The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021552	Bifidobacterium breve strain DRBB27 chromosome, complete genome	2435083	352489	377529	2435083	terminase,portal,holin,capsid,integrase,tail	Bifidobacterium_phage(26.67%)	27	362914:362930	386280:386296
WP_106621351.1|352489_353923_+|terminase	terminase	terminase	V5R8Y1	Arthrobacter_phage	37.8	9.5e-87
WP_080788996.1|353922_355446_+|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	34.0	3.8e-57
WP_106621352.1|355369_356725_+	hypothetical protein	NA	A0A1D8ETG0	Propionibacterium_phage	47.1	2.7e-14
WP_010081005.1|356835_357369_+	helicase	NA	NA	NA	NA	NA
WP_106621353.1|357414_358320_+|capsid	phage major capsid protein	capsid	A0A2K9VJQ1	Propionibacterium_phage	33.0	2.0e-34
WP_010081003.1|358319_358634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080788992.1|358645_359098_+	hypothetical protein	NA	A0A1D8ETI1	Propionibacterium_phage	50.0	2.8e-24
WP_015512461.1|359094_359430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080788991.1|359441_359717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080788990.1|359713_360079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621354.1|360110_360701_+	hypothetical protein	NA	A0A141E164	Streptococcus_phage	36.9	7.8e-19
WP_010080996.1|360760_361081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080788988.1|361092_361485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621355.1|361486_364555_+	tape measure protein	NA	R9QN01	Lactococcus_phage	43.1	6.2e-75
362914:362930	attL	CGTCGTGGCCGCGCTCG	NA	NA	NA	NA
WP_080788986.1|364573_365356_+	3-hydroxy-3-methylglutaryl CoA synthase	NA	I3NL89	Bifidobacterium_phage	38.5	1.6e-43
WP_106621356.1|365375_369095_+|tail	phage tail protein	tail	I3NL88	Bifidobacterium_phage	61.8	2.1e-178
WP_106621357.1|369104_369701_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_106621358.1|369854_370577_+	hypothetical protein	NA	I3NL86	Bifidobacterium_phage	58.2	3.4e-40
WP_106621359.1|370593_372174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621360.1|372588_373833_+	reverse transcriptase	NA	D6PSR5	Lactobacillus_phage	28.9	2.9e-31
WP_157825928.1|373763_373994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621361.1|374121_374445_+	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	68.3	8.3e-15
WP_106621362.1|374512_375745_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTJ6	Lactococcus_phage	42.6	2.0e-37
WP_065453902.1|375829_376096_+|holin	holin	holin	C9E2L0	Enterococcus_phage	49.2	6.2e-08
WP_100990803.1|376158_376443_-	antitoxin	NA	NA	NA	NA	NA
WP_052789178.1|376426_376699_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_065453901.1|376749_377529_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3B212	Gordonia_phage	43.3	1.7e-53
386280:386296	attR	CGAGCGCGGCCACGACG	NA	NA	NA	NA
>prophage 2
NZ_CP021552	Bifidobacterium breve strain DRBB27 chromosome, complete genome	2435083	759286	813439	2435083	terminase,portal,holin,transposase,capsid	Staphylococcus_phage(11.76%)	48	NA	NA
WP_157825938.1|759286_759595_+|transposase	transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	42.3	5.1e-06
WP_106621491.1|760293_761661_+	xanthine/uracil permease	NA	NA	NA	NA	NA
WP_106621492.1|761638_762958_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_106621493.1|763083_763341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157825967.1|763429_763684_-|transposase	transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	42.3	3.2e-06
WP_106622057.1|765548_766106_+	flavodoxin	NA	NA	NA	NA	NA
WP_106621494.1|767280_767967_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106621496.1|768240_770754_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.8	1.3e-107
WP_106621497.1|770929_772288_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_106621498.1|772295_772988_+	DNA lyase	NA	NA	NA	NA	NA
WP_106621500.1|773476_774151_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_101673906.1|774160_774373_-	nodulation protein L	NA	NA	NA	NA	NA
WP_101673894.1|774591_775662_+	permease	NA	NA	NA	NA	NA
WP_157825939.1|775693_775852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101673893.1|776956_777181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101673891.1|778226_778817_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_101673890.1|778897_779686_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_101673889.1|779682_780399_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	5.0e-12
WP_014483972.1|780526_781090_+	elongation factor P	NA	NA	NA	NA	NA
WP_101673888.1|781141_781672_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_101673887.1|781859_783083_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	1.0e-41
WP_106621502.1|783084_786468_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003828699.1|786467_787388_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003828700.1|787424_788015_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	39.0	1.1e-23
WP_050824749.1|788048_788756_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	34.9	9.7e-24
WP_106621503.1|789289_791470_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	24.5	9.5e-54
WP_106621504.1|791682_791964_-|holin	holin	holin	A0A075EHP3	Siphovirus	40.6	1.9e-07
WP_106621505.1|791975_793223_-	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTJ6	Lactococcus_phage	38.8	1.7e-31
WP_106621506.1|793389_793779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621507.1|793801_794305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621508.1|794324_794630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825940.1|794745_795096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621510.1|795809_796316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621511.1|800579_801557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621512.1|801569_803780_-	tape measure protein	NA	A0A075KJK1	Lactobacillus_phage	50.8	5.6e-70
