The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025146	Klebsiella pneumoniae strain KP1766 chromosome, complete genome	5383248	114948	139707	5383248	integrase,transposase,tRNA	Escherichia_phage(23.08%)	19	130847:130864	142356:142373
WP_032434432.1|114948_115638_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_004150214.1|115642_117763_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|117781_118057_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002922664.1|118111_118735_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_032434430.1|118993_120670_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	24.0	1.3e-23
WP_002922654.1|120675_121293_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032434427.1|121568_122819_+	chloride channel protein	NA	NA	NA	NA	NA
WP_032434425.1|122874_123933_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	33.5	1.4e-18
WP_000608644.1|124452_125715_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|125970_126846_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|126892_127225_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|130103_130808_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
130847:130864	attL	TTTGCAACAGTGCCTCTC	NA	NA	NA	NA
WP_001288432.1|131126_132560_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_085955172.1|132801_134009_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_001389365.1|135420_136185_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|136327_136594_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|136814_137288_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_101169226.1|137443_138457_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.3	6.6e-66
WP_001067855.1|139002_139707_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
142356:142373	attR	GAGAGGCACTGTTGCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP025146	Klebsiella pneumoniae strain KP1766 chromosome, complete genome	5383248	494283	527720	5383248	tail,head,tRNA,portal,protease,integrase,capsid,terminase	uncultured_Caudovirales_phage(73.33%)	33	512070:512087	528065:528082
WP_004150007.1|494283_495231_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004150006.1|495245_495755_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.5	4.4e-18
WP_032434585.1|495883_497008_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|496979_497453_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|497479_498022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|498026_498599_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|498602_499421_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|499417_499675_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|499650_500205_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|506179_506401_-	membrane protein	NA	NA	NA	NA	NA
WP_004144975.1|506693_509804_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_004144974.1|509816_510956_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016947472.1|511334_511988_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
512070:512087	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|512260_513487_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|513579_514521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|514702_514987_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|514997_515777_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|516228_516498_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|516490_516679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|516671_516986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|516982_517351_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|517347_517713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|517712_519848_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|520190_520526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|520574_521087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|521350_522517_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|522568_523129_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|523130_524372_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|524368_524704_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|524700_525000_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|524999_525443_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|525718_526075_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|526058_527720_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
528065:528082	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 3
NZ_CP025146	Klebsiella pneumoniae strain KP1766 chromosome, complete genome	5383248	1284484	1331952	5383248	tail,holin,integrase,coat,terminase	Salmonella_phage(20.41%)	59	1284374:1284388	1293687:1293701
1284374:1284388	attL	TACAGTCAACCTAAG	NA	NA	NA	NA
WP_023301229.1|1284484_1285714_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
WP_023301228.1|1285691_1285967_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_071557557.1|1286005_1286245_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_101134779.1|1286252_1286561_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	9.3e-24
WP_101134887.1|1286557_1287268_-	hypothetical protein	NA	Q71T76	Escherichia_phage	62.8	6.0e-74
WP_101134780.1|1287311_1288400_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.2	1.4e-106
WP_101134781.1|1288413_1291515_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	58.2	1.2e-296
WP_016946289.1|1291652_1291808_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_004179600.1|1291816_1292008_-	YebW family protein	NA	NA	NA	NA	NA
WP_101134782.1|1292492_1292696_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.8e-20
WP_032438209.1|1292724_1293135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134783.1|1293261_1293645_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	83.5	2.0e-52
WP_023282398.1|1293743_1293962_+	hypothetical protein	NA	K7PKS2	Enterobacteria_phage	64.8	8.9e-21
1293687:1293701	attR	CTTAGGTTGACTGTA	NA	NA	NA	NA
WP_101134784.1|1293964_1294501_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.9	7.2e-64
WP_071785976.1|1294588_1294777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064179420.1|1294791_1295700_+	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_023286279.1|1295702_1296452_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	2.2e-119
WP_023286280.1|1296459_1296795_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_101134785.1|1296787_1297573_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	1.6e-64
WP_101134786.1|1297700_1298264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101134787.1|1298260_1298905_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	78.9	1.8e-109
