The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021391	Bifidobacterium breve strain NRBB50 chromosome, complete genome	2409058	313682	376422	2409058	integrase,portal,holin,transposase,tail,tRNA	Microbacterium_phage(20.0%)	54	332501:332517	376098:376114
WP_003828126.1|313682_313904_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014483392.1|314537_315743_+	MFS transporter	NA	NA	NA	NA	NA
WP_106647760.1|316331_317549_+	MFS transporter	NA	NA	NA	NA	NA
WP_077387294.1|317644_318994_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_032744541.1|319321_319822_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012576692.1|320159_320894_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_077420544.1|320977_323638_-	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	25.5	1.6e-42
WP_014483396.1|323747_324029_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_100218407.1|324176_325583_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_095256851.1|325651_326209_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014483398.1|326301_327240_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_016462135.1|327440_328379_+	ATP-binding cassette domain-containing protein	NA	M1HS04	Acanthocystis_turfacea_Chlorella_virus	27.6	9.2e-06
WP_016462136.1|328375_329422_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011068473.1|331313_331613_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_021649248.1|331616_333158_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
332501:332517	attL	CAAGCTCAAGGACATGG	NA	NA	NA	NA
WP_016462139.1|333183_334683_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_106648165.1|334850_335870_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003828150.1|335876_336191_+	DUF2469 domain-containing protein	NA	NA	NA	NA	NA
WP_014483403.1|336361_337975_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_106647763.1|338334_340311_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_003828155.1|340556_340886_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_115790808.1|340907_342017_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003828158.1|342656_343532_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003828159.1|343793_345116_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021649315.1|345293_346106_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003828161.1|346107_346977_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003828162.1|347019_348822_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_014483408.1|349221_349611_+	chorismate mutase	NA	NA	NA	NA	NA
WP_021649319.1|349757_351743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021649320.1|351775_354511_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	37.1	1.4e-158
WP_077420638.1|354562_356092_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003828168.1|356126_356795_-	endonuclease III	NA	NA	NA	NA	NA
WP_100218404.1|356819_357608_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.1	2.5e-12
WP_021649322.1|357769_358474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003828171.1|358583_359162_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_003828172.1|359335_359830_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	48.1	2.2e-30
WP_077420534.1|359915_362144_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_065505307.1|362390_364352_+	cell surface protein	NA	NA	NA	NA	NA
WP_065465068.1|364534_365362_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	43.3	1.8e-53
WP_157825594.1|365367_365505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106640977.1|365501_365687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106647764.1|365982_366486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065465072.1|366482_367364_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_080867657.1|367363_367720_-|holin	holin	holin	NA	NA	NA	NA
WP_080867655.1|367735_368413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080867653.1|368409_369912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080867651.1|369911_371621_-|tail	phage tail tape measure protein	tail	A0A221J6S3	Arthrobacter_phage	39.2	7.0e-52
WP_080867649.1|371762_372068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106641190.1|372064_372448_-	hypothetical protein	NA	A0A2P1CBZ9	Gordonia_phage	51.7	2.6e-23
WP_106647766.1|372480_372816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065465079.1|372905_373274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106647768.1|373270_373597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080867645.1|373751_375314_-	hypothetical protein	NA	A0A2R4A075	Microbacterium_phage	33.8	1.4e-62
WP_157825595.1|375300_376422_-|portal	phage portal protein	portal	A0A2R4A099	Microbacterium_phage	35.7	6.6e-59
376098:376114	attR	CCATGTCCTTGAGCTTG	NA	NA	NA	NA
>prophage 2
NZ_CP021391	Bifidobacterium breve strain NRBB50 chromosome, complete genome	2409058	390057	446343	2409058	integrase,protease,portal,terminase,holin,tail	Bifidobacterium_phage(31.58%)	65	411310:411326	439354:439370
WP_077420524.1|390057_390471_+	restriction endonuclease	NA	I3NLB9	Bifidobacterium_phage	39.5	5.1e-17
WP_077420522.1|390467_391112_+	ribonuclease	NA	NA	NA	NA	NA
WP_077420520.1|391108_391342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809976.1|391338_391521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809973.1|391570_391735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420518.1|391731_392037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420516.1|392033_392234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420514.1|392278_392509_+	WhiB family transcriptional regulator	NA	I4AZG9	Saccharomonospora_phage	39.7	5.0e-06
WP_077420512.1|392505_392742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022527279.1|392738_392963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420510.1|393102_393936_+	hypothetical protein	NA	I3NLB4	Bifidobacterium_phage	26.8	7.1e-18
WP_022527281.1|394266_394485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022527282.1|394544_394838_+	hypothetical protein	NA	A0A2H4J9P9	uncultured_Caudovirales_phage	52.8	3.4e-07
