The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	6827	15203	5561815		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625682.1|6827_8135_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170549.1|8223_8943_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000278823.1|8935_9190_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_048375606.1|9186_9870_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_090978162.1|9853_12073_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.5e-163
WP_000879026.1|12057_13473_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_100909758.1|13578_14619_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.0	4.7e-67
WP_053565400.1|14615_15203_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.6e-27
>prophage 2
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	37225	65538	5561815	portal,head,tail,integrase,protease,capsid,terminase	Bacillus_phage(81.82%)	37	37153:37174	76290:76311
37153:37174	attL	ATGGACTTCATTTGTTTGTGCG	NA	NA	NA	NA
WP_100909759.1|37225_38287_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	78.7	1.7e-157
WP_100909760.1|39117_40338_+	hypothetical protein	NA	H0UST6	Bacillus_phage	66.8	1.8e-134
WP_075717195.1|40774_41104_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	89.0	3.2e-46
WP_060852551.1|41322_41553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006928470.1|41574_41763_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	88.7	2.8e-23
WP_100909762.1|42132_42321_+	hypothetical protein	NA	H0USU0	Bacillus_phage	66.7	2.6e-13
WP_100909763.1|42619_43426_+	replication protein	NA	A0A1P8VVR3	Streptococcus_phage	46.3	6.0e-22
WP_100909764.1|43376_44240_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	62.9	5.6e-90
WP_100909765.1|44253_44541_+	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	46.3	1.1e-15
WP_075717201.1|44537_44804_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	64.8	5.6e-25
WP_075717202.1|44842_45010_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	63.0	1.8e-13
WP_075717203.1|45043_45853_+	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JAT4	uncultured_Caudovirales_phage	52.1	4.4e-73
WP_075717204.1|45977_46181_-	hypothetical protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	63.5	7.0e-12
WP_142238818.1|46396_46510_+	DUF3983 domain-containing protein	NA	A0A1B0T6D3	Bacillus_phage	83.8	2.2e-07
WP_075717205.1|46812_47298_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	91.9	5.0e-80
WP_075717206.1|47294_47837_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	92.8	7.8e-90
WP_075717207.1|48043_48289_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	83.8	2.8e-31
WP_075717208.1|48551_49307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075717209.1|49698_50019_+	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	73.3	9.4e-35
WP_075717210.1|50015_50402_+	HNH endonuclease	NA	A0A2H4JFG4	uncultured_Caudovirales_phage	94.5	4.9e-70
WP_157812336.1|50491_50917_+|terminase	terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	87.2	3.4e-64
WP_100909766.1|50913_52638_+|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	91.6	4.1e-310
WP_100909767.1|52653_53832_+|portal	phage portal protein	portal	A0A1B1P7N5	Bacillus_phage	94.9	2.7e-212
WP_100909768.1|53828_54095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100909769.1|54084_54666_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	95.8	1.3e-95
WP_100909770.1|54667_55984_+|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	95.9	4.1e-209
WP_100909771.1|56052_56352_+	collagen-like protein	NA	NA	NA	NA	NA
WP_100909772.1|56366_56627_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	80.2	8.4e-34
WP_065485725.1|56604_56937_+	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	94.4	2.3e-52
WP_100909773.1|56926_57256_+	hypothetical protein	NA	A0A2H4JFJ3	uncultured_Caudovirales_phage	89.0	3.3e-51
WP_100909774.1|57255_57633_+	hypothetical protein	NA	A0A1B1P7P3	Bacillus_phage	96.8	2.1e-62
WP_100909775.1|57644_58280_+|tail	phage tail protein	tail	A0A1C8E980	Bacillus_phage	96.7	7.6e-113
WP_042991582.1|58291_58678_+	hypothetical protein	NA	A0A1B1P7Q6	Bacillus_phage	97.7	2.3e-64
WP_100909776.1|58716_58905_+	hypothetical protein	NA	A0A1B0T6A1	Bacillus_phage	98.4	6.3e-31
WP_100909777.1|58921_62446_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	93.2	0.0e+00
WP_100909778.1|62446_63130_+|tail	phage tail protein	tail	A0A1B0T6A0	Bacillus_phage	95.1	9.4e-125
WP_100909779.1|63126_65538_+	endopeptidase	NA	A0A1B1P770	Bacillus_phage	80.1	0.0e+00
76290:76311	attR	ATGGACTTCATTTGTTTGTGCG	NA	NA	NA	NA
>prophage 3
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	416996	506343	5561815	transposase,portal,head,tail,integrase,plate,protease,capsid,terminase,holin	Bacillus_phage(76.71%)	92	424514:424530	487927:487943
WP_001132865.1|416996_417893_+	ribokinase	NA	A0A0K0KW05	Prochlorococcus_phage	30.2	3.3e-05
WP_000716151.1|417889_418285_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_100909823.1|418689_419850_-|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	96.6	4.1e-213
WP_100909824.1|419920_420346_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	95.7	1.8e-73
WP_100909825.1|420361_420784_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	97.9	2.6e-69
WP_100909826.1|421057_421243_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	98.4	1.6e-26
WP_100909827.1|421242_421515_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	94.4	5.5e-44
WP_157812339.1|421524_421686_+	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	88.2	2.1e-19
WP_100909828.1|421702_422521_+	hypothetical protein	NA	A0A0S2MV65	Bacillus_phage	85.7	2.8e-131
WP_100909829.1|422532_422721_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	93.4	1.3e-23
WP_100909830.1|422747_423182_+	replication terminator protein	NA	A0A0S2MVA8	Bacillus_phage	97.2	1.5e-72
WP_100909831.1|423200_423914_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	97.0	1.2e-125
WP_100909833.1|424061_424400_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	2.2e-50
WP_100909834.1|424493_425405_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	95.1	3.6e-132
424514:424530	attL	AAAGAACAAAAATTATT	NA	NA	NA	NA
WP_100909835.1|425416_425896_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	91.8	2.1e-78
WP_100909836.1|425888_426119_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	92.1	2.2e-30
