_3488650_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	23.8	1.9e-14
WP_000636785.1|3489155_3489389_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001185374.1|3489540_3490212_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	55.2	3.1e-64
WP_000016214.1|3490447_3490645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427184.1|3490812_3491202_+	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.1e-48
WP_001019691.1|3491239_3491785_+	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	7.8e-74
WP_000015964.1|3491851_3492469_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000072673.1|3492988_3493204_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000350297.1|3493407_3493632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932369.1|3493911_3494727_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001982898.1|3494883_3495003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127325.1|3495487_3495946_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	3.5e-27
WP_001004676.1|3496237_3496582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790417.1|3496679_3497786_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	66.9	4.5e-145
WP_000648017.1|3497780_3498995_-	MFS transporter	NA	NA	NA	NA	NA
WP_001133965.1|3499106_3499553_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001210983.1|3499639_3499969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157563.1|3499982_3500129_+	hypothetical protein	NA	A0A0B5KTG2	Acinetobacter_phage	100.0	3.4e-08
WP_000644342.1|3500708_3501302_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_000248356.1|3501686_3502316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182287.1|3502816_3504238_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	3.3e-55
WP_001133555.1|3504451_3505429_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
WP_000179338.1|3505432_3505972_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|3506009_3506558_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|3506541_3507090_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|3507089_3507836_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_015451474.1|3508352_3509576_+	TolC family protein	NA	NA	NA	NA	NA
WP_000988402.1|3509572_3511714_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_101329637.1|3511710_3512901_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000885988.1|3512993_3513593_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_000132359.1|3513585_3514197_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_001082436.1|3514352_3515195_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_001186835.1|3515311_3515980_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	42.5	7.5e-26
WP_000232555.1|3516119_3516791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144889.1|3516971_3517295_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_049081181.1|3517639_3518170_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001083258.1|3518234_3520880_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.5e-32
>prophage 242
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3524587	3525520	3983848		Morganella_phage(100.0%)	1	NA	NA
WP_000165398.1|3524587_3525520_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	1.0e-41
>prophage 243
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3532928	3533387	3983848		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001127331.1|3532928_3533387_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
>prophage 244
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3536750	3544844	3983848		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000934999.1|3536750_3539927_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	64.1	9.7e-257
WP_000015582.1|3539936_3544844_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.4	9.3e-49
>prophage 245
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3554185	3566193	3983848	transposase	Escherichia_phage(40.0%)	9	NA	NA
WP_000698627.1|3554185_3555406_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.7	1.2e-32
WP_001067858.1|3555576_3556281_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001151708.1|3557177_3557744_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|3558950_3559655_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001205190.1|3560298_3560994_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000614025.1|3560990_3562016_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.1e-31
WP_000733779.1|3562091_3562958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024112.1|3563206_3564493_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000153210.1|3564618_3566193_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
>prophage 246
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3577667	3579113	3983848		Escherichia_phage(100.0%)	1	NA	NA
WP_000075891.1|3577667_3579113_-	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	5.6e-119
>prophage 247
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3586602	3588990	3983848		Hokovirus(100.0%)	1	NA	NA
WP_000853480.1|3586602_3588990_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	6.3e-176
>prophage 248
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3603531	3604371	3983848		Bacillus_virus(100.0%)	1	NA	NA
WP_001285156.1|3603531_3604371_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.9	1.4e-24
>prophage 249
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3608933	3618309	3983848		Staphylococcus_phage(33.33%)	8	NA	NA
WP_000853316.1|3608933_3610577_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	37.5	1.8e-76
WP_000083685.1|3610621_3611200_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000137905.1|3611369_3612146_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_000739369.1|3612204_3613503_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PEF3	Moraxella_phage	49.3	7.5e-107
WP_000338780.1|3613518_3613899_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000993387.1|3613855_3614293_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000891197.1|3614551_3616261_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_014462729.1|3616269_3618309_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.4	3.6e-39
>prophage 250
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3647625	3649578	3983848		Wolbachia_phage(100.0%)	1	NA	NA
WP_101329639.1|3647625_3649578_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	2.1e-84