WP_015512469.1|395027_395216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420508.1|395199_396633_+|terminase	terminase	terminase	V5R8Y1	Arthrobacter_phage	37.5	1.1e-85
WP_077420506.1|396623_398108_+|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	33.0	1.5e-55
WP_022527286.1|399614_399845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022527287.1|399970_400504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420504.1|400537_401443_+	hypothetical protein	NA	A0A2K9VJQ1	Propionibacterium_phage	33.8	1.6e-34
WP_077420502.1|401442_401757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420500.1|401768_402221_+	hypothetical protein	NA	A0A1D8ETI1	Propionibacterium_phage	50.8	1.2e-24
WP_077420498.1|402217_402553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022527291.1|402564_402840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420496.1|402836_403202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420494.1|403233_403821_+	hypothetical protein	NA	A0A141E164	Streptococcus_phage	38.5	7.0e-20
WP_077420492.1|403874_404195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420490.1|404206_404599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420488.1|404600_407669_+	tape measure protein	NA	R9QN01	Lactococcus_phage	43.7	2.1e-75
WP_077420486.1|407688_408471_+	3-hydroxy-3-methylglutaryl CoA synthase	NA	I3NL89	Bifidobacterium_phage	38.5	1.6e-43
WP_106648166.1|408490_412282_+|tail	phage tail protein	tail	I3NL88	Bifidobacterium_phage	63.2	3.2e-182
411310:411326	attL	CGGCAAAGAAACCGTCC	NA	NA	NA	NA
WP_065453910.1|412290_412893_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_065453908.1|413046_413769_+	hypothetical protein	NA	I3NL86	Bifidobacterium_phage	57.5	7.5e-40
WP_065453906.1|413785_415366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065453904.1|415780_417025_+	reverse transcriptase	NA	D6PSR5	Lactobacillus_phage	28.6	8.4e-31
WP_157825682.1|417012_417186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077420482.1|417313_417637_+	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	71.4	2.0e-16
WP_106647769.1|417698_418934_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTJ6	Lactococcus_phage	43.1	1.6e-37
WP_065453902.1|419018_419285_+|holin	holin	holin	C9E2L0	Enterococcus_phage	49.2	6.2e-08
WP_106647771.1|419347_419632_-	antitoxin	NA	NA	NA	NA	NA
WP_052789178.1|419615_419888_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_065453901.1|419938_420718_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3B212	Gordonia_phage	43.3	1.7e-53
WP_019727783.1|421148_422183_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_106647772.1|422527_423337_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003828178.1|423440_423671_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_021649483.1|423736_424255_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_021649482.1|424289_425126_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_060812406.1|425201_426833_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003828182.1|426836_427760_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_015438381.1|427768_429241_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_021649479.1|429240_429534_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_021649478.1|429617_430322_+	endonuclease NucS	NA	NA	NA	NA	NA
WP_003828186.1|430452_431406_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_016462197.1|431507_432746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828188.1|432745_433750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828189.1|433972_434944_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_106647774.1|435082_435709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003828192.1|436388_436778_+	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_003831438.1|436903_437857_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003831442.1|438049_439051_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014483427.1|439096_440284_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
439354:439370	attR	GGACGGTTTCTTTGCCG	NA	NA	NA	NA
WP_025301002.1|440548_441715_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003828197.1|441726_442665_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_051483103.1|442700_443573_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015438392.1|443569_444889_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	2.2e-29
WP_003831456.1|445305_446343_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP021391	Bifidobacterium breve strain NRBB50 chromosome, complete genome	2409058	960508	1088566	2409058	protease,transposase,integrase	Agrobacterium_phage(14.81%)	102	960412:960471	963807:963907
960412:960471	attL	ATTCCGATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGG	NA	NA	NA	NA
WP_007054866.1|960508_961564_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IH55	Gordonia_phage	26.7	1.0e-05
WP_010081384.1|961560_962526_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014484092.1|962522_963725_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014483316.1|964155_964941_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
963807:963907	attR	CCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCGGAATGGATGATTGGTTTCTCCCCGTCCTTGAGCGTGGAGCACGCG	NA	NA	NA	NA
WP_015438265.1|964943_966425_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_080659686.1|967526_967829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742916.1|968229_968994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021649234.1|970604_971927_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_021649235.1|972030_972900_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019727979.1|972904_973735_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_021649236.1|973764_975126_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_021649237.1|975118_976600_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_052792710.1|976694_977675_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_106647856.1|980392_981679_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	32.3	3.8e-50