WP_157812340.1|426897_427089_+	hypothetical protein	NA	S5MC27	Brevibacillus_phage	66.7	1.6e-10
WP_100909838.1|427117_427240_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_100909839.1|427277_427673_+	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	87.8	8.2e-57
WP_100909841.1|428821_429034_+	hypothetical protein	NA	D2XR60	Bacillus_phage	88.2	6.8e-26
WP_100909842.1|429683_429992_+	hydrolase	NA	NA	NA	NA	NA
WP_100909843.1|430007_430343_+	alpha/beta hydrolase	NA	D2XR61	Bacillus_phage	93.7	3.8e-55
WP_100909844.1|430492_430849_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	78.8	4.2e-44
WP_100910552.1|430875_432504_+|terminase	terminase large subunit	terminase	A0A0U4B089	Bacillus_phage	79.6	5.0e-257
WP_100909845.1|432487_433675_+|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	94.0	4.3e-202
WP_100909846.1|433658_434441_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.8	6.6e-58
WP_100909847.1|434444_435596_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	96.6	2.1e-209
WP_100909848.1|435601_435916_+	hypothetical protein	NA	D2XR19	Bacillus_phage	90.7	1.8e-43
WP_100909849.1|435896_436253_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.8	1.5e-57
WP_100909850.1|436249_436594_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	92.9	3.1e-52
WP_100909851.1|436590_436920_+	hypothetical protein	NA	D2XR22	Bacillus_phage	90.8	5.1e-52
WP_100909852.1|436920_437517_+|tail	phage tail protein	tail	D2XR23	Bacillus_phage	96.0	4.5e-107
WP_100909853.1|437523_437886_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	87.5	9.2e-55
WP_100909855.1|438250_439480_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.1	7.9e-82
WP_100909856.1|439842_441057_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.0	4.9e-185
WP_053564356.1|441311_441569_+	hypothetical protein	NA	D2XR26	Bacillus_phage	88.1	3.4e-35
WP_100909857.1|441790_443956_+|tail	phage tail tape measure protein	tail	A0A2H4JC82	uncultured_Caudovirales_phage	82.4	8.4e-95
WP_100909858.1|444093_445203_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_100909859.1|445564_447040_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	82.5	6.7e-245
WP_100909860.1|447036_451872_+	hypothetical protein	NA	W8CYT7	Bacillus_phage	65.3	0.0e+00
WP_100909861.1|451914_452340_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	92.2	8.5e-68
WP_100909862.1|452339_453275_+	SH3 domain-containing protein	NA	A0A0S2MVR5	Bacillus_phage	78.8	5.2e-150
WP_100909865.1|456109_456739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100909866.1|456735_457563_+	collagen-like protein	NA	NA	NA	NA	NA
WP_100909867.1|457552_459193_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_100909868.1|459893_460724_-	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	74.9	4.6e-110
WP_001074649.1|462257_463193_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000758975.1|463207_464134_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_000667666.1|464168_464816_+	fructose-6-phosphate aldolase	NA	G8EY84	Synechococcus_phage	48.8	5.1e-48
WP_100909869.1|465198_467598_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_098284475.1|467916_468294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964465.1|468272_468602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873271.1|468618_469773_-	MFS transporter	NA	NA	NA	NA	NA
WP_000948035.1|471169_471514_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000730997.1|471767_472619_+	phospholipase C	NA	NA	NA	NA	NA
WP_100909870.1|472695_473742_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.5	3.7e-88
WP_100909871.1|473680_474781_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	94.3	4.0e-194
WP_100909872.1|475588_476809_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.1	1.7e-105
WP_030027087.1|477227_477563_-	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	1.1e-14
WP_030027086.1|477736_477943_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100910553.1|478018_478207_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	91.9	2.0e-24
WP_100909873.1|479889_480537_+	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	92.1	2.9e-107
WP_100909874.1|480776_481781_+	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	95.6	5.5e-182
WP_100909875.1|481743_482556_+	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	98.1	1.3e-152
WP_100909876.1|482596_482863_+	hypothetical protein	NA	W8CYZ5	Bacillus_phage	92.0	6.8e-39
WP_157812341.1|482949_483234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075717530.1|483619_483811_+	hypothetical protein	NA	A0A0S2MV77	Bacillus_phage	91.7	1.8e-25
WP_000645586.1|483840_483963_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_100909878.1|484265_484736_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	60.3	1.7e-48
WP_100909879.1|484732_485275_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	97.8	4.0e-94
WP_157812399.1|485969_486548_+	cephalosporin hydroxylase	NA	NA	NA	NA	NA
WP_002066846.1|486942_487137_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	93.8	4.2e-30
WP_100909880.1|487120_487426_+	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	88.9	9.8e-42
WP_100909881.1|487532_487853_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	81.1	1.5e-40
WP_100910556.1|487896_489516_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	59.8	2.3e-190
487927:487943	attR	AAAGAACAAAAATTATT	NA	NA	NA	NA
WP_100910557.1|489529_490675_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	91.3	3.2e-202
WP_100910558.1|490839_491397_+|protease	Clp protease ClpP	protease	A0A0U4B047	Bacillus_phage	50.0	2.0e-40
WP_100909882.1|491435_492593_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	43.2	1.2e-84
WP_100909883.1|492689_493142_+	hypothetical protein	NA	A0A286KIG6	Salmonella_phage	35.4	8.9e-07
WP_100909884.1|493146_493443_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	96.9	1.3e-46
WP_100909885.1|493423_493780_+|head	phage head closure protein	head	A0A1B1P760	Bacillus_phage	96.6	1.0e-58
WP_043311788.1|493796_494174_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	96.0	1.5e-60
WP_001272094.1|494160_494589_+	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	95.8	6.4e-71
WP_100909886.1|494590_495175_+|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	84.0	7.6e-91
WP_100909887.1|495246_495708_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	94.8	4.1e-76
