The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025113	Bradyrhizobium sp. SK17 strain CBNU chromosome, complete genome	8003090	1773179	1783489	8003090	integrase	uncultured_Mediterranean_phage(100.0%)	11	1772788:1772808	1783966:1783986
1772788:1772808	attL	CCGCAGCGCAGCGGAGGATGG	NA	NA	NA	NA
WP_100951625.1|1773179_1774187_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	32.6	3.5e-11
WP_168226283.1|1774183_1775098_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_100951626.1|1775091_1776318_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_100951627.1|1776410_1776623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100951628.1|1776707_1777010_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_100956146.1|1777137_1777251_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_043854942.1|1777406_1777703_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_063928869.1|1778181_1778658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043854944.1|1778626_1780513_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_157817097.1|1780515_1782396_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_043854945.1|1782328_1783489_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1783966:1783986	attR	CCGCAGCGCAGCGGAGGATGG	NA	NA	NA	NA
>prophage 2
NZ_CP025113	Bradyrhizobium sp. SK17 strain CBNU chromosome, complete genome	8003090	3877561	3886903	8003090		Escherichia_phage(42.86%)	8	NA	NA
WP_100952810.1|3877561_3878308_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.8	2.0e-11
WP_024579370.1|3878291_3878996_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	5.8e-13
WP_100952812.1|3879371_3880028_-	aldolase	NA	A0A077SK32	Escherichia_phage	48.3	7.5e-47
WP_100952814.1|3880143_3881055_+	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	48.5	9.1e-67
WP_100952816.1|3881067_3881850_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_100952818.1|3881846_3883136_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	41.0	2.7e-72
WP_024579375.1|3883307_3884999_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	4.4e-06
WP_100952820.1|3885196_3886903_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.8	3.2e-12
>prophage 3
NZ_CP025113	Bradyrhizobium sp. SK17 strain CBNU chromosome, complete genome	8003090	4131235	4138297	8003090		Enterobacteria_phage(50.0%)	7	NA	NA
WP_100953091.1|4131235_4132480_+	glycosyltransferase family 92 protein	NA	A0A1V0SD50	Indivirus	27.0	1.2e-13
WP_100956496.1|4132587_4133142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024579583.1|4133322_4134390_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.0	7.3e-92
WP_100953093.1|4134379_4135291_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.7	5.5e-96
WP_024579585.1|4135399_4135954_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.1	5.7e-48
WP_100953095.1|4135953_4136865_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.3e-28
WP_100953097.1|4136989_4138297_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.8	3.8e-82
>prophage 4
NZ_CP025113	Bradyrhizobium sp. SK17 strain CBNU chromosome, complete genome	8003090	5177586	5186694	8003090	tRNA	uncultured_Mediterranean_phage(100.0%)	11	NA	NA
WP_100954067.1|5177586_5178609_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	41.2	1.1e-23
WP_024578320.1|5178605_5179427_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.6	1.8e-29
WP_100954069.1|5179449_5180352_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	50.9	1.1e-43
WP_021081213.1|5180500_5180734_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	63.6	4.2e-08
WP_100954071.1|5180910_5181441_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_024578317.1|5181437_5182238_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	51.6	2.4e-55
WP_100954073.1|5182429_5183761_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.9	1.4e-100
WP_100954075.1|5183777_5184371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100954077.1|5184434_5185202_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	36.6	4.8e-37
WP_100954079.1|5185295_5185673_-	response regulator	NA	NA	NA	NA	NA
WP_100956620.1|5186076_5186694_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	1.8e-29
>prophage 5
NZ_CP025113	Bradyrhizobium sp. SK17 strain CBNU chromosome, complete genome	8003090	6853082	6860517	8003090		Tupanvirus(33.33%)	6	NA	NA
WP_100955339.1|6853082_6854387_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	26.9	1.6e-24
WP_100955340.1|6854573_6855623_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.4	9.5e-52
WP_100955341.1|6855622_6856681_-	NAD-dependent epimerase/dehydratase family protein	NA	M1I5F1	Acanthocystis_turfacea_Chlorella_virus	27.1	7.4e-28
WP_100955342.1|6856683_6857616_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	27.4	2.5e-19
WP_100955343.1|6857629_6858577_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.1	6.2e-18
WP_100955344.1|6858600_6860517_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	28.6	2.5e-26
>prophage 1
NZ_CP025114	Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence	285478	11354	35348	285478	integrase,transposase	Leptospira_phage(66.67%)	21	27268:27290	33833:33855
WP_100957021.1|11354_12302_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	24.0	1.1e-09
WP_100957023.1|12422_14141_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_100957025.1|14302_14644_+	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_100957027.1|14640_15144_+	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_100957029.1|15163_16066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100957031.1|16261_16450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100957021.1|16728_17676_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	24.0	1.1e-09
WP_100957033.1|17963_18446_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100957035.1|18540_18990_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_100957037.1|19005_19305_+	mercury transporter	NA	NA	NA	NA	NA
WP_100957039.1|19557_20991_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	3.0e-40
WP_100957041.1|21020_21797_+	mercuric reductase	NA	NA	NA	NA	NA
WP_157817360.1|21844_22273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100957045.1|22280_24179_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_100957047.1|24182_26027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100957251.1|26013_27174_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
27268:27290	attL	CGGAGCGCCTTCGGCGCGAGTCT	NA	NA	NA	NA
WP_063928869.1|28414_28891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043854944.1|28859_30746_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_157817097.1|30748_32629_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_043854945.1|32561_33722_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024585279.1|34313_35348_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
33833:33855	attR	CGGAGCGCCTTCGGCGCGAGTCT	NA	NA	NA	NA
>prophage 2
NZ_CP025114	Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence	285478	191052	231110	285478	transposase	Leptospira_phage(25.0%)	34	NA	NA
WP_100554962.1|191052_192194_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	6.5e-38
WP_100554963.1|192944_193784_-	universal stress protein	NA	NA	NA	NA	NA
WP_145987136.1|193854_194493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100957189.1|194509_197665_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_080890809.1|197668_198820_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_043854939.1|198915_199551_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024585216.1|200320_201145_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_019200212.1|202021_202651_-	carbon monoxide dehydrogenase subunit G	NA	NA	NA	NA	NA
WP_019200213.1|202650_203493_-	XdhC family protein	NA	NA	NA	NA	NA
WP_019200214.1|203497_204703_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_019200215.1|204704_205592_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_024585215.1|205743_208173_-	carbon-monoxide dehydrogenase large subunit	NA	NA	NA	NA	NA
WP_019200217.1|208169_208670_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.7	6.2e-17
WP_019200218.1|208691_209558_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_019200219.1|209728_210937_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080890817.1|211060_211642_-	ParA family protein	NA	NA	NA	NA	NA
WP_100957191.1|212328_213564_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_151650824.1|214757_215885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145987137.1|215836_216367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024585213.1|216473_216746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157817366.1|216886_217738_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_024585211.1|218143_219214_-	maleylacetate reductase	NA	NA	NA	NA	NA
WP_024585210.1|219227_219806_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157817367.1|219941_220787_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_024585208.1|220806_221358_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_024585207.1|221354_222683_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_029880289.1|222723_223764_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024585205.1|223814_224543_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_024585204.1|224539_225166_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_024585203.1|225251_226430_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
WP_024585202.1|226516_227629_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_051404400.1|227709_227949_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157817368.1|228697_229360_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	28.7	3.2e-05
WP_100957199.1|229571_231110_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.3	1.5e-125