WP_101134788.1|1298901_1299333_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	47.2	2.2e-10
WP_101134789.1|1299505_1300402_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	91.4	2.2e-28
WP_040241897.1|1300680_1300908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|1301283_1301517_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_071557491.1|1301621_1301870_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_101134790.1|1301904_1302501_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_004892208.1|1302709_1303006_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_023282412.1|1303002_1303359_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023287514.1|1303474_1304296_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_024940884.1|1304551_1304851_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_064179041.1|1304847_1305387_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_023313049.1|1305383_1305731_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	1.2e-40
WP_101134792.1|1305727_1306003_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.7	5.2e-10
WP_072071795.1|1306141_1306558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073545918.1|1306882_1307119_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	62.8	3.8e-17
WP_101134793.1|1307369_1308374_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.3	2.3e-34
WP_064179047.1|1308351_1309656_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	1.7e-146
WP_064179048.1|1309660_1311085_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	70.9	2.9e-192
WP_101134794.1|1311068_1312181_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.6	5.3e-109
WP_101134795.1|1312284_1313049_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.8	8.7e-79
WP_048997557.1|1313136_1314273_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.6	1.3e-155
WP_101134796.1|1314322_1314607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048271645.1|1314610_1315021_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	6.6e-09
WP_065520084.1|1315022_1315406_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	6.0e-20
WP_008807839.1|1315407_1315959_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_004146196.1|1315955_1316348_+	hypothetical protein	NA	M4SMU9	Cyanophage	30.9	7.3e-05
WP_101134797.1|1316371_1317544_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	26.6	2.1e-23
WP_043906941.1|1317598_1318081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157829711.1|1318218_1318416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906942.1|1318592_1319123_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
WP_050486020.1|1319204_1319702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602982.1|1319747_1320110_+	membrane protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
WP_101134798.1|1320205_1323775_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	31.4	1.1e-83
WP_023313121.1|1323774_1324248_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.6	8.6e-61
WP_101134799.1|1324234_1324717_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	97.5	1.3e-83
WP_017880229.1|1324726_1325107_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_101134800.1|1325103_1328172_+	kinase	NA	A0A286S259	Klebsiella_phage	97.6	0.0e+00
WP_101134803.1|1330857_1331952_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	88.7	3.0e-181
>prophage 4
NZ_CP025146	Klebsiella pneumoniae strain KP1766 chromosome, complete genome	5383248	1523234	1620729	5383248	tail,head,tRNA,portal,protease,holin,plate,integrase,capsid,terminase	Escherichia_phage(20.83%)	95	1558443:1558467	1597976:1598000
WP_101134808.1|1523234_1524584_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025368033.1|1524580_1525270_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032434868.1|1525269_1526946_+	OmpA family protein	NA	NA	NA	NA	NA
WP_025368035.1|1526948_1527440_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_107318634.1|1527670_1527835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434870.1|1527860_1530218_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_071994657.1|1530227_1530770_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_032425140.1|1530843_1531314_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_077254137.1|1531656_1534059_+	glycoside hydrolase family 104 protein	NA	NA	NA	NA	NA
WP_032434872.1|1534055_1534499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886200.1|1534659_1535040_+	DUF4087 domain-containing protein	NA	NA	NA	NA	NA
WP_123618670.1|1535511_1535940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368039.1|1536156_1536456_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_032435675.1|1536518_1536782_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
WP_032425487.1|1536784_1537993_+	membrane protein	NA	NA	NA	NA	NA
WP_032434874.1|1537985_1541357_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_153582916.1|1541359_1541509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434876.1|1541849_1543457_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_025368043.1|1543490_1545260_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032425136.1|1545223_1546306_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032425135.1|1546341_1546866_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_101134809.1|1546870_1549192_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.7e-14
WP_050484908.1|1549188_1549692_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.0	1.5e-18
WP_023317120.1|1549685_1550030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086472102.1|1550062_1550800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049107563.1|1551042_1551525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434878.1|1553408_1554293_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_050598595.1|1554282_1554840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071838925.1|1555347_1555746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123618669.1|1556534_1556984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050598596.1|1556980_1557514_+	hypothetical protein	NA	NA	NA	NA	NA
1558443:1558467	attL	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_032434882.1|1558661_1559831_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
WP_123618668.1|1559935_1560778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254126.1|1560879_1561080_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	60.0	1.8e-12
WP_004864289.1|1561887_1562403_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_021314787.1|1562778_1563855_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.4	2.8e-147
WP_032434886.1|1563982_1564768_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.9e-61
