The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021556	Bifidobacterium breve strain 139W423 chromosome, complete genome	2411276	430340	483865	2411276	transposase,head,portal,protease	Marinomonas_phage(12.5%)	48	NA	NA
WP_021649494.1|430340_431912_-|head,protease	HK97 family phage prohead protease	head,protease	I6S2W2	Marinomonas_phage	35.3	9.4e-11
WP_019727771.1|431908_433081_-|portal	phage portal protein	portal	A0A2R4A099	Microbacterium_phage	37.2	4.8e-60
WP_021649493.1|433122_434589_-	hypothetical protein	NA	A0A0K0MWE3	Gordonia_phage	31.4	1.1e-45
WP_019727773.1|434585_434897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032743046.1|435065_435839_-	HNH endonuclease	NA	A0A1D8EX78	Mycobacterium_phage	36.1	4.8e-16
WP_019727775.1|435825_436005_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021649490.1|436004_436364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021649487.1|437927_438125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021649486.1|438124_438358_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019727783.1|439052_440087_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_021649484.1|440431_441241_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003828178.1|441344_441575_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_021649483.1|441640_442159_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_021649482.1|442193_443030_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_060812406.1|443105_444737_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003828182.1|444740_445664_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_015438381.1|445672_447145_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_021649479.1|447144_447438_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_021649478.1|447521_448226_+	endonuclease NucS	NA	NA	NA	NA	NA
WP_021649477.1|448356_449310_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_077420478.1|449411_450650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021649475.1|450649_451654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828189.1|451878_452850_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003831436.1|452988_453615_-	adenylate cyclase	NA	NA	NA	NA	NA
WP_003828192.1|454292_454682_+	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_021649473.1|454807_455761_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003831442.1|455953_456955_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032743044.1|457000_458188_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_032743042.1|458452_459619_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021649470.1|459630_460569_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_051317553.1|460604_461381_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003828199.1|461377_462697_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	2.2e-29
WP_021649467.1|463112_464150_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032743041.1|464281_465073_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_015438395.1|465253_466687_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_157825606.1|466818_467199_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003831459.1|467404_468208_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_021649464.1|468287_469580_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_016462208.1|469652_470714_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_021649463.1|470762_472232_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_029575563.1|472730_474107_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_032743039.1|474179_475091_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003828213.1|475092_476067_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_021649460.1|476229_477453_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_106652039.1|477688_479044_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.3	2.2e-45
WP_000691721.1|479115_481035_-	tetracycline resistance ribosomal protection protein Tet(W)	NA	E4ZFJ7	Streptococcus_phage	100.0	0.0e+00
WP_014483316.1|481595_482381_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
WP_015438265.1|482383_483865_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP021556	Bifidobacterium breve strain 139W423 chromosome, complete genome	2411276	912220	981132	2411276	transposase,tRNA,integrase	Streptococcus_phage(23.08%)	57	978443:978462	993235:993254
WP_025262887.1|912220_913288_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	9.8e-28
WP_019727951.1|913295_915905_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.1	1.5e-05
WP_025332179.1|915932_916589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032743170.1|916685_917780_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_021649867.1|917776_918952_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_003831250.1|919180_920137_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_021649866.1|920126_921422_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.9	1.4e-20
WP_014483932.1|921450_922416_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_021649865.1|922412_922925_+	arginine repressor	NA	NA	NA	NA	NA
WP_021649864.1|923081_924320_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_021649863.1|924702_925134_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_021649862.1|925209_925971_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.5	2.0e-30
WP_015438265.1|927293_928775_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014483316.1|928777_929563_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
WP_003828806.1|930765_931041_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003828808.1|931042_931297_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003828810.1|931525_932998_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_003828811.1|933435_933630_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003828815.1|933641_934511_+	thiazole synthase	NA	NA	NA	NA	NA
WP_025299683.1|934649_935459_+	thiazole biosynthesis adenylyltransferase ThiF	NA	A0A291ATS8	Pandoravirus	34.1	4.1e-10
WP_021649813.1|935604_935961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014483927.1|936230_936764_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_021649814.1|936773_937541_+	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_003831242.1|939585_940908_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.1	1.1e-68
WP_065505054.1|940935_942756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021649819.1|942764_943811_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_025299689.1|943966_944740_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_032743156.1|944721_945396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032743157.1|946636_947617_+	NAD kinase	NA	NA	NA	NA	NA
WP_021649826.1|947616_949467_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_021649827.1|949463_950111_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003828856.1|950999_951374_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014485765.1|951395_952316_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	1.1e-19
WP_106647851.1|952340_953018_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_032743158.1|953020_953734_+	ABC transporter	NA	NA	NA	NA	NA
WP_021649831.1|953876_954251_+	TnpV protein	NA	D0R0F4	Streptococcus_phage	61.0	3.4e-36
WP_021649832.1|954868_956359_-	threonine synthase	NA	NA	NA	NA	NA
WP_003828865.1|956746_958042_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.1	2.3e-100
