The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025122	Bacillus sp. HBCD-sjtu chromosome, complete genome	5230501	1578646	1640613	5230501	tRNA,coat,protease,integrase	Klosneuvirus(22.22%)	59	1606181:1606200	1621808:1621827
WP_000125362.1|1578646_1579786_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000354028.1|1579798_1580851_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|1580870_1581071_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344456.1|1581067_1582069_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	5.2e-07
WP_000464508.1|1582074_1582692_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823597.1|1582880_1583825_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871182.1|1583838_1584369_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_157827770.1|1584810_1585245_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101194904.1|1585279_1585924_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_101194905.1|1586102_1587914_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025295.1|1588288_1589395_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092244.1|1589425_1590259_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_101194906.1|1590278_1591808_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_101194907.1|1591960_1593100_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
WP_000812272.1|1593102_1593645_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_042512180.1|1593726_1594374_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621721.1|1594455_1595307_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_101194908.1|1595403_1597317_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_101194909.1|1597366_1599289_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_101194910.1|1599263_1600040_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
WP_157827771.1|1600133_1601216_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000276720.1|1601205_1601913_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000496111.1|1602052_1603339_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001037006.1|1603338_1603887_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
WP_000944957.1|1603950_1604241_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|1604244_1604589_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|1604600_1604909_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_101194912.1|1605078_1606467_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
1606181:1606200	attL	TTCGTATCAATTGCCTCTTT	NA	NA	NA	NA
WP_000599073.1|1606534_1607395_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797461.1|1607387_1608134_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503310.1|1608267_1609065_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|1609067_1609754_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975753.1|1609789_1610335_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135493.1|1610349_1611201_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|1611242_1612262_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_002360221.1|1612999_1613143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040928540.1|1613396_1614824_+	chloramphenicol/florfenicol efflux MFS transporter FexA	NA	NA	NA	NA	NA
WP_000855243.1|1615001_1615418_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000619629.1|1615700_1616066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029658482.1|1616067_1617981_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000867971.1|1617983_1619069_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	25.4	1.7e-11
WP_157827772.1|1619182_1619743_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001226272.1|1619789_1620365_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000360979.1|1620586_1621549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582053.1|1621713_1623015_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
1621808:1621827	attR	TTCGTATCAATTGCCTCTTT	NA	NA	NA	NA
WP_101194913.1|1623108_1625754_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.9	4.7e-164
WP_000366998.1|1626149_1627175_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_002054837.1|1627237_1628251_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_001224512.1|1628330_1629620_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087068.1|1629619_1630609_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_042512172.1|1630629_1631382_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001226420.1|1631384_1632314_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000008996.1|1632329_1633163_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_000547860.1|1633180_1634515_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017561634.1|1634930_1635383_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359781.1|1635385_1635802_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869113.1|1635834_1636431_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097303.1|1636427_1638758_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	3.9e-178
WP_009879805.1|1638942_1640613_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	9.6e-14
>prophage 2
NZ_CP025122	Bacillus sp. HBCD-sjtu chromosome, complete genome	5230501	2905708	2915701	5230501		Bacillus_phage(33.33%)	8	NA	NA
WP_001029999.1|2905708_2907343_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_157827792.1|2907521_2908502_+	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	41.9	2.3e-60
WP_179950254.1|2908545_2908926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101195170.1|2908925_2909630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165450126.1|2910113_2911655_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	3.4e-21
WP_000833093.1|2912039_2913365_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	5.4e-44
WP_001262952.1|2913510_2914212_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	3.3e-40
WP_070172022.1|2914195_2915701_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	29.1	2.7e-31
>prophage 3
NZ_CP025122	Bacillus sp. HBCD-sjtu chromosome, complete genome	5230501	2947539	2955915	5230501		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625683.1|2947539_2948847_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170540.1|2948935_2949655_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000278820.1|2949647_2949902_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666779.1|2949898_2950582_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|2950565_2952785_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|2952769_2954185_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262436.1|2954290_2955331_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000088592.1|2955327_2955915_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
>prophage 4
NZ_CP025122	Bacillus sp. HBCD-sjtu chromosome, complete genome	5230501	3083180	3089285	5230501	transposase	Staphylococcus_phage(66.67%)	6	NA	NA
WP_000195429.1|3083180_3084353_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000393259.1|3084409_3084802_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.9e-72
WP_127821116.1|3084802_3086170_+	APH(2'')-Ia/If/Ih family aminoglycoside O-phosphotransferase	NA	A0A1X9I6C2	Streptococcus_phage	100.0	1.1e-270
WP_025189010.1|3086150_3086543_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_001028144.1|3086543_3087983_+	aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A1X9I6C2	Streptococcus_phage	100.0	3.8e-285
WP_000195429.1|3088112_3089285_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 5
NZ_CP025122	Bacillus sp. HBCD-sjtu chromosome, complete genome	5230501	4554061	4563373	5230501		Bacillus_phage(71.43%)	9	NA	NA
WP_001991647.1|4554061_4555318_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_001194297.1|4555416_4556181_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017561892.1|4556421_4558182_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	96.1	6.7e-268
WP_171856546.1|4558243_4558948_+	response regulator	NA	W8CYM9	Bacillus_phage	93.6	5.0e-121
WP_179950259.1|4558944_4560018_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.5	1.6e-171
WP_157827833.1|4560042_4560630_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|4560825_4561545_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_157827834.1|4561694_4562366_+	class I SAM-dependent methyltransferase	NA	W8CYT3	Bacillus_phage	86.1	1.0e-59
WP_017561888.1|4562500_4563373_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.9	7.9e-68