WP_100910559.1|495882_497715_+	hypothetical protein	NA	A0A1B1P775	Bacillus_phage	98.0	6.6e-133
WP_100909888.1|497938_500773_+	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	82.5	5.7e-200
WP_100909889.1|500774_501458_+|tail	phage tail protein	tail	A0A1B1P761	Bacillus_phage	96.9	8.5e-126
WP_100909890.1|501457_503863_+	endopeptidase	NA	A0A1B1P770	Bacillus_phage	98.1	0.0e+00
WP_100909891.1|503877_505053_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	76.6	7.9e-164
WP_075717496.1|505102_505525_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	93.6	1.4e-67
WP_100909892.1|505524_506343_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	95.6	7.0e-159
>prophage 4
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	877273	942619	5561815	transposase,protease	Streptococcus_phage(33.33%)	54	NA	NA
WP_100909797.1|877273_878503_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.3e-84
WP_100909955.1|883365_884334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000144821.1|884808_885546_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_001208940.1|885542_886289_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000939632.1|886377_887319_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001182719.1|887544_888021_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_098251310.1|888013_889432_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_000644097.1|889561_890059_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_088022540.1|890186_892304_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_000252604.1|892481_893528_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_000726800.1|893542_894478_+	ferrochelatase	NA	NA	NA	NA	NA
WP_098329483.1|894497_895925_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_100909956.1|896138_898505_+	endonuclease	NA	NA	NA	NA	NA
WP_100909906.1|898663_899917_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001176842.1|900256_900556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000984164.1|900641_901496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184509.1|901725_902127_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_100909957.1|902129_904079_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000963381.1|904350_904923_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100909958.1|905140_907912_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_142325701.1|908057_908267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140298.1|908306_908612_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_097925337.1|908638_908992_-	PlcR-regulated protein PRP2	NA	NA	NA	NA	NA
WP_065228438.1|909125_909635_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000103711.1|909829_910843_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_100909959.1|910882_911011_-	YhfH family protein	NA	NA	NA	NA	NA
WP_100909960.1|911214_911949_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000897273.1|911958_912948_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000832165.1|913087_913516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100909961.1|913677_915210_+	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	3.3e-45
WP_001986183.1|915377_915554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000758699.1|915728_916784_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001227879.1|916816_917644_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_090975781.1|917655_918513_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_016513149.1|918526_919600_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	4.4e-28
WP_016513148.1|919641_920652_-	beta-channel forming cytolysin CytK	NA	R4WAV6	Staphylococcus_phage	30.6	1.7e-26
WP_100909962.1|920943_922050_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_100909797.1|923420_924650_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.3e-84
WP_000587038.1|925020_925998_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_000501938.1|926041_927166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824004.1|927171_927657_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000446842.1|927794_928697_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000473644.1|928757_929123_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_001010445.1|929787_931530_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.7	1.3e-13
WP_069355191.1|931539_932244_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	1.2e-34
WP_139213191.1|932384_933233_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023521404.1|933234_933591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001006050.1|933622_933922_+	DUF2101 domain-containing protein	NA	NA	NA	NA	NA
WP_043936613.1|934160_935429_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_097925345.1|935563_937291_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.1	1.2e-11
WP_016513145.1|937902_938559_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_090975791.1|938761_939424_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000107345.1|939644_941234_+	malate synthase A	NA	NA	NA	NA	NA
WP_100909797.1|941389_942619_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.3e-84
>prophage 5
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	964101	994514	5561815	portal,head,tail,protease,capsid,terminase	uncultured_Caudovirales_phage(46.88%)	36	NA	NA
WP_086422204.1|964101_965880_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.1	6.0e-22
WP_086422203.1|965910_967314_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.6	2.0e-113
WP_086422202.1|967426_967645_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_098508193.1|967660_968446_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	34.4	8.8e-26
WP_072179783.1|968595_968868_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	47.0	8.8e-10
WP_098508191.1|969335_969686_+	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	86.2	1.6e-51
WP_098508189.1|969778_970039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098508188.1|970031_970235_+	hypothetical protein	NA	A0A2H4J979	uncultured_Caudovirales_phage	89.6	2.3e-26
WP_098508186.1|970234_970516_+	hypothetical protein	NA	A0A1B2AQ09	Phage_Wrath	93.4	8.2e-43
WP_098508184.1|970493_971042_+	hypothetical protein	NA	A0A2H4JFP8	uncultured_Caudovirales_phage	86.3	1.1e-83
WP_098508182.1|971044_971974_+	AAA family ATPase	NA	A0A2H4JFH2	uncultured_Caudovirales_phage	53.9	7.8e-90