>prophage 251
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3653923	3656329	3983848	tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000009660.1|3653923_3654433_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
WP_000803945.1|3654601_3656329_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.2e-187
>prophage 252
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3666934	3668647	3983848		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000808295.1|3666934_3668647_+	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.7e-77
>prophage 253
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3686273	3686744	3983848		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001123845.1|3686273_3686744_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	4.9e-32
>prophage 254
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3694497	3702423	3983848		Hokovirus(33.33%)	8	NA	NA
WP_000193592.1|3694497_3696081_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	25.3	1.7e-20
WP_001109442.1|3696340_3696784_-	universal stress protein	NA	NA	NA	NA	NA
WP_000774578.1|3697072_3697300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139332.1|3697478_3697652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221474.1|3697924_3698368_+	RDD family protein	NA	NA	NA	NA	NA
WP_001983688.1|3698669_3698831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000675125.1|3698931_3701688_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.2	6.4e-39
WP_000775740.1|3701703_3702423_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-12
>prophage 255
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3711888	3717666	3983848		Tupanvirus(33.33%)	4	NA	NA
WP_000588786.1|3711888_3713148_+	serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	23.6	2.8e-13
WP_000323808.1|3713195_3713774_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001170321.1|3713899_3715378_+	multidrug efflux MFS transporter AmvA	NA	A0A0M3UL24	Mycobacterium_phage	26.4	7.9e-28
WP_000285263.1|3715551_3717666_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	30.6	1.2e-40
>prophage 256
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3733436	3780507	3983848	terminase,capsid,integrase,transposase	Acinetobacter_phage(100.0%)	66	3733259:3733276	3781015:3781032
3733259:3733276	attL	GGATTCTACTTCTTTTAT	NA	NA	NA	NA
WP_000773619.1|3733436_3734699_+|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	100.0	3.8e-249
WP_000910238.1|3734704_3734974_-	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000005650.1|3734974_3735232_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	100.0	5.9e-48
WP_000048755.1|3735235_3735520_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	100.0	2.3e-45
WP_000453807.1|3735516_3735726_-	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	100.0	7.4e-33
WP_000654796.1|3735716_3735974_-	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	100.0	2.0e-43
WP_000698524.1|3735975_3736977_-	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	100.0	1.6e-189
WP_001207480.1|3736973_3738095_-	ATP-binding protein	NA	A0A0P0IDZ3	Acinetobacter_phage	100.0	3.0e-213
WP_000181037.1|3738105_3738429_-	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	93.5	1.1e-51
WP_001101456.1|3738431_3738872_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	100.0	4.0e-76
WP_000129518.1|3739069_3739825_-	helix-turn-helix transcriptional regulator	NA	A0A0P0I8E0	Acinetobacter_phage	100.0	1.5e-144
WP_001050157.1|3739925_3740141_+	helix-turn-helix domain-containing protein	NA	A0A0P0IY81	Acinetobacter_phage	100.0	1.3e-35
WP_000092157.1|3740151_3740508_+	hypothetical protein	NA	A0A0P0IKQ0	Acinetobacter_phage	100.0	2.2e-61
WP_001180656.1|3740570_3740843_+	hypothetical protein	NA	A0A0P0J0B9	Acinetobacter_phage	100.0	4.6e-43
WP_001084147.1|3740839_3741136_+	hypothetical protein	NA	A0A0P0HSJ2	Acinetobacter_phage	100.0	1.1e-48
WP_002020065.1|3741132_3741489_+	hypothetical protein	NA	A0A0P0IVS7	Acinetobacter_phage	100.0	1.5e-57
WP_000280079.1|3741488_3742418_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	1.1e-171
WP_000544510.1|3742410_3743160_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	100.0	9.6e-139
WP_000647820.1|3743156_3743579_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
WP_002018225.1|3743628_3743991_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_001288422.1|3743983_3744208_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_000100185.1|3744207_3744603_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
WP_000783470.1|3744599_3745100_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_002001437.1|3745295_3745946_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
WP_000134363.1|3746135_3746327_+	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	5.8e-24
WP_000341071.1|3746339_3746768_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	67.6	2.4e-46
WP_002001438.1|3746736_3747378_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	99.5	6.1e-126
WP_000212566.1|3747436_3747907_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000102080.1|3747896_3749324_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_001286355.1|3749320_3750772_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	100.0	1.0e-285
WP_000179763.1|3750773_3751877_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_000965231.1|3751885_3752314_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000004363.1|3752412_3752655_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_001139861.1|3752872_3753064_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000770049.1|3753177_3753945_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_000214198.1|3753972_3754929_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000692540.1|3754994_3755660_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000008496.1|3755664_3756054_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_002075957.1|3756055_3756424_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.9	4.2e-63
WP_000914808.1|3756461_3757130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002029757.1|3757169_3757322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248222.1|3757350_3757755_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	90.2	9.3e-64
WP_000539746.1|3757726_3758095_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	85.2	6.1e-54
WP_000178914.1|3758096_3758495_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	95.5	4.2e-69