WP_024623196.1|1564767_1565067_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
WP_000690183.1|1565695_1566391_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
WP_001191665.1|1566488_1566731_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_101134810.1|1566765_1567227_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	89.7	2.3e-58
WP_001208720.1|1567464_1567644_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_017880208.1|1567633_1568587_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
WP_101134811.1|1568583_1569393_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	5.5e-108
WP_000779146.1|1569402_1569780_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_032434890.1|1569792_1570773_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.6e-136
WP_004899672.1|1570786_1571365_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_032412064.1|1571584_1572010_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.7	1.9e-59
WP_032434891.1|1572006_1572162_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	2.5e-09
WP_017145563.1|1572660_1573056_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1573042_1573324_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_032434894.1|1573323_1573953_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	1.2e-105
WP_032434896.1|1573960_1574236_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	1.9e-23
WP_032434899.1|1574437_1575097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032434901.1|1575296_1575647_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.7	3.4e-46
WP_032434902.1|1575805_1576303_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
WP_000246643.1|1576306_1578058_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	6.7e-252
WP_032434905.1|1578205_1579432_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_032434907.1|1579424_1580024_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	1.0e-90
WP_004104235.1|1580033_1581272_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_023316722.1|1581349_1581667_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
WP_031592512.1|1581675_1582014_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	3.3e-38
WP_019705270.1|1582010_1582460_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_023302599.1|1582456_1582804_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_032412035.1|1582860_1583565_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
WP_032434909.1|1583595_1584000_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	1.9e-32
WP_016530183.1|1584002_1584308_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|1584381_1584615_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032434911.1|1584676_1588063_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	4.0e-301
WP_004884312.1|1588084_1588558_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_023302606.1|1588544_1589021_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
WP_032434913.1|1589033_1589414_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.0e-60
WP_032434915.1|1589410_1592488_+	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
WP_032434917.1|1595172_1596267_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.5	1.4e-178
WP_032434919.1|1596301_1597390_-	acyltransferase	NA	C6ZR20	Salmonella_phage	27.2	1.8e-05
WP_004149224.1|1598088_1599018_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1597976:1598000	attR	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_002913362.1|1599307_1600069_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149222.1|1600130_1601459_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913359.1|1601826_1602111_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_032434923.1|1602270_1603581_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_032434925.1|1603580_1605725_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913355.1|1605934_1606420_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002913348.1|1606440_1606992_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913346.1|1607159_1608092_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913342.1|1608133_1609219_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_004174960.1|1609221_1610046_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913340.1|1610045_1610855_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913339.1|1610854_1611403_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913338.1|1611434_1611716_+	YfcL family protein	NA	NA	NA	NA	NA
WP_032435686.1|1611777_1613766_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|1613924_1615145_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004149211.1|1615354_1616530_+	MFS transporter	NA	NA	NA	NA	NA
WP_002913228.1|1617703_1618840_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_002913227.1|1618903_1619917_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015958766.1|1619916_1620729_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP025146	Klebsiella pneumoniae strain KP1766 chromosome, complete genome	5383248	1820427	1827332	5383248	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1820427_1821291_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1821301_1822075_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1822315_1823209_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1823454_1824816_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1825134_1825857_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_032434977.1|1825853_1827332_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 6
NZ_CP025146	Klebsiella pneumoniae strain KP1766 chromosome, complete genome	5383248	1972245	2025071	5383248	head,tRNA,holin,integrase,terminase	Enterobacteria_phage(25.0%)	68	1978641:1978663	2025610:2025632
WP_004151452.1|1972245_1973979_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|1974214_1974784_+	VOC family protein	NA	NA	NA	NA	NA
WP_002911488.1|1974860_1975604_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_032435025.1|1975685_1976690_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|1976686_1977430_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|1977469_1977865_-	membrane protein	NA	NA	NA	NA	NA
WP_096991418.1|1977917_1978691_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
1978641:1978663	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_101134814.1|1978693_1979953_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	90.4	3.0e-225
WP_023283988.1|1979995_1980241_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
WP_101134815.1|1980244_1980439_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	53.6	2.6e-11
WP_101134816.1|1980435_1980942_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	43.9	3.5e-36
