The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025143	Klebsiella pneumoniae strain NR5632 chromosome, complete genome	5388622	114929	139688	5388622	tRNA,integrase,transposase	Escherichia_phage(23.08%)	19	130828:130845	142337:142354
WP_032434432.1|114929_115619_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_004150214.1|115623_117744_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|117762_118038_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002922664.1|118092_118716_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_032434430.1|118974_120651_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	24.0	1.3e-23
WP_002922654.1|120656_121274_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032434427.1|121549_122800_+	chloride channel protein	NA	NA	NA	NA	NA
WP_032434425.1|122855_123914_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	33.5	1.4e-18
WP_000608644.1|124433_125696_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|125951_126827_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|126873_127206_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|130084_130789_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
130828:130845	attL	TTTGCAACAGTGCCTCTC	NA	NA	NA	NA
WP_001288432.1|131107_132541_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_101140099.1|132782_133990_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	59.6	9.2e-91
WP_001389365.1|135401_136166_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|136308_136575_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|136795_137269_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_101140061.1|137424_138438_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.9	4.1e-68
WP_001067855.1|138983_139688_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
142337:142354	attR	GAGAGGCACTGTTGCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP025143	Klebsiella pneumoniae strain NR5632 chromosome, complete genome	5388622	494264	527701	5388622	terminase,integrase,tail,capsid,protease,head,portal,tRNA	uncultured_Caudovirales_phage(73.33%)	33	512051:512068	528046:528063
WP_004150007.1|494264_495212_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004150006.1|495226_495736_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.5	4.4e-18
WP_032434585.1|495864_496989_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|496960_497434_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|497460_498003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|498007_498580_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|498583_499402_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|499398_499656_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|499631_500186_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|506160_506382_-	membrane protein	NA	NA	NA	NA	NA
WP_004144975.1|506674_509785_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_004144974.1|509797_510937_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016947472.1|511315_511969_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
512051:512068	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|512241_513468_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|513560_514502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|514683_514968_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|514978_515758_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|516209_516479_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|516471_516660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|516652_516967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|516963_517332_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|517328_517694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|517693_519829_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|520171_520507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|520555_521068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|521331_522498_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|522549_523110_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|523111_524353_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|524349_524685_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|524681_524981_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|524980_525424_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|525699_526056_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|526039_527701_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
528046:528063	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 3
NZ_CP025143	Klebsiella pneumoniae strain NR5632 chromosome, complete genome	5388622	1284025	1331493	5388622	terminase,integrase,tail,coat,holin	Salmonella_phage(20.41%)	59	1283915:1283929	1293228:1293242
1283915:1283929	attL	TACAGTCAACCTAAG	NA	NA	NA	NA
WP_023301229.1|1284025_1285255_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
WP_023301228.1|1285232_1285508_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_071557557.1|1285546_1285786_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_101134779.1|1285793_1286102_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	9.3e-24
WP_101134887.1|1286098_1286809_-	hypothetical protein	NA	Q71T76	Escherichia_phage	62.8	6.0e-74
WP_101134780.1|1286852_1287941_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.2	1.4e-106
WP_101134781.1|1287954_1291056_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	58.2	1.2e-296
WP_016946289.1|1291193_1291349_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_004179600.1|1291357_1291549_-	YebW family protein	NA	NA	NA	NA	NA
WP_101134782.1|1292033_1292237_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.8e-20
WP_032438209.1|1292265_1292676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134783.1|1292802_1293186_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	83.5	2.0e-52
WP_023282398.1|1293284_1293503_+	hypothetical protein	NA	K7PKS2	Enterobacteria_phage	64.8	8.9e-21
1293228:1293242	attR	CTTAGGTTGACTGTA	NA	NA	NA	NA
WP_101134784.1|1293505_1294042_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.9	7.2e-64
WP_071785976.1|1294129_1294318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064179420.1|1294332_1295241_+	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_023286279.1|1295243_1295993_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	2.2e-119