WP_000495504.1|971973_972408_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	66.9	1.7e-50
WP_100909965.1|972477_974865_+	DNA primase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	93.1	0.0e+00
WP_100909966.1|975166_975601_+	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	93.8	4.8e-74
WP_100909967.1|975601_976141_+	nuclease	NA	A0A2H4J819	uncultured_Caudovirales_phage	90.5	5.0e-89
WP_100909968.1|976144_976429_+	hypothetical protein	NA	Q4Z944	Staphylococcus_phage	43.5	2.3e-08
WP_100909969.1|976509_976854_+	organic solvent tolerance protein OstA	NA	A0A1B1P7N6	Bacillus_phage	58.5	2.9e-26
WP_016126403.1|977376_977772_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	87.8	5.2e-59
WP_100909970.1|977954_978374_+	DUF3775 domain-containing protein	NA	NA	NA	NA	NA
WP_100909971.1|978447_978729_+	hypothetical protein	NA	A0A1C8EAA0	Bacillus_phage	83.2	1.1e-36
WP_100909972.1|978725_979091_+	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	64.5	6.9e-42
WP_100909973.1|979210_979645_+	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	95.1	3.5e-69
WP_100909974.1|979641_981366_+|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	94.4	0.0e+00
WP_100909975.1|981428_982121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100909976.1|982184_983369_+|portal	phage portal protein	portal	A0A1B1P7N5	Bacillus_phage	95.9	5.6e-218
WP_142332645.1|983358_983940_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1P7P1	Bacillus_phage	97.4	2.0e-99
WP_100909977.1|983941_985252_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	93.1	1.9e-195
WP_100909978.1|985253_985514_+	hypothetical protein	NA	A0A1B1P7M9	Bacillus_phage	94.2	1.0e-39
WP_100909979.1|985488_985824_+	hypothetical protein	NA	A0A2H4JG72	uncultured_Caudovirales_phage	96.3	2.5e-54
WP_100909980.1|985813_986143_+	hypothetical protein	NA	A0A2H4JAX7	uncultured_Caudovirales_phage	95.4	1.9e-54
WP_100909981.1|986142_986526_+	hypothetical protein	NA	A0A2H4J971	uncultured_Caudovirales_phage	93.7	4.8e-62
WP_100909982.1|986531_987173_+|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	98.1	1.7e-112
WP_100909983.1|987177_987564_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	94.5	1.4e-61
WP_100909985.1|987810_991098_+|tail	phage tail tape measure protein	tail	A0A2H4J957	uncultured_Caudovirales_phage	81.0	2.8e-251
WP_100909986.1|991094_991901_+|tail	phage tail family protein	tail	A0A2H4J982	uncultured_Caudovirales_phage	70.8	1.0e-109
WP_100909987.1|991916_994514_+	hypothetical protein	NA	A0A2P9HXN3	Yersinia_phage	32.4	6.3e-28
>prophage 6
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	1264772	1323767	5561815	integrase,transposase,protease	Bacillus_phage(38.46%)	57	1284797:1284815	1308988:1309006
WP_100909797.1|1264772_1266002_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.3e-84
WP_053564908.1|1266372_1267728_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_100910019.1|1268015_1269290_-	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	36.5	2.0e-11
WP_000821126.1|1269785_1271060_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_063546925.1|1271128_1271647_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_000665496.1|1271967_1273284_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_000808640.1|1273466_1273823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814127.1|1273870_1274533_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000716093.1|1274639_1275380_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_000744326.1|1275379_1276435_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_097924950.1|1276431_1277064_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_100910020.1|1277258_1277966_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	49.8	5.8e-53
WP_157812403.1|1278030_1278354_+	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_098353245.1|1278378_1279734_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000880630.1|1280322_1280532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026288.1|1280572_1281349_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000677052.1|1281457_1282309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053359.1|1282506_1282704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000794493.1|1282854_1283952_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_000735528.1|1284066_1284585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910023.1|1284744_1285953_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
1284797:1284815	attL	AAGAAAAAGGCGTTGAAAT	NA	NA	NA	NA
WP_000600585.1|1285985_1286498_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000883009.1|1286668_1286896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455762.1|1287189_1287990_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000380276.1|1288107_1289106_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_000231445.1|1289117_1289738_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_000769253.1|1290049_1292092_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_065228522.1|1292171_1292600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937248.1|1293325_1294597_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	6.0e-16
WP_000897363.1|1294736_1295582_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_001094860.1|1295797_1295992_-	DUF3924 domain-containing protein	NA	NA	NA	NA	NA
WP_000806236.1|1296113_1296644_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	39.4	1.1e-24
WP_090975937.1|1296751_1298566_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.7	1.3e-32
WP_000110707.1|1298875_1299583_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_100910024.1|1299759_1300548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000010853.1|1300552_1303132_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_000584360.1|1303316_1303706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000067551.1|1303727_1304219_+	YpuI family protein	NA	NA	NA	NA	NA
WP_001075742.1|1304324_1305239_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	40.6	1.7e-36
WP_001252626.1|1305351_1306476_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	24.1	6.9e-08
WP_000247810.1|1306468_1307065_+	spore maturation protein SbmA	NA	NA	NA	NA	NA
WP_000029514.1|1307061_1307592_+	spore maturation protein SpmB	NA	NA	NA	NA	NA