WP_000064602.1|3758563_3758917_+	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	96.6	1.0e-58
WP_000002418.1|3758916_3760272_+	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	97.8	4.3e-198
WP_000094270.1|3760324_3761242_+	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	100.0	2.6e-170
WP_030423917.1|3761312_3761828_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	98.5	6.3e-73
WP_001258718.1|3762378_3763089_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000065059.1|3763203_3764133_-	ORF6N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	86.5	4.7e-87
WP_000453244.1|3764341_3764578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000722131.1|3764664_3765186_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
WP_000106804.1|3765204_3765480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059273154.1|3765557_3769865_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.5	0.0e+00
WP_000856592.1|3770022_3770781_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	100.0	1.6e-141
WP_000369030.1|3770773_3771160_+	hypothetical protein	NA	J7I476	Acinetobacter_phage	100.0	3.3e-66
WP_000277443.1|3771221_3771620_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
WP_000368375.1|3771619_3772126_+	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.2e-92
WP_000835168.1|3772122_3772485_+	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
WP_000590505.1|3772477_3775924_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	100.0	0.0e+00
WP_000433918.1|3775991_3776381_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_001019712.1|3776423_3776969_+	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	97.2	9.2e-99
WP_000999701.1|3777157_3777838_+	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
WP_001109862.1|3777848_3778496_+	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_000151893.1|3778502_3779096_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
WP_085942227.1|3779341_3780507_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
3781015:3781032	attR	GGATTCTACTTCTTTTAT	NA	NA	NA	NA
>prophage 257
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3785365	3786694	3983848		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000652023.1|3785365_3786694_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	44.3	1.4e-100
>prophage 258
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3806669	3809139	3983848		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_001047539.1|3806669_3806981_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	2.0e-18
WP_000194629.1|3807000_3807285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859778.1|3807302_3807653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105719.1|3807697_3808066_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.0	8.9e-13
WP_000604791.1|3808131_3809139_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L5H6	Tupanvirus	31.9	9.5e-49
>prophage 259
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3823832	3824585	3983848		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000132219.1|3823832_3824585_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	42.2	4.3e-22
>prophage 260
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3835324	3836374	3983848		Bacillus_phage(100.0%)	1	NA	NA
WP_000344169.1|3835324_3836374_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
>prophage 261
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3844813	3852884	3983848		Tupanvirus(25.0%)	6	NA	NA
WP_001026393.1|3844813_3845992_+	S8 family peptidase	NA	A0A2K9L570	Tupanvirus	40.6	3.2e-32
WP_000957160.1|3846039_3847494_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	69.3	1.0e-181
WP_000332536.1|3847731_3848370_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	54.5	2.7e-57
WP_001032856.1|3848724_3850167_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_000120225.1|3850221_3850665_-	universal stress protein	NA	NA	NA	NA	NA
WP_000203146.1|3850790_3852884_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.2	1.3e-15
>prophage 262
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3858211	3861070	3983848		Hokovirus(100.0%)	1	NA	NA
WP_000880346.1|3858211_3861070_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.2	5.1e-15
>prophage 263
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3898329	3902878	3983848	protease	uncultured_Mediterranean_phage(25.0%)	4	NA	NA
WP_001260033.1|3898329_3898743_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	2.9e-12
WP_000952702.1|3898752_3901029_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	4.0e-164
WP_000904308.1|3901032_3901395_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	62.6	1.3e-27
WP_000993015.1|3901822_3902878_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	45.8	1.4e-82
>prophage 264
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3910762	3914624	3983848		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_000148660.1|3910762_3912400_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.7	8.2e-151
WP_000080538.1|3912431_3913289_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.5e-50
WP_000078452.1|3913334_3914624_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	1.0e-135
>prophage 265
NZ_CP025266	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 chromosome, complete genome	3983848	3925428	3926256	3983848		Streptococcus_phage(100.0%)	1	NA	NA
WP_014462804.1|3925428_3926256_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.8	1.1e-18
>prophage 1
NZ_CP025267	Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 plasmid pSMC_AB_BL01_1, complete sequence	74241	24208	31795	74241		Alteromonadaceae_phage(14.29%)	9	NA	NA
WP_000389916.1|24208_24898_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	30.9	2.6e-13
WP_000063345.1|24902_25139_+	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	41.5	5.0e-09
WP_060853653.1|25144_25351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000794252.1|25863_26955_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	32.2	1.1e-15
WP_000844619.1|27012_27786_+	hypothetical protein	NA	A0A2K9VK66	Klebsiella_phage	44.5	1.3e-53
WP_001067229.1|28266_28764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086346.1|28792_29569_+	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	34.3	7.6e-22
WP_000724905.1|29761_30535_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.8e-08
WP_000096599.1|30538_31795_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	28.2	7.2e-06
