The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021393	Bifidobacterium breve strain NRBB52 chromosome, complete genome	2379672	299919	351711	2379672	tRNA,holin,integrase,transposase	Mycobacterium_phage(25.0%)	44	341823:341839	351749:351765
WP_003828126.1|299919_300141_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014483392.1|300774_301980_+	MFS transporter	NA	NA	NA	NA	NA
WP_003828131.1|302145_302457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828132.1|302472_302838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074525445.1|302884_303046_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003828134.1|303079_303757_-|integrase	site-specific integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	33.5	6.6e-22
WP_014483394.1|304195_304930_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_106640973.1|305013_307650_-	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	25.7	4.8e-44
WP_014483396.1|307759_308041_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_106622466.1|308188_309595_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_100218408.1|309663_310221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828140.1|310309_311248_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_052787346.1|311448_312387_+	ATP-binding cassette domain-containing protein	NA	M1HS04	Acanthocystis_turfacea_Chlorella_virus	27.6	5.4e-06
WP_025341538.1|312383_313430_+	permease of ABC transporter system	NA	NA	NA	NA	NA
WP_003831383.1|313505_314468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011068473.1|315322_315622_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_019727746.1|315625_317167_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_014483402.1|317192_318692_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_095256852.1|318859_319879_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003828150.1|319885_320200_+	DUF2469 domain-containing protein	NA	NA	NA	NA	NA
WP_014483403.1|320370_321984_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014483404.1|322346_324323_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_003828155.1|324568_324898_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_029575555.1|324919_326218_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	24.4	2.3e-07
WP_003828158.1|326675_327551_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003828159.1|327812_329135_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003828160.1|329312_330125_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003828161.1|330126_330996_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003828162.1|331038_332841_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_014483408.1|333240_333630_+	chorismate mutase	NA	NA	NA	NA	NA
WP_015438351.1|335794_338530_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	37.1	1.0e-158
WP_106641189.1|338581_340111_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106640974.1|340145_340814_-	endonuclease III	NA	NA	NA	NA	NA
WP_106640975.1|340838_341627_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.1	2.5e-12
341823:341839	attL	GCGGTGATGGTCACGCC	NA	NA	NA	NA
WP_003828171.1|342601_343180_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_003828172.1|343353_343848_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	48.1	2.2e-30
WP_052789211.1|343933_346162_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_106640976.1|346408_348343_+	cell surface protein	NA	NA	NA	NA	NA
WP_065465068.1|348525_349353_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	43.3	1.8e-53
WP_157825594.1|349358_349496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106640977.1|349492_349678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065465071.1|349973_350477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065465072.1|350473_351355_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_080867657.1|351354_351711_-|holin	holin	holin	NA	NA	NA	NA
351749:351765	attR	GCGGTGATGGTCACGCC	NA	NA	NA	NA
>prophage 2
NZ_CP021393	Bifidobacterium breve strain NRBB52 chromosome, complete genome	2379672	1201280	1239923	2379672	portal,tail,integrase,terminase,coat,holin	Bifidobacterium_phage(50.0%)	55	1201712:1201729	1246643:1246660
WP_025221566.1|1201280_1201547_-|holin	holin	holin	C9E2L0	Enterococcus_phage	50.8	9.6e-09
WP_106641205.1|1201633_1202836_-	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTJ6	Lactococcus_phage	43.6	3.1e-38
1201712:1201729	attL	GCCGAGGCGGGCGGCGAT	NA	NA	NA	NA
WP_106641049.1|1203019_1203352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106641050.1|1203383_1204178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157825600.1|1204193_1204340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106641051.1|1204389_1206228_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_106641052.1|1206251_1206611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106641053.1|1206626_1207733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106641054.1|1207735_1208851_-	hypothetical protein	NA	A0A1D8ETD8	Propionibacterium_phage	28.8	6.4e-30
WP_106641055.1|1208857_1209622_-	hypothetical protein	NA	A6N209	Microbacterium_phage	32.9	2.3e-18
WP_106641056.1|1209642_1212960_-|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	48.8	2.6e-196
WP_106641057.1|1212976_1213273_-	hypothetical protein	NA	I3NL91	Bifidobacterium_phage	68.4	4.1e-37
WP_106641058.1|1213344_1213839_-	DNA primase	NA	I3NL92	Bifidobacterium_phage	65.0	1.4e-50
WP_065470501.1|1213940_1214228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065470499.1|1214230_1214776_-	hypothetical protein	NA	I3NL93	Bifidobacterium_phage	86.9	5.4e-83
WP_065470498.1|1214815_1215232_-	transcriptional regulator	NA	I3NL94	Bifidobacterium_phage	61.6	1.1e-40
WP_081296496.1|1215228_1215618_-	hypothetical protein	NA	I3NL95	Bifidobacterium_phage	63.0	2.1e-36
WP_052828295.1|1215619_1216042_-	hypothetical protein	NA	I3NL96	Bifidobacterium_phage	86.4	1.8e-38
WP_015713630.1|1216038_1216623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065470492.1|1216687_1217545_-|coat	coat protein	coat	A0A1L2JY55	Aeribacillus_phage	49.3	1.7e-62
WP_065470491.1|1217561_1218176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065470588.1|1218199_1219360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065470489.1|1219301_1220795_-|portal	phage portal protein	portal	D7NW49	Streptomyces_phage	32.0	2.3e-59
WP_065470487.1|1220794_1221451_-|terminase	terminase	terminase	A0A1C9EHV3	Gordonia_phage	54.6	1.5e-58
WP_016462991.1|1221437_1222562_-	hypothetical protein	NA	A0A1C9EHW4	Gordonia_phage	54.3	3.8e-107
WP_032734780.1|1222554_1223091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016462988.1|1224118_1224322_+	hypothetical protein	NA	I3NLB0	Bifidobacterium_phage	93.8	1.1e-28
WP_052787023.1|1224376_1225153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155270257.1|1225243_1225402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032683672.1|1225425_1225686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032683673.1|1225753_1226020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007058723.1|1226132_1226441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052786956.1|1226437_1226767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065456941.1|1226938_1227514_-	hypothetical protein	NA	I3NLB8	Bifidobacterium_phage	34.4	8.1e-21