WP_000440553.1|1307881_1308610_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000742194.1|1308716_1309238_+	thiol-disulfide oxidoreductase ResA	NA	NA	NA	NA	NA
1308988:1309006	attR	AAGAAAAAGGCGTTGAAAT	NA	NA	NA	NA
WP_100910026.1|1309359_1310985_+	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_000250087.1|1310999_1312157_+	cytochrome c biogenesis protein ResC	NA	NA	NA	NA	NA
WP_000426861.1|1312459_1313176_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	41.7	1.2e-42
WP_000964683.1|1313175_1314951_+	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	36.3	8.6e-37
WP_000781271.1|1315087_1315669_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000866227.1|1315752_1316367_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	41.7	9.9e-17
WP_000711798.1|1316520_1317207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000810856.1|1317757_1318336_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_100909906.1|1318505_1319759_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001151993.1|1320076_1320325_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.3	1.2e-16
WP_098817496.1|1320623_1321685_+	recombinase RecQ	NA	NA	NA	NA	NA
WP_100910027.1|1321674_1323204_+	ATP-dependent DNA helicase RecQ	NA	K7YHB4	Megavirus	35.1	3.3e-53
WP_001025783.1|1323203_1323767_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	3521626	3530350	5561815		Bacillus_phage(66.67%)	7	NA	NA
WP_098831278.1|3521626_3522499_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	6.9e-64
WP_090976720.1|3522632_3523304_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	90.5	1.0e-62
WP_000818985.1|3523451_3524171_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_142338214.1|3524398_3525472_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.5	1.1e-185
WP_100910588.1|3525468_3526146_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	8.7e-123
WP_023521720.1|3528187_3528952_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_098831277.1|3529051_3530350_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.3	2.9e-10
>prophage 8
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	4199222	4257784	5561815	coat,transposase,protease,tRNA	Klosneuvirus(20.0%)	55	NA	NA
WP_000125365.1|4199222_4200362_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	1.1e-82
WP_000354014.1|4200374_4201427_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000970410.1|4201446_4201647_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344450.1|4201643_4202645_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.8e-07
WP_000464511.1|4202650_4203268_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_100910424.1|4203456_4204401_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871172.1|4204412_4204943_-	BofC protein	NA	NA	NA	NA	NA
WP_000721216.1|4205373_4205808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093537.1|4205841_4206486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910425.1|4206664_4208611_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025335.1|4208836_4209943_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092229.1|4209973_4210807_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_100910426.1|4210826_4212356_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_069356236.1|4212508_4213651_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	28.6	2.1e-28
WP_053563610.1|4213650_4214193_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_090976998.1|4214272_4214920_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621693.1|4215080_4215932_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_090976996.1|4216029_4217943_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075718177.1|4217992_4219915_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114529.1|4219889_4220666_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.3e-29
WP_000865403.1|4220759_4221842_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002082113.1|4221831_4222539_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000497130.1|4222679_4223966_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001003587.1|4223965_4224514_-	sporulation protein	NA	NA	NA	NA	NA
WP_000944957.1|4224577_4224868_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002094147.1|4224871_4225216_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4225227_4225536_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_100910427.1|4225705_4227094_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599064.1|4227161_4228022_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797475.1|4228014_4228761_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503309.1|4228894_4229692_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391521.1|4229694_4230381_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975765.1|4230416_4230962_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135487.1|4230976_4231828_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466736.1|4231869_4232889_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001013391.1|4233046_4233724_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_029443367.1|4233770_4234346_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000361016.1|4234579_4235530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582037.1|4235695_4236997_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072222.1|4237090_4239736_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.1	1.5e-165
WP_000350660.1|4240222_4241248_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_115609903.1|4241314_4242325_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712942.1|4242405_4243692_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087056.1|4243691_4244681_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_023523117.1|4244701_4245454_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_016080168.1|4245456_4246386_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000009005.1|4246401_4247235_-	cytochrome c assembly protein	NA	NA	NA	NA	NA
WP_000547868.1|4247252_4248587_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_100910428.1|4249002_4249458_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100909797.1|4249591_4250821_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.3e-84
WP_000359774.1|4251190_4251607_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869118.1|4251641_4252238_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097288.1|4252234_4254565_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	9.5e-177