WP_023286280.1|1296000_1296336_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_101134785.1|1296328_1297114_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	1.6e-64
WP_101134786.1|1297241_1297805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101134787.1|1297801_1298446_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	78.9	1.8e-109
WP_101134788.1|1298442_1298874_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	47.2	2.2e-10
WP_101134789.1|1299046_1299943_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	91.4	2.2e-28
WP_040241897.1|1300221_1300449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|1300824_1301058_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_071557491.1|1301162_1301411_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_101134790.1|1301445_1302042_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_004892208.1|1302250_1302547_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_023282412.1|1302543_1302900_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023287514.1|1303015_1303837_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_024940884.1|1304092_1304392_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_064179041.1|1304388_1304928_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_023313049.1|1304924_1305272_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	1.2e-40
WP_101134792.1|1305268_1305544_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.7	5.2e-10
WP_072071795.1|1305682_1306099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073545918.1|1306423_1306660_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	62.8	3.8e-17
WP_101134793.1|1306910_1307915_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.3	2.3e-34
WP_064179047.1|1307892_1309197_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	1.7e-146
WP_064179048.1|1309201_1310626_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	70.9	2.9e-192
WP_101134794.1|1310609_1311722_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.6	5.3e-109
WP_101134795.1|1311825_1312590_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.8	8.7e-79
WP_048997557.1|1312677_1313814_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.6	1.3e-155
WP_101134796.1|1313863_1314148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048271645.1|1314151_1314562_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	6.6e-09
WP_065520084.1|1314563_1314947_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	6.0e-20
WP_008807839.1|1314948_1315500_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_004146196.1|1315496_1315889_+	hypothetical protein	NA	M4SMU9	Cyanophage	30.9	7.3e-05
WP_101134797.1|1315912_1317085_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	26.6	2.1e-23
WP_043906941.1|1317139_1317622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157829711.1|1317759_1317957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906942.1|1318133_1318664_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
WP_050486020.1|1318745_1319243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602982.1|1319288_1319651_+	membrane protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
WP_101134798.1|1319746_1323316_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	31.4	1.1e-83
WP_023313121.1|1323315_1323789_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.6	8.6e-61
WP_101134799.1|1323775_1324258_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	97.5	1.3e-83
WP_017880229.1|1324267_1324648_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_101134800.1|1324644_1327713_+	kinase	NA	A0A286S259	Klebsiella_phage	97.6	0.0e+00
WP_101134803.1|1330398_1331493_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	88.7	3.0e-181
>prophage 4
NZ_CP025143	Klebsiella pneumoniae strain NR5632 chromosome, complete genome	5388622	1522774	1620269	5388622	terminase,integrase,tail,capsid,protease,head,portal,holin,tRNA,plate	Escherichia_phage(20.83%)	95	1557983:1558007	1597516:1597540
WP_101134808.1|1522774_1524124_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025368033.1|1524120_1524810_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032434868.1|1524809_1526486_+	OmpA family protein	NA	NA	NA	NA	NA
WP_025368035.1|1526488_1526980_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_107318634.1|1527210_1527375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434870.1|1527400_1529758_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_071994657.1|1529767_1530310_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_032425140.1|1530383_1530854_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_077254137.1|1531196_1533599_+	glycoside hydrolase family 104 protein	NA	NA	NA	NA	NA
WP_032434872.1|1533595_1534039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886200.1|1534199_1534580_+	DUF4087 domain-containing protein	NA	NA	NA	NA	NA
WP_123618670.1|1535051_1535480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368039.1|1535696_1535996_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_032435675.1|1536058_1536322_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
WP_032425487.1|1536324_1537533_+	membrane protein	NA	NA	NA	NA	NA
WP_032434874.1|1537525_1540897_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_153582916.1|1540899_1541049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434876.1|1541389_1542997_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_025368043.1|1543030_1544800_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032425136.1|1544763_1545846_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032425135.1|1545881_1546406_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_101134809.1|1546410_1548732_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.7e-14
WP_050484908.1|1548728_1549232_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.0	1.5e-18
WP_023317120.1|1549225_1549570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086472102.1|1549602_1550340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049107563.1|1550582_1551065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434878.1|1552948_1553833_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_050598595.1|1553822_1554380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071838925.1|1554887_1555286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123618669.1|1556074_1556524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050598596.1|1556520_1557054_+	hypothetical protein	NA	NA	NA	NA	NA