WP_106621513.1|803804_804251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621514.1|804250_804610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621515.1|805384_805765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578115.1|805764_806040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621516.1|806043_806388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578113.1|806384_806792_-	hypothetical protein	NA	A0A1P8BKC7	Lactococcus_phage	29.6	4.0e-06
WP_106621517.1|806805_807369_-	hypothetical protein	NA	I3NL98	Bifidobacterium_phage	51.4	8.0e-13
WP_106621518.1|807368_808310_-|capsid	phage major capsid protein	capsid	Q1A0S2	Mycobacterium_virus	57.0	1.4e-94
WP_012578110.1|808343_808808_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_065463855.1|808893_809085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106622058.1|809065_810484_-	hypothetical protein	NA	A0A1D8ETG0	Propionibacterium_phage	36.6	1.1e-29
WP_012578108.1|810509_812003_-|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	33.9	3.8e-62
WP_106622059.1|812002_813439_-|terminase	terminase	terminase	A0A1D8EU80	Propionibacterium_phage	46.3	2.8e-110
>prophage 3
NZ_CP021552	Bifidobacterium breve strain DRBB27 chromosome, complete genome	2435083	1417202	1473425	2435083	transposase,integrase,tRNA	Staphylococcus_phage(25.0%)	50	1464869:1464928	1473431:1473946
WP_101674017.1|1417202_1417550_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_106621710.1|1417468_1417933_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_106621711.1|1418461_1419244_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_003831791.1|1420524_1421619_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.5	6.9e-37
WP_003829514.1|1421615_1422455_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_032739314.1|1422451_1423315_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003829518.1|1423381_1423870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012577399.1|1423872_1424223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621712.1|1424346_1425636_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_012577401.1|1425628_1426312_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_081291552.1|1426496_1426712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621713.1|1426869_1427913_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.0	1.3e-53
WP_106621714.1|1427909_1428509_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_106621715.1|1428523_1429405_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_106621716.1|1429463_1430030_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_157825960.1|1430038_1431010_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_157825961.1|1431172_1431346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621717.1|1431480_1433754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621718.1|1433836_1435600_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_106622096.1|1435599_1436112_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_106621719.1|1436587_1439551_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.4	1.0e-199
WP_101674136.1|1439593_1440475_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003829540.1|1440487_1441438_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003829541.1|1441617_1442463_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_106622097.1|1442624_1443803_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015438878.1|1443886_1444291_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_106621720.1|1444525_1445461_+	DMT family transporter	NA	NA	NA	NA	NA
WP_106621721.1|1445535_1446234_+	nitroreductase	NA	NA	NA	NA	NA
WP_106621722.1|1446405_1447608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106652060.1|1447604_1447790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621724.1|1448085_1449384_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_101674140.1|1449387_1450686_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_080568425.1|1451051_1452104_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_060618493.1|1452314_1453592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019727527.1|1453607_1454435_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003829557.1|1454424_1455414_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019727526.1|1455413_1456682_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106621725.1|1457064_1460211_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_106621726.1|1460341_1463461_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_106621727.1|1463621_1464110_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
1464869:1464928	attL	TGGATTGGCTACAATGTATTAGACAGTCTGATGGGGGACGATTGACGTGGGATTGGAGGC	NA	NA	NA	NA
WP_157825942.1|1464933_1465221_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	40.2	3.2e-10
WP_157825943.1|1465609_1466056_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_106621728.1|1466052_1466247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106621729.1|1466474_1467974_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.3	1.1e-11
WP_015439062.1|1467970_1468750_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_106621730.1|1469083_1470553_+	MFS transporter	NA	NA	NA	NA	NA
WP_106621731.1|1470532_1470937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003830742.1|1471107_1471743_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157825968.1|1472302_1472974_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	28.6	1.0e-06
WP_157825942.1|1473137_1473425_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	40.2	3.2e-10
1473431:1473946	attR	GCCTCCAATCCCACGTCAATCGTCCCCCATCAGACTGTCTAATACATTGTAGCCAATCCACGCACACGAAAGAAGCATGCGAGTGTTCCTGCGACCTATCTCAGATGGCGAAGCCGCTCGATCAGATCGACGAGCGTCTGTTCCTCCTGTTCCACGCAGTCTAGGAAAATGGAGCAGAACGAATCCGGCTTGCCGTCCACCTGCCATGCCTCCAGGCCTCGCGCGTATGACCGACCCGCATCGTATTTGATGGCCACGGGACGGTATCCGTTCCGCAGCAGCACGAAGTTGAGCAGCTGGCGGCCGGTCCGCCCGTTGCCGTCCATGAATGGATGGATGTTCTCGAACATCGCGTGGAAACCGGCGGCCCTGAGCAGCGGATGCGCTGCGCAGCCATCCAACCCGTCGATCAAGGATCGCAGGTCGTCGCGGATCTCCAGCGGGTCCGCGGTCTTGACTCGGGTGGCGGTGATCCGCGCCAAATAGCCATAGGGACGGAACGTGCCGCGGGCGAAC	NA	NA	NA	NA
