The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023198	Bifidobacterium breve strain DRBB29 chromosome, complete genome	2435086	352489	377529	2435086	integrase,tail,capsid,terminase,portal,holin	Bifidobacterium_phage(26.67%)	27	362914:362930	386280:386296
WP_106621351.1|352489_353923_+|terminase	terminase	terminase	V5R8Y1	Arthrobacter_phage	37.8	9.5e-87
WP_080788996.1|353922_355446_+|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	34.0	3.8e-57
WP_106621352.1|355369_356725_+	hypothetical protein	NA	A0A1D8ETG0	Propionibacterium_phage	47.1	2.7e-14
WP_010081005.1|356835_357369_+	helicase	NA	NA	NA	NA	NA
WP_106621353.1|357414_358320_+|capsid	phage major capsid protein	capsid	A0A2K9VJQ1	Propionibacterium_phage	33.0	2.0e-34
WP_010081003.1|358319_358634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080788992.1|358645_359098_+	hypothetical protein	NA	A0A1D8ETI1	Propionibacterium_phage	50.0	2.8e-24
WP_015512461.1|359094_359430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080788991.1|359441_359717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080788990.1|359713_360079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621354.1|360110_360701_+	hypothetical protein	NA	A0A141E164	Streptococcus_phage	36.9	7.8e-19
WP_010080996.1|360760_361081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080788988.1|361092_361485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621355.1|361486_364555_+	tape measure protein	NA	R9QN01	Lactococcus_phage	43.1	6.2e-75
362914:362930	attL	CGTCGTGGCCGCGCTCG	NA	NA	NA	NA
WP_080788986.1|364573_365356_+	3-hydroxy-3-methylglutaryl CoA synthase	NA	I3NL89	Bifidobacterium_phage	38.5	1.6e-43
WP_106621356.1|365375_369095_+|tail	phage tail protein	tail	I3NL88	Bifidobacterium_phage	61.8	2.1e-178
WP_106621357.1|369104_369701_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_106621358.1|369854_370577_+	hypothetical protein	NA	I3NL86	Bifidobacterium_phage	58.2	3.4e-40
WP_106621359.1|370593_372174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621360.1|372588_373833_+	reverse transcriptase	NA	D6PSR5	Lactobacillus_phage	28.9	2.9e-31
WP_157825682.1|373820_373994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621361.1|374121_374445_+	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	68.3	8.3e-15
WP_106621362.1|374512_375745_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTJ6	Lactococcus_phage	42.6	2.0e-37
WP_065453902.1|375829_376096_+|holin	holin	holin	C9E2L0	Enterococcus_phage	49.2	6.2e-08
WP_100990803.1|376158_376443_-	antitoxin	NA	NA	NA	NA	NA
WP_052789178.1|376426_376699_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_065453901.1|376749_377529_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3B212	Gordonia_phage	43.3	1.7e-53
386280:386296	attR	CGAGCGCGGCCACGACG	NA	NA	NA	NA
>prophage 2
NZ_CP023198	Bifidobacterium breve strain DRBB29 chromosome, complete genome	2435086	759286	813439	2435086	capsid,terminase,portal,transposase,holin	Staphylococcus_phage(11.76%)	48	NA	NA
WP_157825938.1|759286_759595_+|transposase	transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	42.3	5.1e-06
WP_106621491.1|760293_761661_+	xanthine/uracil permease	NA	NA	NA	NA	NA
WP_106621492.1|761638_762958_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_106621493.1|763083_763341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157825967.1|763429_763684_-|transposase	transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	42.3	3.2e-06
WP_106622057.1|765548_766106_+	flavodoxin	NA	NA	NA	NA	NA
WP_106621494.1|767280_767967_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106621496.1|768240_770754_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.8	1.3e-107
WP_106621497.1|770929_772288_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_106621498.1|772295_772988_+	DNA lyase	NA	NA	NA	NA	NA
WP_106621500.1|773476_774151_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_101673906.1|774160_774373_-	nodulation protein L	NA	NA	NA	NA	NA
WP_101673894.1|774591_775662_+	permease	NA	NA	NA	NA	NA
WP_157825939.1|775693_775852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101673893.1|776956_777181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101673891.1|778226_778817_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_101673890.1|778897_779686_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_101673889.1|779682_780399_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	5.0e-12
WP_014483972.1|780526_781090_+	elongation factor P	NA	NA	NA	NA	NA
WP_101673888.1|781141_781672_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_101673887.1|781859_783083_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	1.0e-41
WP_106621502.1|783084_786468_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003828699.1|786467_787388_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003828700.1|787424_788015_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	39.0	1.1e-23
WP_050824749.1|788048_788756_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	34.9	9.7e-24
WP_106621503.1|789289_791470_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	24.5	9.5e-54
WP_106621504.1|791682_791964_-|holin	holin	holin	A0A075EHP3	Siphovirus	40.6	1.9e-07
WP_106621505.1|791975_793223_-	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTJ6	Lactococcus_phage	38.8	1.7e-31
WP_106621506.1|793389_793779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621507.1|793801_794305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621508.1|794324_794630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157826575.1|794682_795096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621510.1|795809_796316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621511.1|800579_801557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621512.1|801569_803780_-	tape measure protein	NA	A0A075KJK1	Lactobacillus_phage	50.8	5.6e-70