WP_000119173.1|4254747_4256418_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	8.7e-15
WP_000472289.1|4256524_4257784_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
>prophage 9
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	4305694	4313379	5561815		Bacillus_phage(33.33%)	9	NA	NA
WP_069356272.1|4305694_4306618_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	9.0e-46
WP_000247679.1|4306743_4307679_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	1.1e-22
WP_000018029.1|4307680_4308373_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_001014310.1|4308715_4308910_+	YwbE family protein	NA	NA	NA	NA	NA
WP_053563583.1|4308948_4310148_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	3.6e-71
WP_000587818.1|4310442_4310766_+	heme oxygenase	NA	NA	NA	NA	NA
WP_090976964.1|4310838_4311603_-	class B sortase	NA	NA	NA	NA	NA
WP_000403765.1|4311635_4312406_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.7e-13
WP_100910434.1|4312395_4313379_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	2.7e-16
>prophage 10
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	4698201	4740080	5561815	coat,protease	Prochlorococcus_phage(14.29%)	51	NA	NA
WP_098235657.1|4698201_4698879_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_157812390.1|4698977_4699772_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_098284313.1|4699824_4700133_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4700328_4700565_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125507.1|4700885_4701101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614216.1|4701162_4702164_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|4702284_4702776_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_098842068.1|4702799_4703279_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_098250799.1|4703440_4704544_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_069356409.1|4704488_4705835_+	adenine/guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_098250800.1|4705840_4706953_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_000575380.1|4706949_4707765_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_000683411.1|4708321_4708903_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000276470.1|4709052_4709817_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_000503347.1|4709924_4710557_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000274010.1|4710637_4711078_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|4711225_4712197_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000392611.1|4712213_4712480_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_001174588.1|4712853_4713351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435946.1|4713396_4713705_-	YutD family protein	NA	NA	NA	NA	NA
WP_000744131.1|4713823_4714402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178777.1|4714436_4715171_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141541727.1|4715271_4716087_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_075719462.1|4716112_4716544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_090978057.1|4716677_4717232_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_100910482.1|4717306_4717786_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000166367.1|4717806_4718703_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_000944681.1|4718892_4719876_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_100910483.1|4719949_4720681_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000248467.1|4720735_4721038_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_001118824.1|4723053_4724451_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000009523.1|4724499_4724931_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001020767.1|4724920_4726141_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	2.3e-118
WP_000152173.1|4726140_4727433_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000929163.1|4727448_4728234_-	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	26.1	7.0e-07
WP_000722399.1|4728472_4729279_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053563423.1|4729352_4730165_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000359401.1|4730188_4730854_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000601791.1|4730846_4731872_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.0e-29
WP_000781229.1|4732283_4732628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568174.1|4732780_4733080_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000640870.1|4733092_4733437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026896.1|4733873_4734257_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000218968.1|4734298_4734664_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	5.1e-21
WP_000826910.1|4735158_4735686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713772.1|4735830_4736478_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000666168.1|4736543_4737557_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_157812391.1|4737579_4738773_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001002982.1|4738772_4739024_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_001180555.1|4739037_4739223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232991.1|4739366_4740080_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	5176994	5232988	5561815	transposase,holin,protease	Bacillus_phage(18.75%)	49	NA	NA
WP_000168869.1|5176994_5177687_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_053563271.1|5177722_5178154_-|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_000921848.1|5178286_5179027_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000933592.1|5179004_5180774_-	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	30.6	1.5e-65
WP_016513283.1|5181099_5182398_+	MFS transporter	NA	NA	NA	NA	NA
WP_001242450.1|5182450_5184019_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.9	1.3e-15
WP_090978335.1|5184379_5185450_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000094037.1|5185669_5186296_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	2.6e-57
WP_100910525.1|5186384_5187278_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000540540.1|5187374_5187965_-	acetamide transporter	NA	NA	NA	NA	NA
WP_000996538.1|5188408_5189425_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.6	1.6e-96