WP_052786958.1|1227510_1227726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052786959.1|1227722_1228139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106641059.1|1228135_1229257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106641060.1|1229260_1230676_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	37.5	5.4e-66
WP_106641061.1|1230808_1231210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052828280.1|1231219_1231837_-	single-stranded DNA-binding protein	NA	A0A0U4B2E8	Arthrobacter_phage	53.5	1.1e-31
WP_008783507.1|1231836_1232217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016462973.1|1232213_1232435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008783509.1|1232437_1232701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052828278.1|1232955_1233201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052828277.1|1233209_1234109_-	prohibitin family protein	NA	NA	NA	NA	NA
WP_052828276.1|1234198_1234438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155468143.1|1234431_1234590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052828275.1|1234589_1234889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052828274.1|1234918_1235602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157825601.1|1235868_1236279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052828273.1|1236275_1236662_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_052828272.1|1236676_1237345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052828271.1|1237395_1237779_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_050496242.1|1237901_1238363_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_052828270.1|1238747_1239923_+|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	38.7	1.2e-58
1246643:1246660	attR	ATCGCCGCCCGCCTCGGC	NA	NA	NA	NA
>prophage 3
NZ_CP021393	Bifidobacterium breve strain NRBB52 chromosome, complete genome	2379672	1642308	1715953	2379672	tRNA,protease,integrase,transposase	Lactococcus_phage(16.67%)	57	1691891:1691933	1702401:1702443
WP_003831572.1|1642308_1644900_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.9	5.5e-133
WP_019728158.1|1645052_1646018_+	universal stress protein	NA	NA	NA	NA	NA
WP_019728159.1|1646169_1647219_-	DUF3027 domain-containing protein	NA	NA	NA	NA	NA
WP_003830298.1|1647227_1647617_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	50.8	3.3e-10
WP_025301330.1|1647710_1649636_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.1	1.5e-10
WP_003830296.1|1649712_1650444_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.4e-33
WP_025301331.1|1650436_1651132_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_015439033.1|1651349_1651640_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_003830293.1|1651822_1653448_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	53.0	6.4e-148
WP_014483537.1|1654149_1654806_-	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_025301332.1|1654922_1655612_+	uracil-DNA glycosylase	NA	L7SRQ6	Infectious_laryngotracheitis_virus	37.6	1.0e-22
WP_015439036.1|1655650_1656730_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_106621055.1|1656801_1657671_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_025301334.1|1657667_1658210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003830286.1|1658206_1659265_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_025263118.1|1659261_1660299_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016462454.1|1660295_1660868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025301335.1|1661299_1662880_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_025301336.1|1662906_1663551_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003830280.1|1663683_1665120_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	36.3	2.4e-77
WP_106641124.1|1665192_1667757_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003830278.1|1667894_1668176_+	integration host factor	NA	A0A1P8CWT5	Bacillus_phage	43.2	1.8e-10
WP_050825086.1|1668287_1669775_-	Pup--protein ligase	NA	NA	NA	NA	NA
WP_003830276.1|1669774_1669972_-	ubiquitin-like protein Pup	NA	NA	NA	NA	NA
WP_015439048.1|1670081_1670987_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_025301339.1|1670989_1672654_-	proteasome accessory factor PafA2	NA	NA	NA	NA	NA
WP_015439050.1|1672765_1673482_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_015439051.1|1673659_1674778_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003830271.1|1674829_1675141_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_003830270.1|1675191_1675662_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025332387.1|1675704_1676133_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_016462462.1|1676129_1677623_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_025332388.1|1677866_1678580_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003832954.1|1678639_1680214_-	proteasome ATPase	NA	Q677Q6	Lymphocystis_disease_virus	40.6	2.8e-31
WP_003832951.1|1680267_1680963_-	DedA family protein	NA	NA	NA	NA	NA
WP_100218471.1|1680983_1681736_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_106641125.1|1681783_1684093_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_003830255.1|1684337_1685042_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003830253.1|1685180_1686194_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_003830252.1|1686490_1688353_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003830251.1|1688519_1688804_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_025301348.1|1689089_1690310_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	57.1	1.7e-124
1691891:1691933	attL	ATTTCAATCCACGCTCCCCGGATGGGGAGCGACGGTGGCGGGA	NA	NA	NA	NA
WP_080685592.1|1692076_1693534_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_025301351.1|1693530_1694292_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.9	1.9e-33
WP_052787171.1|1695897_1697100_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010081384.1|1697096_1698062_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014483316.1|1698255_1699041_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
WP_015438265.1|1699043_1700525_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014484096.1|1705981_1706215_-	hypothetical protein	NA	NA	NA	NA	NA
1702401:1702443	attR	ATTTCAATCCACGCTCCCCGGATGGGGAGCGACGGTGGCGGGA	NA	NA	NA	NA
WP_003833383.1|1706675_1706966_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_014484097.1|1707022_1708054_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_014484098.1|1708055_1708745_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_014484099.1|1708783_1709635_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_025301354.1|1709638_1711597_-	CRISPR-associated protein Cas8	NA	NA	NA	NA	NA
WP_025301355.1|1711599_1712304_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_080685582.1|1712310_1714779_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_141672445.1|1715242_1715953_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