1557983:1558007	attL	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_032434882.1|1558201_1559371_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
WP_123618668.1|1559475_1560318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254126.1|1560419_1560620_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	60.0	1.8e-12
WP_004864289.1|1561427_1561943_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_021314787.1|1562318_1563395_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.4	2.8e-147
WP_032434886.1|1563522_1564308_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.9e-61
WP_024623196.1|1564307_1564607_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
WP_000690183.1|1565235_1565931_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
WP_001191665.1|1566028_1566271_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_101134810.1|1566305_1566767_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	89.7	2.3e-58
WP_001208720.1|1567004_1567184_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_017880208.1|1567173_1568127_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
WP_101134811.1|1568123_1568933_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	5.5e-108
WP_000779146.1|1568942_1569320_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_032434890.1|1569332_1570313_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.6e-136
WP_004899672.1|1570326_1570905_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_032412064.1|1571124_1571550_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.7	1.9e-59
WP_032434891.1|1571546_1571702_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	2.5e-09
WP_017145563.1|1572200_1572596_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1572582_1572864_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_032434894.1|1572863_1573493_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	1.2e-105
WP_032434896.1|1573500_1573776_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	1.9e-23
WP_032434899.1|1573977_1574637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032434901.1|1574836_1575187_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.7	3.4e-46
WP_032434902.1|1575345_1575843_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
WP_000246643.1|1575846_1577598_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	6.7e-252
WP_032434905.1|1577745_1578972_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_032434907.1|1578964_1579564_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	1.0e-90
WP_004104235.1|1579573_1580812_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_023316722.1|1580889_1581207_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
WP_031592512.1|1581215_1581554_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	3.3e-38
WP_019705270.1|1581550_1582000_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_023302599.1|1581996_1582344_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_032412035.1|1582400_1583105_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
WP_032434909.1|1583135_1583540_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	1.9e-32
WP_016530183.1|1583542_1583848_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|1583921_1584155_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032434911.1|1584216_1587603_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	4.0e-301
WP_004884312.1|1587624_1588098_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_023302606.1|1588084_1588561_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
WP_032434913.1|1588573_1588954_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.0e-60
WP_032434915.1|1588950_1592028_+	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
WP_032434917.1|1594712_1595807_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.5	1.4e-178
WP_032434919.1|1595841_1596930_-	acyltransferase	NA	C6ZR20	Salmonella_phage	27.2	1.8e-05
WP_004149224.1|1597628_1598558_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1597516:1597540	attR	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_002913362.1|1598847_1599609_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149222.1|1599670_1600999_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913359.1|1601366_1601651_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_032434923.1|1601810_1603121_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_032434925.1|1603120_1605265_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913355.1|1605474_1605960_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002913348.1|1605980_1606532_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913346.1|1606699_1607632_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913342.1|1607673_1608759_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_004174960.1|1608761_1609586_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913340.1|1609585_1610395_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913339.1|1610394_1610943_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913338.1|1610974_1611256_+	YfcL family protein	NA	NA	NA	NA	NA
WP_032435686.1|1611317_1613306_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|1613464_1614685_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004149211.1|1614894_1616070_+	MFS transporter	NA	NA	NA	NA	NA
WP_002913228.1|1617243_1618380_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_002913227.1|1618443_1619457_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015958766.1|1619456_1620269_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP025143	Klebsiella pneumoniae strain NR5632 chromosome, complete genome	5388622	1819190	1826095	5388622	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1819190_1820054_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1820064_1820838_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1821078_1821972_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1822217_1823579_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1823897_1824620_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_032434977.1|1824616_1826095_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 6
NZ_CP025143	Klebsiella pneumoniae strain NR5632 chromosome, complete genome	5388622	1980112	2032938	5388622	terminase,integrase,head,holin,tRNA	Enterobacteria_phage(25.0%)	68	1986508:1986530	2033477:2033499
WP_004151452.1|1980112_1981846_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|1982081_1982651_+	VOC family protein	NA	NA	NA	NA	NA