WP_157812393.1|5189961_5190204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157812394.1|5190250_5190409_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098508025.1|5192022_5192622_-	NDxxF motif lipoprotein	NA	NA	NA	NA	NA
WP_086396668.1|5192618_5193194_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000993663.1|5193147_5193501_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100910528.1|5193803_5195510_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	37.4	7.1e-81
WP_098509201.1|5196810_5199414_-	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_100910529.1|5199482_5199620_-	SapB/AmfS family lantipeptide	NA	NA	NA	NA	NA
WP_098509199.1|5199737_5200403_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_098509197.1|5202236_5202419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000995320.1|5202738_5203386_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000789961.1|5203550_5204111_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002094212.1|5204259_5205498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098509193.1|5205741_5207187_-	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	34.4	1.3e-59
WP_000432447.1|5207662_5208646_+	GMP reductase	NA	G3MBI2	Bacillus_virus	84.7	3.4e-160
WP_100910530.1|5208783_5210598_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	38.7	5.7e-121
WP_000713633.1|5210638_5211517_-	radical SAM protein	NA	NA	NA	NA	NA
WP_069356595.1|5211738_5213757_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001027003.1|5213836_5214316_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_001052833.1|5214375_5214561_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_098447476.1|5214614_5215790_-|protease	serine protease	protease	W5SAB9	Pithovirus	31.9	7.7e-10
WP_000522837.1|5215853_5216648_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.3	6.1e-43
WP_000383720.1|5216631_5217474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075719576.1|5217454_5218771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000755367.1|5218767_5220609_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	8.9e-37
WP_000971865.1|5220612_5221320_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.7	7.6e-45
WP_100910531.1|5222114_5223404_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	35.9	7.3e-70
WP_001286147.1|5223619_5224969_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.3	2.5e-121
WP_000864223.1|5224996_5225443_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001113779.1|5225439_5227413_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_023523631.1|5227491_5228427_-	YybS family protein	NA	NA	NA	NA	NA
WP_000918873.1|5228507_5228741_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002094213.1|5228786_5229308_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	61.8	4.0e-51
WP_001233781.1|5229334_5229625_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000524670.1|5229816_5230917_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000435486.1|5231032_5231230_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000365115.1|5231250_5232132_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_061660971.1|5232391_5232988_+|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	39.4	2.8e-24
>prophage 12
NZ_CP024655	Bacillus cereus strain MLY1 chromosome MLY1.0, complete sequence	5561815	5500624	5508574	5561815		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|5500624_5500909_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|5500947_5502582_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_000743908.1|5502988_5504527_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833094.1|5504912_5506238_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	7.1e-44
WP_000929891.1|5506383_5507085_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_090978976.1|5507068_5508574_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	7.1e-32
>prophage 1
NZ_CP024657	Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence	158531	22016	80169	158531	protease,transposase	uncultured_Caudovirales_phage(18.18%)	43	NA	NA
WP_100910671.1|22016_22766_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_100910672.1|23100_23655_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100910673.1|24194_24410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910675.1|24818_25058_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_100910677.1|25362_25590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910744.1|26068_26353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098396063.1|27394_27985_+	methyltransferase	NA	NA	NA	NA	NA
WP_086386980.1|29333_30149_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_157812415.1|30338_30503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910678.1|30818_31115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157812419.1|31470_32571_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_100910680.1|32652_33792_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_100910681.1|35892_36243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910682.1|36265_36991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910683.1|37706_39461_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.0	1.8e-42
WP_100910684.1|39487_40069_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_100910685.1|40711_41188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910686.1|41945_43733_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	31.6	8.4e-40
WP_100910687.1|44265_46983_+	collagenase	NA	NA	NA	NA	NA
WP_100910688.1|48548_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910689.1|49756_50638_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_100910690.1|50811_51195_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	30.6	1.2e-07
WP_100910691.1|51317_52025_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.1e-42
WP_100910692.1|52128_52686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910745.1|53268_54717_+	peptidase C1	NA	A0A1B1V5K5	Malacosoma_sp._alphabaculovirus	33.6	6.6e-27
WP_100910693.1|54837_55173_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_001256731.1|55399_55591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910694.1|56442_56631_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_100910695.1|56878_57196_+	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	43.0	2.5e-16