WP_019727986.1|982139_982364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155238099.1|982381_982531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021649573.1|982584_982953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157825684.1|983069_983429_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_021649568.1|985321_985891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025332187.1|986022_987480_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_003828883.1|987540_987948_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003831219.1|988045_988525_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_032743087.1|988609_989530_-	hemolysin III	NA	NA	NA	NA	NA
WP_014483900.1|989716_991204_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_003828887.1|991262_991541_-	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	45.1	1.6e-11
WP_077420390.1|991655_993374_-	cell division protein FtsK	NA	V5UPA0	Mycobacterium_phage	33.3	1.1e-15
WP_025301149.1|993577_994483_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003828893.1|994544_994943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828894.1|995172_995472_+	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	66.7	5.3e-24
WP_077420360.1|995517_998610_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003828897.1|998606_1000148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016463119.1|1000169_1000598_-	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_050824800.1|1000683_1001487_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_065504802.1|1001558_1002233_+	ComF family protein	NA	NA	NA	NA	NA
WP_014483891.1|1002290_1003364_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	6.4e-11
WP_003828907.1|1003363_1004086_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	2.3e-28
WP_025301153.1|1004116_1006369_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_003828909.1|1006546_1007140_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_103619915.1|1007136_1007652_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_016463121.1|1007725_1008559_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014483888.1|1009679_1010852_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_014483887.1|1010956_1011835_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003828920.1|1012084_1013560_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_025262906.1|1013707_1014334_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003828925.1|1014499_1016611_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_025301157.1|1016644_1017631_+	TerC family protein	NA	A0A140G639	Enterobacteria_phage	34.6	1.3e-37
WP_014483884.1|1017800_1019243_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_003828931.1|1019366_1019966_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003828934.1|1020300_1021089_+	response regulator	NA	NA	NA	NA	NA
WP_106647857.1|1021127_1023983_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	27.9	2.6e-43
WP_095256945.1|1024111_1025041_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_003831861.1|1025083_1025758_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_106647859.1|1025810_1027943_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_032738251.1|1028080_1028281_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_025221443.1|1028429_1028915_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106647860.1|1028918_1029569_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_106647864.1|1030686_1031274_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	35.9	4.0e-23
WP_014483316.1|1031430_1032216_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
WP_015438265.1|1032218_1033700_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_106647865.1|1033869_1035123_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	41.4	1.2e-32
WP_080784033.1|1035143_1035785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106647867.1|1035946_1037119_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016463130.1|1037146_1038481_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003828955.1|1038708_1039938_-	acetate kinase	NA	NA	NA	NA	NA
WP_015438676.1|1040069_1041740_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_032738170.1|1042160_1043183_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.6	2.5e-41
WP_003828961.1|1043323_1045255_-	acetyltransferase	NA	A0A166XZF2	Gordonia_phage	26.3	8.2e-17
WP_003828963.1|1045838_1046528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003828964.1|1046531_1046750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003828965.1|1046746_1047073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003828966.1|1047103_1049836_-	type III restriction endonuclease	NA	NA	NA	NA	NA
WP_003828970.1|1050244_1050406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015438265.1|1050982_1052464_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014483316.1|1052466_1053252_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
WP_106647869.1|1054067_1054574_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.6	1.3e-19
WP_106647870.1|1054835_1056296_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_019728013.1|1057038_1057680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828987.1|1057691_1058852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828989.1|1058969_1059524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003828996.1|1060472_1060886_+	helix-turn-helix transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	36.1	4.5e-05
WP_003831873.1|1061501_1063064_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.0	9.0e-14
WP_106647872.1|1063511_1065989_+	phosphoketolase	NA	NA	NA	NA	NA
WP_015438680.1|1066172_1067555_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.6	3.7e-27
WP_065452646.1|1067558_1067945_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003829007.1|1067941_1068643_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_019728019.1|1069052_1069862_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_106647874.1|1070110_1071091_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_052787716.1|1071259_1072462_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.5e-29
WP_014483869.1|1072458_1073145_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_052789053.1|1073223_1074375_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003829015.1|1074468_1076166_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.1	4.3e-86