WP_101134817.1|1981157_1981685_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	4.9e-57
WP_072044372.1|1981681_1981840_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	1.9e-09
WP_049186040.1|1981836_1982517_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	4.6e-124
WP_101134818.1|1982513_1983359_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_085841924.1|1983374_1983659_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	4.4e-28
WP_019725103.1|1983747_1983942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134819.1|1984590_1985427_-	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	29.5	2.1e-25
WP_004197930.1|1985389_1985569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134820.1|1985690_1986389_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.2	2.0e-106
WP_004201115.1|1986500_1986728_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004141720.1|1986767_1987088_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_101134821.1|1987416_1988277_+	replication protein	NA	K7PGT1	Enterobacteria_phage	52.2	3.9e-59
WP_101134822.1|1988273_1989122_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	3.0e-88
WP_004151295.1|1989118_1989412_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_101134823.1|1989408_1989954_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.2	5.7e-08
WP_101134824.1|1989950_1990700_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_101134889.1|1991795_1992011_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	64.3	5.0e-08
WP_101134825.1|1992007_1992553_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	67.7	1.0e-20
WP_016831923.1|1992542_1992767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101134826.1|1993018_1993474_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	3.4e-54
WP_023342724.1|1993473_1993644_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_101134827.1|1993636_1994275_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	70.3	3.4e-76
WP_101134828.1|1994271_1994913_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	8.4e-35
WP_023342726.1|1994909_1995050_+	YlcG family protein	NA	NA	NA	NA	NA
WP_101134829.1|1995046_1995736_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.2	4.5e-58
WP_019704119.1|1996581_1996806_+|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_019704120.1|1996783_1997278_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	95.1	1.7e-88
WP_020804394.1|1997274_1997625_+	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	5.8e-14
WP_065242184.1|1998856_1999483_+	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	1.1e-103
WP_065242183.1|1999513_1999981_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_065242182.1|1999964_2001263_+|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.1	1.5e-240
WP_065242181.1|2001275_2002745_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	55.9	9.9e-148
WP_065242180.1|2002671_2003667_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.2	8.0e-117
WP_112113408.1|2003713_2004016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803626.1|2004087_2005473_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.5	6.9e-167
WP_004178846.1|2005476_2005908_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
WP_004178847.1|2005919_2007017_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	4.2e-151
WP_020803627.1|2007026_2007284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040229589.1|2007286_2007667_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	1.2e-28
WP_032752624.1|2007666_2007840_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_032425728.1|2007839_2008202_+	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	45.0	3.1e-18
WP_020804116.1|2008204_2008573_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	79.5	4.7e-46
WP_020804115.1|2008569_2008953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065242179.1|2009010_2009775_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.4	4.2e-41
WP_065242178.1|2009843_2010557_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.1	9.6e-64
WP_020804850.1|2010775_2011531_+	KilA-N domain protein	NA	K7PH30	Enterobacteria_phage	50.0	2.8e-61
WP_020804851.1|2011533_2011788_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	72.3	2.3e-20
WP_023328739.1|2012208_2012529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556004.1|2012580_2012898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032426034.1|2013320_2013734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804808.1|2013793_2017159_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	75.0	0.0e+00
WP_032426035.1|2017158_2017404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087588165.1|2017503_2017923_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	6.3e-31
WP_038421573.1|2017922_2018393_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	3.3e-28
WP_065242176.1|2018389_2018785_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	2.3e-35
WP_087588163.1|2018771_2021249_+	MoaD/ThiS family protein	NA	R9TR21	Aeromonas_phage	47.0	2.3e-197
WP_101134803.1|2023976_2025071_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	88.7	3.0e-181
2025610:2025632	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
>prophage 7
NZ_CP025146	Klebsiella pneumoniae strain KP1766 chromosome, complete genome	5383248	2833161	2844048	5383248		Escherichia_phage(87.5%)	9	NA	NA
WP_020805006.1|2833161_2836269_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2836323_2837589_+	MFS transporter	NA	NA	NA	NA	NA
WP_020805010.1|2837619_2838708_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
WP_004176262.1|2838794_2839055_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|2839352_2840213_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|2840233_2840995_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2841255_2842158_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|2842169_2843435_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|2843427_2844048_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP025146	Klebsiella pneumoniae strain KP1766 chromosome, complete genome	5383248	3513490	3522964	5383248	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3513490_3515212_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3515256_3515958_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3516311_3516530_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3516660_3518940_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3518970_3519288_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3519613_3519835_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_025368306.1|3519911_3521852_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_002896440.1|3521848_3522964_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP025147	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p1, complete sequence	205953	778	43817	205953	tail,head,portal,lysis,terminase,holin,transposase,plate,capsid,integrase	Escherichia_phage(57.45%)	57	4854:4872	49407:49425