WP_002911488.1|1982727_1983471_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_032435025.1|1983552_1984557_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|1984553_1985297_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|1985336_1985732_-	membrane protein	NA	NA	NA	NA	NA
WP_096991418.1|1985784_1986558_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
1986508:1986530	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_101134814.1|1986560_1987820_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	90.4	3.0e-225
WP_023283988.1|1987862_1988108_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
WP_101134815.1|1988111_1988306_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	53.6	2.6e-11
WP_101134816.1|1988302_1988809_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	43.9	3.5e-36
WP_101134817.1|1989024_1989552_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	4.9e-57
WP_072044372.1|1989548_1989707_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	1.9e-09
WP_049186040.1|1989703_1990384_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	4.6e-124
WP_101134818.1|1990380_1991226_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_085841924.1|1991241_1991526_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	4.4e-28
WP_019725103.1|1991614_1991809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134819.1|1992457_1993294_-	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	29.5	2.1e-25
WP_004197930.1|1993256_1993436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134820.1|1993557_1994256_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.2	2.0e-106
WP_004201115.1|1994367_1994595_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004141720.1|1994634_1994955_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_101134821.1|1995283_1996144_+	replication protein	NA	K7PGT1	Enterobacteria_phage	52.2	3.9e-59
WP_101134822.1|1996140_1996989_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	3.0e-88
WP_004151295.1|1996985_1997279_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_101134823.1|1997275_1997821_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.2	5.7e-08
WP_101134824.1|1997817_1998567_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_101134889.1|1999662_1999878_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	64.3	5.0e-08
WP_101134825.1|1999874_2000420_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	67.7	1.0e-20
WP_016831923.1|2000409_2000634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101134826.1|2000885_2001341_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	3.4e-54
WP_023342724.1|2001340_2001511_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_101134827.1|2001503_2002142_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	70.3	3.4e-76
WP_101134828.1|2002138_2002780_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	8.4e-35
WP_023342726.1|2002776_2002917_+	YlcG family protein	NA	NA	NA	NA	NA
WP_101134829.1|2002913_2003603_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.2	4.5e-58
WP_019704119.1|2004448_2004673_+|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_019704120.1|2004650_2005145_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	95.1	1.7e-88
WP_020804394.1|2005141_2005492_+	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	5.8e-14
WP_065242184.1|2006723_2007350_+	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	1.1e-103
WP_065242183.1|2007380_2007848_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_065242182.1|2007831_2009130_+|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.1	1.5e-240
WP_065242181.1|2009142_2010612_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	55.9	9.9e-148
WP_065242180.1|2010538_2011534_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.2	8.0e-117
WP_112113408.1|2011580_2011883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803626.1|2011954_2013340_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.5	6.9e-167
WP_004178846.1|2013343_2013775_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
WP_004178847.1|2013786_2014884_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	4.2e-151
WP_020803627.1|2014893_2015151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040229589.1|2015153_2015534_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	1.2e-28
WP_032752624.1|2015533_2015707_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_032425728.1|2015706_2016069_+	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	45.0	3.1e-18
WP_020804116.1|2016071_2016440_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	79.5	4.7e-46
WP_020804115.1|2016436_2016820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065242179.1|2016877_2017642_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.4	4.2e-41
WP_065242178.1|2017710_2018424_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.1	9.6e-64
WP_020804850.1|2018642_2019398_+	KilA-N domain protein	NA	K7PH30	Enterobacteria_phage	50.0	2.8e-61
WP_020804851.1|2019400_2019655_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	72.3	2.3e-20
WP_023328739.1|2020075_2020396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556004.1|2020447_2020765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032426034.1|2021187_2021601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804808.1|2021660_2025026_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	75.0	0.0e+00
WP_032426035.1|2025025_2025271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087588165.1|2025370_2025790_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	6.3e-31
WP_038421573.1|2025789_2026260_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	3.3e-28
WP_065242176.1|2026256_2026652_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	2.3e-35
WP_087588163.1|2026638_2029116_+	MoaD/ThiS family protein	NA	R9TR21	Aeromonas_phage	47.0	2.3e-197
WP_101134803.1|2031843_2032938_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	88.7	3.0e-181
2033477:2033499	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
>prophage 7
NZ_CP025143	Klebsiella pneumoniae strain NR5632 chromosome, complete genome	5388622	2840643	2851530	5388622		Escherichia_phage(87.5%)	9	NA	NA
WP_020805006.1|2840643_2843751_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2843805_2845071_+	MFS transporter	NA	NA	NA	NA	NA
WP_020805010.1|2845101_2846190_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