WP_003831230.1|958038_958602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003831229.1|958598_959327_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_106622067.1|959347_960148_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_029575591.1|960150_960633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019727970.1|960794_964052_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_032743159.1|964197_964695_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003828872.1|964743_965343_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_032743161.1|965398_968947_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_021649837.1|968928_969855_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003828875.1|970005_971304_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.7	3.6e-133
WP_015438651.1|971370_971979_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003828877.1|971975_972542_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_016463114.1|972600_973602_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_007054866.1|974187_975243_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IH55	Gordonia_phage	26.7	1.0e-05
WP_010081384.1|975239_976205_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014484092.1|976201_977404_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
978443:978462	attL	GATGTGTCTGTTCAATAGAA	NA	NA	NA	NA
WP_015438265.1|978614_980096_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014483316.1|980098_980884_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
WP_106651994.1|980943_981132_-|integrase	integrase	integrase	NA	NA	NA	NA
993235:993254	attR	TTCTATTGAACAGACACATC	NA	NA	NA	NA
>prophage 3
NZ_CP021556	Bifidobacterium breve strain 139W423 chromosome, complete genome	2411276	1044372	1086181	2411276	transposase,protease	Agrobacterium_phage(21.43%)	34	NA	NA
WP_021648948.1|1044372_1044960_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	36.5	2.1e-24
WP_157825607.1|1044952_1045090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014483316.1|1045079_1045865_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
WP_015438265.1|1045867_1047349_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_106651996.1|1047505_1048807_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	31.7	4.5e-35
WP_032739352.1|1048827_1049469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003831866.1|1049630_1050803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742803.1|1050830_1052165_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003828955.1|1052392_1053622_-	acetate kinase	NA	NA	NA	NA	NA
WP_016463131.1|1053753_1055424_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014483875.1|1055845_1056868_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.6	1.9e-41
WP_021648942.1|1057008_1058940_-	acetyltransferase	NA	A0A166XZF2	Gordonia_phage	26.0	1.4e-16
WP_021648941.1|1059079_1060642_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.5	1.2e-13
WP_014483873.1|1061089_1063567_+	phosphoketolase	NA	NA	NA	NA	NA
WP_021648939.1|1063750_1065133_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.6	2.2e-27
WP_003833436.1|1065136_1065523_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_021648938.1|1065519_1066221_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_032742802.1|1066630_1067440_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014483870.1|1067688_1068669_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003829011.1|1068837_1070040_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.5e-29
WP_014483869.1|1070036_1070723_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021648935.1|1070801_1071953_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003829015.1|1072046_1073744_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.1	4.3e-86
WP_003829017.1|1073762_1073993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003833430.1|1074267_1076643_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	39.2	2.8e-152
WP_003833429.1|1076755_1077637_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_014483867.1|1077818_1078451_+	DUF3000 family protein	NA	NA	NA	NA	NA
WP_021648934.1|1078447_1079749_+	3'-5' exonuclease	NA	K7XYU9	uncultured_Mediterranean_phage	25.4	3.8e-10
WP_021648933.1|1079803_1081177_+	trigger factor	NA	NA	NA	NA	NA
WP_021648932.1|1081359_1082760_+	chloride channel protein	NA	NA	NA	NA	NA
WP_003829031.1|1082804_1083182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003833421.1|1083333_1083957_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.7	3.7e-43
WP_014483863.1|1083962_1084646_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	42.9	3.9e-38
WP_003833417.1|1084819_1086181_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	49.4	1.1e-113
>prophage 4
NZ_CP021556	Bifidobacterium breve strain 139W423 chromosome, complete genome	2411276	1302896	1325628	2411276	coat,integrase,portal,terminase,holin	Bifidobacterium_phage(53.85%)	29	1290887:1290902	1327790:1327805
1290887:1290902	attL	CCAGCGCAGCATCGAC	NA	NA	NA	NA
WP_106652043.1|1302896_1303154_-|holin	holin	holin	NA	NA	NA	NA
WP_106652001.1|1303285_1304395_-	glycoside hydrolase	NA	A0A0A1ERA5	Lactobacillus_phage	36.6	3.7e-22
WP_106652044.1|1304515_1304734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106652002.1|1304907_1305423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106652003.1|1305465_1305795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106652004.1|1305934_1306486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106652005.1|1306488_1307355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007056605.1|1307508_1307814_-	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	63.8	7.6e-18
WP_106652006.1|1307899_1308769_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	23.8	3.6e-12
WP_157825610.1|1308788_1309058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106652008.1|1309073_1309355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106652009.1|1309376_1309673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053496438.1|1309724_1309997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106652045.1|1310054_1310348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007056600.1|1310890_1311139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106652010.1|1311148_1312132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015713635.1|1316314_1316611_-	hypothetical protein	NA	I3NL91	Bifidobacterium_phage	69.4	4.1e-37
WP_015713634.1|1316682_1317177_-	hypothetical protein	NA	I3NL92	Bifidobacterium_phage	70.6	1.3e-56
WP_015713633.1|1317278_1317806_-	hypothetical protein	NA	I3NL93	Bifidobacterium_phage	87.4	3.1e-83
WP_015713632.1|1317880_1318297_-	hypothetical protein	NA	I3NL94	Bifidobacterium_phage	61.6	1.3e-41
WP_015713631.1|1318293_1318683_-	hypothetical protein	NA	I3NL95	Bifidobacterium_phage	62.3	3.5e-36
WP_007056601.1|1318684_1319107_-	hypothetical protein	NA	I3NL96	Bifidobacterium_phage	87.5	2.8e-39
WP_106652011.1|1319103_1319688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106652012.1|1319753_1320611_-|coat	coat protein	coat	E5DV53	Deep-sea_thermophilic_phage	49.0	2.4e-61
WP_106652013.1|1320627_1321242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015713627.1|1321265_1322426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106652014.1|1322382_1323861_-|portal	phage portal protein	portal	D7NW49	Streptomyces_phage	31.7	1.3e-59
WP_007056596.1|1323860_1324517_-|terminase	terminase	terminase	A0A1C9EHV3	Gordonia_phage	55.1	3.8e-59
WP_106652015.1|1324503_1325628_-|terminase	terminase	terminase	A0A1C9EHW4	Gordonia_phage	54.8	1.6e-108
1327790:1327805	attR	CCAGCGCAGCATCGAC	NA	NA	NA	NA