WP_101169249.1|778_1804_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	49.1	2.1e-83
WP_000703827.1|2516_2789_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|2837_4019_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|4022_4808_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
4854:4872	attL	AAACTTTCACATGTGAAAG	NA	NA	NA	NA
WP_000338945.1|4981_5293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|5599_6415_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|6501_6804_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|6697_6949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000242922.1|7455_7893_-	DUF4102 domain-containing protein	NA	Q858E8	Salmonella_phage	69.9	2.4e-25
WP_000058871.1|8098_8530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337763.1|8543_9791_-	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.2e-05
WP_001258027.1|9780_10143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096362.1|10145_10388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268395.1|10822_11761_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_000435224.1|11877_12423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001256128.1|12425_12995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004673.1|13006_13570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468308.1|13749_13968_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_032413567.1|14049_15213_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
WP_032413566.1|15212_15692_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_032413565.1|15706_18154_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|18146_18266_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001461862.1|18298_18574_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
WP_001251408.1|18630_19149_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286737.1|19161_20352_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_001322808.1|20411_21011_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	3.4e-102
WP_001322807.1|21035_21425_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	5.5e-13
WP_001106830.1|21446_21887_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.0	1.5e-54
WP_001030526.1|21858_22461_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	2.9e-93
WP_032413564.1|22460_23795_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.7	1.4e-177
WP_001285340.1|23791_24403_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_064987485.1|24395_25304_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.3	5.7e-162
WP_000127164.1|25308_25656_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_032413562.1|25652_26288_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	3.2e-111
WP_032413561.1|26354_26807_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	2.6e-75
WP_032413560.1|26799_27267_-|tail	phage tail protein	tail	A0A0F7LDF5	Escherichia_phage	97.4	6.9e-79
WP_000040630.1|27374_27800_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	2.3e-65
WP_021563761.1|27787_28213_-	hypothetical protein	NA	M1SV74	Escherichia_phage	97.9	1.2e-58
WP_001144101.1|28227_28725_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|28724_29006_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|29009_29213_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_032413559.1|29212_29722_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_032413558.1|29821_30565_-|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.2	6.0e-125
WP_001248583.1|30568_31642_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001607695.1|31700_32555_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
WP_032413555.1|32728_34501_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.3	0.0e+00
WP_032413553.1|34500_35535_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	1.6e-200
WP_000725496.1|35929_37474_+	RNA-directed DNA polymerase	NA	A0A0F7LCK9	Escherichia_phage	99.0	4.7e-289
WP_032413551.1|37961_40238_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	99.5	0.0e+00
WP_000027673.1|40227_40503_-	hypothetical protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113264.1|40499_40724_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|40726_41026_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|41025_41250_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|41313_41814_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001081582.1|41991_42267_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|42388_42688_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|42803_43817_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
49407:49425	attR	AAACTTTCACATGTGAAAG	NA	NA	NA	NA
>prophage 2
NZ_CP025147	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p1, complete sequence	205953	55545	95697	205953	transposase,integrase	Escherichia_phage(46.15%)	40	63793:63808	92915:92930
WP_012569499.1|55545_56526_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_001167032.1|56834_57692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972663.1|57678_57909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210758.1|57908_58427_-	nitrite reductase	NA	NA	NA	NA	NA
WP_000919345.1|58423_58870_-	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000422768.1|58869_59229_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000591074.1|59285_59714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139698.1|59747_60608_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001326179.1|60623_61601_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
WP_000539392.1|61582_62437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902149.1|62441_62756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326180.1|62745_63189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805800.1|63315_63837_-	hypothetical protein	NA	NA	NA	NA	NA
63793:63808	attL	GAAAGGGGCGATGATC	NA	NA	NA	NA
WP_077264454.1|63839_64301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000849071.1|64365_64974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946102.1|65242_66358_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
WP_000883925.1|66375_66810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350011.1|67846_68947_-	plasmid replication protein	NA	NA	NA	NA	NA