WP_004176262.1|2846276_2846537_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|2846834_2847695_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|2847715_2848477_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2848737_2849640_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|2849651_2850917_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|2850909_2851530_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP025143	Klebsiella pneumoniae strain NR5632 chromosome, complete genome	5388622	3520153	3529627	5388622	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3520153_3521875_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3521919_3522621_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3522974_3523193_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3523323_3525603_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3525633_3525951_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3526276_3526498_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_025368306.1|3526574_3528515_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_002896440.1|3528511_3529627_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP025144	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p1, complete sequence	204123	5370	38365	204123	plate,tail,holin,portal,integrase,capsid,head,terminase,lysis	Escherichia_phage(65.85%)	44	35348:35363	39300:39315
WP_000268395.1|5370_6309_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_000435224.1|6425_6971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001256128.1|6973_7543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004673.1|7554_8118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468308.1|8297_8516_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_032413567.1|8597_9761_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
WP_032413566.1|9760_10240_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_032413565.1|10254_12702_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|12694_12814_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001461862.1|12846_13122_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
WP_001251408.1|13178_13697_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286737.1|13709_14900_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_001322808.1|14959_15559_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	3.4e-102
WP_064987487.1|15583_16129_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	59.1	4.8e-55
WP_001030526.1|16128_16731_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	2.9e-93
WP_001106830.1|16702_17143_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.0	1.5e-54
WP_064987486.1|17164_18343_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.3	2.9e-158
WP_001285340.1|18339_18951_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_064987485.1|18943_19852_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.3	5.7e-162
WP_000127164.1|19856_20204_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_032413562.1|20200_20836_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	3.2e-111
WP_032413561.1|20902_21355_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	2.6e-75
WP_032413560.1|21347_21815_-|tail	phage tail protein	tail	A0A0F7LDF5	Escherichia_phage	97.4	6.9e-79
WP_000040630.1|21922_22348_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	2.3e-65
WP_021563761.1|22335_22761_-	hypothetical protein	NA	M1SV74	Escherichia_phage	97.9	1.2e-58
WP_001144101.1|22775_23273_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|23272_23554_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|23557_23761_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_032413559.1|23760_24270_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_032413558.1|24369_25113_-|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.2	6.0e-125
WP_001248583.1|25116_26190_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001607695.1|26248_27103_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
WP_032413555.1|27276_29049_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.3	0.0e+00
WP_032413553.1|29048_30083_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	1.6e-200
WP_000725496.1|30477_32022_+	RNA-directed DNA polymerase	NA	A0A0F7LCK9	Escherichia_phage	99.0	4.7e-289
WP_032413551.1|32509_34786_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	99.5	0.0e+00
WP_000027673.1|34775_35051_-	hypothetical protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113264.1|35047_35272_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|35274_35574_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
35348:35363	attL	AGTTCATCCACTGAGG	NA	NA	NA	NA
WP_000557703.1|35573_35798_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|35861_36362_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001081582.1|36539_36815_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|36936_37236_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|37351_38365_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
39300:39315	attR	AGTTCATCCACTGAGG	NA	NA	NA	NA
>prophage 2
NZ_CP025144	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p1, complete sequence	204123	50093	93132	204123	integrase,transposase	Escherichia_phage(46.15%)	42	58341:58356	87463:87478
WP_012569499.1|50093_51074_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_001167032.1|51382_52240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972663.1|52226_52457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210758.1|52456_52975_-	nitrite reductase	NA	NA	NA	NA	NA
WP_000919345.1|52971_53418_-	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000422768.1|53417_53777_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000591074.1|53833_54262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139698.1|54295_55156_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001326179.1|55171_56149_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
WP_000539392.1|56130_56985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902149.1|56989_57304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326180.1|57293_57737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805800.1|57863_58385_-	hypothetical protein	NA	NA	NA	NA	NA
58341:58356	attL	GAAAGGGGCGATGATC	NA	NA	NA	NA
WP_077264454.1|58387_58849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000849071.1|58913_59522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946102.1|59790_60906_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
