The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025119	Polaribacter sp. ALD11 chromosome, complete genome	3567309	1227097	1277666	3567309	integrase,transposase	Acinetobacter_phage(28.57%)	42	1214274:1214306	1230980:1231012
1214274:1214306	attL	ACTCAAACGCTGAAAAACCAAAATTGCGGAATT	NA	NA	NA	NA
WP_100947638.1|1227097_1228315_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.0	1.8e-14
WP_100945790.1|1229532_1229724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157812194.1|1229925_1230075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945792.1|1231420_1232107_+	hypothetical protein	NA	NA	NA	NA	NA
1230980:1231012	attR	ACTCAAACGCTGAAAAACCAAAATTGCGGAATT	NA	NA	NA	NA
WP_100945793.1|1232290_1232827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945794.1|1232833_1233661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157812195.1|1234337_1235384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945796.1|1236139_1236892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945797.1|1236910_1237492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026450520.1|1238197_1238602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945798.1|1238786_1239464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945799.1|1240200_1240773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100947639.1|1241556_1242177_+	DUF4240 domain-containing protein	NA	NA	NA	NA	NA
WP_068452251.1|1245160_1245712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945800.1|1246528_1247068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945801.1|1247304_1248015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945802.1|1249872_1250511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945804.1|1250838_1251162_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157812196.1|1251163_1253629_+	N-6 DNA methylase	NA	P95687	Staphylococcus_phage	29.5	1.4e-45
WP_100945805.1|1255464_1255749_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100945806.1|1255938_1256310_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157812245.1|1256309_1257161_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	34.3	8.3e-30
WP_100945808.1|1257291_1257918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945809.1|1257914_1258631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945810.1|1259381_1260476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945811.1|1260624_1261446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058885311.1|1263002_1263299_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	35.6	3.5e-12
WP_100945812.1|1263314_1263692_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	52.1	2.2e-22
WP_100945813.1|1263876_1264983_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	26.7	1.9e-05
WP_100945814.1|1266808_1267792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945815.1|1268511_1268964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945816.1|1268953_1269604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945817.1|1269758_1270790_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100945294.1|1270976_1271348_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157812244.1|1271347_1272223_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.9	7.7e-31
WP_100945818.1|1272281_1272821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945819.1|1272852_1273062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157812197.1|1273889_1274192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945821.1|1274191_1274683_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_100947640.1|1274858_1275485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100945822.1|1275621_1277106_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_100945806.1|1277294_1277666_+|transposase	transposase	transposase	NA	NA	NA	NA