WP_000375812.1|69223_69790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|70261_71245_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000919078.1|71261_71555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|71556_71976_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001020646.1|72035_72587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891157.1|72583_73192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790610.1|73202_73736_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000356489.1|73735_74008_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000683483.1|74723_75086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534551.1|75123_78738_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_101169250.1|78865_79648_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_000255956.1|79644_80667_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_101134910.1|80733_82143_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001326396.1|82144_83185_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000811656.1|83295_84807_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_000101568.1|85093_86134_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152391.1|86350_88066_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|88175_91205_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|91311_92337_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|92333_93113_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
92915:92930	attR	GAAAGGGGCGATGATC	NA	NA	NA	NA
WP_004199234.1|93246_94128_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_101169251.1|94377_95697_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	23.9	2.4e-12
>prophage 3
NZ_CP025147	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p1, complete sequence	205953	103369	148833	205953	transposase,integrase	Salmonella_phage(21.43%)	52	122713:122728	151582:151597
WP_000935451.1|103369_105085_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|105087_106080_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000259031.1|106675_107515_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|107508_107856_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_015059044.1|108083_108638_-	aminoglycoside 6'-N-acetyltransferase AAC(6')-33	NA	NA	NA	NA	NA
WP_000381802.1|108738_109272_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_101169252.1|109417_110431_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.8	8.9e-71
WP_001162012.1|110736_111294_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_064987470.1|111296_114269_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427620.1|114347_115352_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001217881.1|115793_116351_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|116533_117394_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|117464_118169_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000993245.1|118356_118569_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|118531_118651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|118634_118871_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|118867_119233_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|119250_120936_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|120974_121400_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|121427_121703_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|121718_122084_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|122155_122611_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000139718.1|122600_123083_-	hypothetical protein	NA	NA	NA	NA	NA
122713:122728	attL	TCATCATTGATGAAAT	NA	NA	NA	NA
WP_000997323.1|123079_123949_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|123953_124964_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|124966_125503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|125801_126122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|126344_126947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|126962_127415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|127581_127917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|128175_128448_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_032413490.1|128444_132707_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.8e-23
WP_000988732.1|132839_133565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337692.1|133678_134080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|134299_134539_-	permease	NA	NA	NA	NA	NA
WP_000268337.1|134611_134890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|134876_136604_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077335.1|136781_137168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|137625_138477_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064432.1|138551_139109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|139182_139401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|139414_139684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|139676_140282_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050848.1|140353_140557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134912.1|140758_143212_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000042274.1|143299_143686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093868.1|143918_144473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058950.1|144546_145023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|145038_146664_-	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_000410925.1|146741_147044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|147121_147466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|147720_148833_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
151582:151597	attR	ATTTCATCAATGATGA	NA	NA	NA	NA
>prophage 1
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	0	8568	161986	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_101134916.1|121_745_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.0	7.4e-28
WP_003032875.1|737_2213_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|2463_2895_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|4323_5530_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|6570_8568_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 2
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	13877	27299	161986	integrase,transposase	Macacine_betaherpesvirus(37.5%)	9	3626:3642	34688:34704
3626:3642	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_004152067.1|13877_14801_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_071527918.1|14865_15177_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|15203_16151_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|17294_18035_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|18751_19762_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|20513_21680_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|21679_22651_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152715.1|25602_26874_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004178083.1|26873_27299_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