WP_000883925.1|60923_61358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350011.1|62394_63495_-	plasmid replication protein	NA	NA	NA	NA	NA
WP_000375812.1|63771_64338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|64809_65793_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000919078.1|65809_66103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|66104_66524_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001020646.1|66583_67135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891157.1|67131_67740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790610.1|67750_68284_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000356489.1|68283_68556_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000683483.1|69271_69634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534551.1|69671_73286_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001317493.1|73413_74196_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|74192_75215_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_101134910.1|75281_76691_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001326396.1|76692_77733_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000811656.1|77843_79355_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_000101568.1|79641_80682_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152391.1|80898_82614_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|82723_85753_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_101140100.1|85859_86885_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.0	4.4e-86
WP_101140101.1|86881_87661_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	4.2e-89
87463:87478	attR	GAAAGGGGCGATGATC	NA	NA	NA	NA
WP_101140102.1|87792_88674_+	inhibitor-resistant carbapenem-hydrolyzing class A beta-lactamase KPC-33	NA	A0A1B0VBP7	Salmonella_phage	51.8	1.8e-72
WP_004152397.1|88923_90243_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_032413577.1|90587_91466_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_101140103.1|92127_93132_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP025144	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p1, complete sequence	204123	97915	143379	204123	integrase,transposase	Salmonella_phage(21.43%)	51	99504:99518	128146:128160
WP_000935451.1|97915_99631_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
99504:99518	attL	ATCGCCGCCAGCACC	NA	NA	NA	NA
WP_001381192.1|99633_100626_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000259031.1|101221_102061_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|102054_102402_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_015059044.1|102629_103184_-	aminoglycoside 6'-N-acetyltransferase AAC(6')-33	NA	NA	NA	NA	NA
WP_000381802.1|103284_103818_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000845039.1|103963_104977_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|105282_105840_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_064987470.1|105842_108815_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_001217881.1|110339_110897_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|111079_111940_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|112010_112715_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000993245.1|112902_113115_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|113077_113197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|113180_113417_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|113413_113779_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|113796_115482_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|115520_115946_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|115973_116249_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|116264_116630_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|116701_117157_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000139718.1|117146_117629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997323.1|117625_118495_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|118499_119510_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|119512_120049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|120347_120668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|120890_121493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|121508_121961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|122127_122463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|122721_122994_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_032413490.1|122990_127253_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.8e-23
WP_000988732.1|127385_128111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337692.1|128224_128626_-	hypothetical protein	NA	NA	NA	NA	NA
128146:128160	attR	ATCGCCGCCAGCACC	NA	NA	NA	NA
WP_000714162.1|128845_129085_-	permease	NA	NA	NA	NA	NA
WP_000268337.1|129157_129436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|129422_131150_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077335.1|131327_131714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|132171_133023_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064432.1|133097_133655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|133728_133947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|133960_134230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|134222_134828_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050848.1|134899_135103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134912.1|135304_137758_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000042274.1|137845_138232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093868.1|138464_139019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058950.1|139092_139569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|139584_141210_-	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_000410925.1|141287_141590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|141667_142012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|142266_143379_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	0	5496	149158	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_085955172.1|1251_2458_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|3498_5496_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 2
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	10805	28018	149158	integrase,transposase	Macacine_betaherpesvirus(30.0%)	13	3179:3193	23207:23221