WP_106621513.1|803804_804251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621514.1|804250_804610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621515.1|805384_805765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578115.1|805764_806040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621516.1|806043_806388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578113.1|806384_806792_-	hypothetical protein	NA	A0A1P8BKC7	Lactococcus_phage	29.6	4.0e-06
WP_106621517.1|806805_807369_-	hypothetical protein	NA	I3NL98	Bifidobacterium_phage	51.4	8.0e-13
WP_106621518.1|807368_808310_-|capsid	phage major capsid protein	capsid	Q1A0S2	Mycobacterium_virus	57.0	1.4e-94
WP_012578110.1|808343_808808_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_065463855.1|808893_809085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106622058.1|809065_810484_-	hypothetical protein	NA	A0A1D8ETG0	Propionibacterium_phage	36.6	1.1e-29
WP_012578108.1|810509_812003_-|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	33.9	3.8e-62
WP_106622059.1|812002_813439_-|terminase	terminase	terminase	A0A1D8EU80	Propionibacterium_phage	46.3	2.8e-110
>prophage 3
NZ_CP023198	Bifidobacterium breve strain DRBB29 chromosome, complete genome	2435086	1417201	1473424	2435086	integrase,tRNA,transposase	Staphylococcus_phage(25.0%)	49	1464868:1464927	1473430:1473945
WP_101674017.1|1417201_1417549_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_106621710.1|1417467_1417932_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_106621711.1|1418460_1419243_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_003831791.1|1420523_1421618_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.5	6.9e-37
WP_003829514.1|1421614_1422454_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_032739314.1|1422450_1423314_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003829518.1|1423380_1423869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012577399.1|1423871_1424222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621712.1|1424345_1425635_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_012577401.1|1425627_1426311_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_081291552.1|1426495_1426711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621713.1|1426868_1427912_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.0	1.3e-53
WP_106621714.1|1427908_1428508_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_106621715.1|1428522_1429404_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_106621716.1|1429462_1430029_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_157825960.1|1430037_1431009_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_157825961.1|1431171_1431345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621717.1|1431479_1433753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621718.1|1433835_1435599_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_106622096.1|1435598_1436111_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_106621719.1|1436586_1439550_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.4	1.0e-199
WP_101674136.1|1439592_1440474_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003829540.1|1440486_1441437_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003829541.1|1441616_1442462_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_106622097.1|1442623_1443802_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015438878.1|1443885_1444290_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_106621720.1|1444524_1445460_+	DMT family transporter	NA	NA	NA	NA	NA
WP_106621721.1|1445534_1446233_+	nitroreductase	NA	NA	NA	NA	NA
WP_106621722.1|1446404_1447607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621724.1|1448084_1449383_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_101674140.1|1449386_1450685_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_080568425.1|1451050_1452103_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_060618493.1|1452313_1453591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019727527.1|1453606_1454434_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003829557.1|1454423_1455413_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019727526.1|1455412_1456681_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106621725.1|1457063_1460210_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_106621726.1|1460340_1463460_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_106621727.1|1463620_1464109_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
1464868:1464927	attL	TGGATTGGCTACAATGTATTAGACAGTCTGATGGGGGACGATTGACGTGGGATTGGAGGC	NA	NA	NA	NA
WP_157825942.1|1464932_1465220_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	40.2	3.2e-10
WP_157825943.1|1465608_1466055_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_106621728.1|1466051_1466246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621729.1|1466473_1467973_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.3	1.1e-11
WP_015439062.1|1467969_1468749_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_106621730.1|1469082_1470552_+	MFS transporter	NA	NA	NA	NA	NA
WP_106621731.1|1470531_1470936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003830742.1|1471106_1471742_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157825968.1|1472301_1472973_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	28.6	1.0e-06
WP_157825942.1|1473136_1473424_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	40.2	3.2e-10
1473430:1473945	attR	GCCTCCAATCCCACGTCAATCGTCCCCCATCAGACTGTCTAATACATTGTAGCCAATCCACGCACACGAAAGAAGCATGCGAGTGTTCCTGCGACCTATCTCAGATGGCGAAGCCGCTCGATCAGATCGACGAGCGTCTGTTCCTCCTGTTCCACGCAGTCTAGGAAAATGGAGCAGAACGAATCCGGCTTGCCGTCCACCTGCCATGCCTCCAGGCCTCGCGCGTATGACCGACCCGCATCGTATTTGATGGCCACGGGACGGTATCCGTTCCGCAGCAGCACGAAGTTGAGCAGCTGGCGGCCGGTCCGCCCGTTGCCGTCCATGAATGGATGGATGTTCTCGAACATCGCGTGGAAACCGGCGGCCCTGAGCAGCGGATGCGCTGCGCAGCCATCCAACCCGTCGATCAAGGATCGCAGGTCGTCGCGGATCTCCAGCGGGTCCGCGGTCTTGACTCGGGTGGCGGTGATCCGCGCCAAATAGCCATAGGGACGGAACGTGCCGCGGGCGAAC	NA	NA	NA	NA
