The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019383	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC50 chromosome, complete genome	4673894	1414920	1420973	4673894		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1414920_1415088_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1415103_1415247_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1416236_1418159_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1418176_1418431_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1418399_1418789_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1420031_1420973_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP019383	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC50 chromosome, complete genome	4673894	1650708	1659879	4673894	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1650708_1651656_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1651639_1652371_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1652351_1652459_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1652518_1653250_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1653472_1655158_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1655154_1655874_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1655920_1656388_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1656444_1656975_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1657146_1657605_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1657845_1659879_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP019383	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC50 chromosome, complete genome	4673894	1727077	1737584	4673894		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1727077_1728481_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1728658_1729552_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1729928_1731014_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1731013_1731913_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1731960_1732839_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1732839_1733391_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_066038535.1|1733396_1734371_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1734386_1735160_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1735164_1736244_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1736270_1737584_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP019383	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC50 chromosome, complete genome	4673894	1844579	1898003	4673894	terminase,head,transposase,protease,tail,portal,holin,plate,capsid,integrase	Salmonella_phage(76.36%)	65	1853408:1853422	1901598:1901612
WP_001127942.1|1844579_1846418_+|tail	tail fiber protein	tail	I1TR70	Cronobacter_phage	49.0	1.0e-32
WP_000028416.1|1846991_1847873_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_000072670.1|1848283_1848847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001084817.1|1849208_1849706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042271.1|1850184_1850436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001680077.1|1850507_1851782_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_000598920.1|1853107_1853905_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1853408:1853422	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1854196_1855186_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1855187_1855415_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061370.1|1855454_1856024_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1856020_1856884_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1856880_1857174_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1857445_1857805_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1857801_1858317_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1858313_1858544_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1858614_1859154_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1859248_1860166_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|1860735_1860987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1861062_1861248_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1861453_1862149_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|1862246_1862471_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1862499_1863054_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1863050_1864208_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1864204_1864429_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1864425_1865400_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1865396_1865870_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1865866_1866748_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1866756_1867146_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1867162_1868023_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1868030_1869020_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1869033_1869786_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1869835_1870909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1870921_1871494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1871582_1871972_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1871958_1872240_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1872239_1872857_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1872853_1873393_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1873416_1873767_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1873913_1874351_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|1874350_1876081_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000838395.1|1876077_1876236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905357.1|1876352_1877447_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1877439_1878042_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1878051_1879281_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1879360_1879684_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1879680_1880085_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1880056_1880569_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1880565_1881126_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1881129_1881294_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1881283_1882780_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1882779_1883136_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1883132_1883459_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1883543_1885472_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1885505_1886846_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1886842_1887901_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1887900_1888434_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1888438_1888852_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001699732.1|1888844_1889924_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_001207832.1|1889926_1890514_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1890500_1892063_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_015701331.1|1892032_1892632_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|1892916_1893924_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1894136_1894358_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1895700_1896519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1896980_1898003_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1901598:1901612	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP019383	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC50 chromosome, complete genome	4673894	2430031	2445975	4673894	holin,tRNA	Escherichia_phage(64.71%)	23	NA	NA
WP_001082296.1|2430031_2430466_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2430515_2430854_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000729249.1|2431493_2431667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2431699_2432245_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2432241_2432523_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2432512_2432701_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2432622_2433018_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2435188_2435725_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2435721_2436012_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2436011_2436611_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2436673_2436844_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2437134_2437347_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2437716_2438649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2438645_2439200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2439361_2439691_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2439963_2440431_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2440815_2440971_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2441078_2441600_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560208.1|2442037_2442259_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2442343_2442661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2442688_2443306_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2443622_2444558_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2444601_2445975_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP019383	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC50 chromosome, complete genome	4673894	2637265	2686515	4673894	protease,lysis,tail,holin,integrase	Salmonella_phage(27.27%)	48	2667030:2667059	2686651:2686680
WP_000984498.1|2637265_2638147_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2638340_2640389_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2640408_2641095_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2641192_2641690_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2641818_2643102_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|2643070_2645704_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2645781_2647221_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2647338_2647575_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2647685_2647877_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2647895_2648546_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2648769_2648934_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2649218_2649941_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2650624_2651020_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2651349_2651826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2652198_2652618_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2652990_2653260_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2653425_2653566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2656704_2657619_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2657751_2657910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2657919_2658534_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2659021_2659168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2659668_2659794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2660363_2660564_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2660660_2661161_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348541.1|2663265_2663757_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001576014.1|2663811_2664000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2664064_2664232_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2664488_2665022_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2665075_2665306_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2665495_2665990_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2666633_2666903_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2667030:2667059	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2667847_2668648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2669127_2669850_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001152416.1|2673904_2674600_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2674689_2675223_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2676117_2676597_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2676614_2677067_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2677050_2677380_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2677655_2678342_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2678702_2679152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2679525_2680050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2680146_2680836_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2680965_2681193_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2681189_2681789_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|2681852_2682101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2682789_2684769_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2685182_2685461_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2685435_2686515_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2686651:2686680	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP019383	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC50 chromosome, complete genome	4673894	2858907	2899174	4673894	protease,tail	Salmonella_phage(23.08%)	39	NA	NA
WP_000938186.1|2858907_2859588_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2860206_2860866_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2860952_2861282_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2861278_2861560_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2861608_2862388_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2862413_2862962_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2863176_2864388_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2864445_2864763_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2864807_2865221_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2865394_2866057_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2866151_2866610_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2866645_2868700_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2868823_2869270_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2869288_2871442_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_066038538.1|2871428_2872034_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2872250_2872760_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2873116_2874169_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2874240_2874693_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2874878_2876639_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2876707_2877226_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2877325_2877493_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2877748_2878312_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2878308_2879949_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2879953_2881207_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2881221_2883129_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2883141_2885250_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2885348_2886458_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2886454_2886997_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2887162_2888173_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2888380_2890993_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2891419_2891611_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2891881_2892568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2892927_2893554_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2894201_2895170_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2895395_2895644_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2895647_2896229_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2896228_2897938_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2897934_2898561_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2898544_2899174_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
>prophage 8
NZ_CP019383	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC50 chromosome, complete genome	4673894	2970884	2978197	4673894	protease,integrase	Ralstonia_phage(16.67%)	7	2965681:2965695	2976933:2976947
2965681:2965695	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2970884_2971262_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2971423_2971621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2971833_2974110_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2974140_2974461_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2974784_2975006_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2975135_2977082_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2976933:2976947	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2977078_2978197_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