3179:3193	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_004152067.1|10805_11729_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_071527918.1|11793_12105_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|12131_13079_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|14222_14963_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|15679_16690_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|17441_18608_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|18607_19579_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_101140106.1|22530_23802_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	2.8e-154
23207:23221	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178083.1|23801_24227_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152765.1|24632_26117_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|26350_26581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|27101_27527_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|27763_28018_+	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
>prophage 3
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	31155	35461	149158		Thalassomonas_phage(33.33%)	4	NA	NA
WP_004152645.1|31155_31719_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_004152644.1|32494_33037_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_001568055.1|33085_33334_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_023287107.1|33403_35461_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.2	3.4e-21
>prophage 4
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	39745	43346	149158		Klebsiella_phage(25.0%)	7	NA	NA
WP_004152717.1|39745_40102_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152718.1|40162_40375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|40385_40610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|40690_41011_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|41000_41279_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023287139.1|41279_41693_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023287138.1|42524_43346_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 5
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	68552	110854	149158	protease,transposase	uncultured_Caudovirales_phage(43.75%)	38	NA	NA
WP_101140107.1|68552_69521_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	1.2e-178
WP_023287125.1|69598_69970_+	TraT complement resistance protein	NA	NA	NA	NA	NA
WP_017900859.1|70468_70852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287124.1|70978_73288_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_023287123.1|73287_78546_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_009309882.1|78635_79361_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_009309883.1|79515_80112_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_009309884.1|80131_80479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309885.1|80949_81594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309886.1|81649_82300_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_009309887.1|82296_82608_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.0	2.1e-15
WP_001549890.1|83104_83437_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004118521.1|83433_84156_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549888.1|84213_84642_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|84691_85975_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|86070_86424_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|86907_88386_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_004118529.1|88404_89232_+	universal stress protein	NA	NA	NA	NA	NA
WP_001549953.1|89303_90500_-	MFS transporter	NA	NA	NA	NA	NA
WP_004118534.1|91028_91403_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_011977829.1|91677_92826_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118538.1|93179_93512_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_001067855.1|93774_94479_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|94784_95489_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|96344_97172_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|97168_98032_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|98040_98868_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|98876_99887_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|99880_100750_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|101958_102939_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|104140_104404_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|104418_104682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|104925_105207_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|105241_105811_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|105925_108721_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|108720_108918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|109155_109905_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|109891_110854_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	118166	122473	149158		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_004152101.1|118166_118517_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|118566_118929_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|118946_120698_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|120745_122035_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|122047_122473_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
>prophage 7
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	125930	126641	149158		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_085903505.1|125930_126641_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 8
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	131159	133237	149158		Bacillus_phage(100.0%)	2	NA	NA
WP_004152084.1|131159_132560_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|132556_133237_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 9
NZ_CP025145	Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence	149158	138330	145587	149158		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_004118669.1|138330_139068_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|139101_139299_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|139339_141787_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|141913_142354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|142440_145587_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