34688:34704	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
>prophage 3
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	30835	31090	161986		Pectobacterium_phage(100.0%)	1	NA	NA
WP_023157779.1|30835_31090_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	8.8e-12
>prophage 4
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	34227	38533	161986		Thalassomonas_phage(33.33%)	4	NA	NA
WP_004152645.1|34227_34791_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_004152644.1|35566_36109_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_001568055.1|36157_36406_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_023287107.1|36475_38533_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.2	3.4e-21
>prophage 5
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	42817	46418	161986		Klebsiella_phage(25.0%)	7	NA	NA
WP_004152717.1|42817_43174_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152718.1|43234_43447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|43457_43682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|43762_44083_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|44072_44351_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023287139.1|44351_44765_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023287138.1|45596_46418_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 6
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	71624	121549	161986	integrase,transposase	uncultured_Caudovirales_phage(35.0%)	41	98767:98826	113935:114311
WP_157831193.1|71624_72548_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	3.6e-172
WP_023287125.1|72670_73042_+	TraT complement resistance protein	NA	NA	NA	NA	NA
WP_017900859.1|73540_73924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287124.1|74050_76360_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_023287123.1|76359_81618_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_009309882.1|81707_82433_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_009309883.1|82587_83184_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_009309884.1|83203_83551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309885.1|84021_84666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309886.1|84721_85372_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_009309887.1|85368_85680_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.0	2.1e-15
WP_001549890.1|86176_86509_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004118521.1|86505_87228_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549888.1|87285_87714_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|87763_89047_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|89142_89496_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|89979_91458_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_004118529.1|91476_92304_+	universal stress protein	NA	NA	NA	NA	NA
WP_001549953.1|92375_93572_-	MFS transporter	NA	NA	NA	NA	NA
WP_004118534.1|94100_94475_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_011977829.1|94749_95898_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118538.1|96251_96584_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_001067855.1|96846_97551_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|97856_98561_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
98767:98826	attL	AATGGTGGTTTCGTCGGGGATGCGCTCCAGGTTCAGCCCGGCAAACTGGCGCAGGATCGT	NA	NA	NA	NA
WP_101169254.1|99399_101115_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|101224_104254_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|104360_105386_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|105382_106162_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|106293_107175_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|107424_108744_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004153729.1|109172_110000_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|109996_110860_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|110868_111696_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|111704_112715_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|112708_113578_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|114786_115767_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
113935:114311	attR	ACGATCCTGCGCCAGTTTGCCGGGCTGAACCTGGAGCGCATCCCCGACGAAACCACCATTCTCAACTTCCGCCGCTTGCTGGAGAAACACGAGCTGGCGGCCGGCATCCTCGCTGTCATCAATGGCTCTGGGCGACCGCGGCCTGTCGCTGCGCCAGGGCACCATCGTCGATGCAACGCTGATCAATGCGCCCAGTTCGACCAAGAACAAGGACGGCAAGCGCGACCCGGAAATGCACCAGACCAAGAAGGGAAACCAGTATTATTTCGGCAGTGCGACCTGAAAGTCGCATGGGTTTCTGTTCCGCAGGTTAACGCCCGACGGAACCGACTGTTCCACCACTCGTTCCCTACCCAGACAGGCGTGGCCGGTAACAG	NA	NA	NA	NA
WP_004118209.1|116968_117232_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|117246_117510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|117753_118035_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|118069_118639_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|118753_121549_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
>prophage 7
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	130994	135301	161986		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_004152101.1|130994_131345_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|131394_131757_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|131774_133526_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|133573_134863_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|134875_135301_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
>prophage 8
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	138758	139469	161986		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_085903505.1|138758_139469_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 9
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	143987	146065	161986		Bacillus_phage(100.0%)	2	NA	NA
WP_004152084.1|143987_145388_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|145384_146065_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 10
NZ_CP025148	Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence	161986	151158	158415	161986		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_004118669.1|151158_151896_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|151929_152127_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|152167_154615_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|154741_155182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|155268_158415_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