WP_003829017.1|1076184_1076415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106647875.1|1076689_1079065_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	39.1	8.2e-152
WP_003833429.1|1079177_1080059_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_025262912.1|1080203_1080836_+	DUF3000 family protein	NA	NA	NA	NA	NA
WP_025262913.1|1080832_1082134_+	ribonuclease D	NA	K7XYU9	uncultured_Mediterranean_phage	25.0	8.6e-10
WP_003833426.1|1082188_1083562_+	trigger factor	NA	NA	NA	NA	NA
WP_025262914.1|1083744_1085145_+	chloride channel protein	NA	NA	NA	NA	NA
WP_003833424.1|1085189_1085567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003833421.1|1085718_1086342_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.7	3.7e-43
WP_003829035.1|1086347_1087031_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.4	1.3e-38
WP_003833417.1|1087204_1088566_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	49.4	1.1e-113
>prophage 4
NZ_CP021391	Bifidobacterium breve strain NRBB50 chromosome, complete genome	2409058	2270717	2362569	2409058	transposase	Paenibacillus_phage(22.22%)	60	NA	NA
WP_115790810.1|2270717_2271155_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_106630696.1|2271151_2271529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015439315.1|2272794_2273868_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_015439316.1|2273990_2274770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032743212.1|2274836_2276933_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_015439318.1|2276994_2277936_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032743213.1|2277940_2279500_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	1.2e-18
WP_032743214.1|2279524_2280703_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106648122.1|2281027_2281525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015438265.1|2281705_2283187_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014483316.1|2283189_2283975_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.0	1.7e-37
WP_157825697.1|2283964_2284252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106630698.1|2284848_2285061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021650051.1|2285017_2285227_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	44.3	3.8e-05
WP_041473463.1|2285377_2285812_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.4	5.0e-15
WP_021648758.1|2285884_2287408_-	amino acid permease	NA	NA	NA	NA	NA
WP_032742763.1|2287662_2291421_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_021648760.1|2291430_2292132_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	4.9e-36
WP_021648762.1|2292613_2294086_+	amino acid permease	NA	NA	NA	NA	NA
WP_015439324.1|2294137_2294743_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_003829602.1|2294893_2295736_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_032742764.1|2295735_2296590_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015439325.1|2296960_2297977_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_106648125.1|2298182_2299511_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_100199007.1|2299931_2300630_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_014484412.1|2300716_2301094_+	DUF4235 domain-containing protein	NA	NA	NA	NA	NA
WP_003831850.1|2301189_2301957_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021648767.1|2302124_2304872_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_021648768.1|2304868_2307208_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003829580.1|2307367_2307619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106648127.1|2319835_2320591_+	NAD-dependent deacetylase	NA	S5M4R0	Bacillus_phage	25.4	7.2e-17
WP_106648128.1|2320697_2321963_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_106648130.1|2322266_2324087_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003827791.1|2324860_2325727_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_106648132.1|2325745_2326696_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019727602.1|2326717_2328007_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014484417.1|2328179_2329388_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_077420630.1|2329500_2331816_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_106648133.1|2331932_2332382_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_106648135.1|2332818_2334891_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_106648136.1|2334932_2335736_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_106648138.1|2335847_2336606_-	esterase	NA	NA	NA	NA	NA
WP_025332535.1|2336663_2337533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106648140.1|2337889_2338471_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	64.4	3.6e-69
WP_106648141.1|2338533_2339877_+	sugar-binding domain protein	NA	NA	NA	NA	NA
WP_106648143.1|2339966_2342957_-	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	28.1	3.4e-70
WP_106648144.1|2343117_2343333_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003827808.1|2343325_2343838_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_015439350.1|2345788_2347003_-	MFS transporter	NA	NA	NA	NA	NA
WP_003827811.1|2347090_2348089_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003827812.1|2348140_2349001_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_003827813.1|2349055_2350567_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003833025.1|2350743_2352156_-	DUF4032 domain-containing protein	NA	NA	NA	NA	NA
WP_014484423.1|2352146_2353007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003833030.1|2354296_2355379_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003827821.1|2355413_2356382_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003827822.1|2356384_2357950_+	sugar ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	5.5e-11
WP_003827823.1|2357942_2358947_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003827824.1|2358946_2360317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015438265.1|2361087_2362569_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