WP_100910696.1|57424_57844_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_100910697.1|58455_58899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910698.1|59426_61025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910699.1|61254_62337_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_157812420.1|62354_63554_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100910701.1|63617_65039_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_100910645.1|65848_66415_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_100910644.1|66513_66990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000690668.1|67234_67786_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	3.2e-43
WP_100910702.1|67798_70780_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	45.5	7.0e-257
WP_100910703.1|76572_77229_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0A8WIK9	Clostridium_phage	54.0	5.4e-53
WP_100910704.1|77265_77610_+	DNA methyltransferase	NA	A0A218MND0	uncultured_virus	67.0	2.5e-33
WP_100910705.1|78316_79042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910607.1|79461_80169_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.4e-38
>prophage 2
NZ_CP024657	Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence	158531	83754	152315	158531	transposase	Streptococcus_phage(35.0%)	53	NA	NA
WP_100910707.1|83754_84672_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_078188146.1|84718_85006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078188145.1|85148_85490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078188144.1|85632_85848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910708.1|86234_86894_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	33.2	1.4e-13
WP_100910638.1|87538_88246_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.5	2.1e-42
WP_157812416.1|89162_90023_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_100910711.1|90439_91666_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_086387926.1|92856_93117_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_100910712.1|93184_94606_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_100910713.1|94966_95239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910714.1|95886_97113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910715.1|97564_98251_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.5	7.8e-71
WP_157812417.1|98493_99414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910646.1|99517_100954_+|transposase	IS4-like element IS231O family transposase	transposase	NA	NA	NA	NA
WP_100910642.1|101177_104159_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	45.7	2.0e-256
WP_100910717.1|104955_105522_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_100910718.1|105935_108791_-	DEAD/DEAH box helicase family protein	NA	A0A0P0YML3	Yellowstone_lake_phycodnavirus	28.8	1.9e-30
WP_098282336.1|109284_110718_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157812418.1|111563_111728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910719.1|111899_112694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910720.1|112929_114051_-	iota toxin protein Ia	NA	A0A1V0E017	Clostridioides_phage	37.2	2.8e-65
WP_100910721.1|114083_116183_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	35.8	2.4e-86
WP_100910722.1|117033_117759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910723.1|117891_118959_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_100910724.1|119351_119897_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.5	6.3e-31
WP_100910725.1|119939_122888_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.3	2.3e-79
WP_100910726.1|122925_123258_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	4.4e-11
WP_100910727.1|123348_124221_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	48.1	2.1e-36
WP_100909797.1|124917_126147_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.3e-84
WP_100910728.1|126793_127003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910729.1|128365_129307_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_100910730.1|129694_130003_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_100910731.1|130071_130374_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065486420.1|130527_130803_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.7	1.9e-20
WP_100910732.1|130859_131093_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_100910733.1|131114_131396_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.7e-11
WP_098138892.1|131509_131674_+	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_078185714.1|132199_132514_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100910734.1|133058_133514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910735.1|133588_134098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910736.1|134903_136712_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	25.7	5.9e-25
WP_006919475.1|138741_138957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100909797.1|139579_140809_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.3e-84
WP_100910737.1|140923_141109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910738.1|141123_142857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910739.1|142875_143421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910740.1|143423_144140_-	DUF4366 domain-containing protein	NA	NA	NA	NA	NA
WP_100910741.1|144123_144426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910746.1|144459_148002_-	hypothetical protein	NA	A0A1S5SEZ8	Streptococcus_phage	35.8	9.4e-51
WP_100910742.1|148068_150483_-	conjugal transfer protein TraE	NA	G3MBM1	Bacillus_virus	24.0	7.9e-09
WP_100910653.1|150424_150826_-	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	37.8	6.3e-12
WP_100910654.1|151127_152315_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	26.8	7.0e-27
>prophage 1
NZ_CP024656	Bacillus cereus strain MLY1 plasmid pMLY1.2, complete sequence	102005	5754	54988	102005	protease,transposase,integrase	Bacillus_phage(55.0%)	55	5664:5723	55020:55882
5664:5723	attL	GGTTCTGGTGCAAAAAAGCGAAATGATTTGAAAATGCTCTTTCAAACTTGGCAATACTGG	NA	NA	NA	NA
WP_100910607.1|5754_6462_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.4e-38
WP_100910608.1|6992_7526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078188157.1|8099_8372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910651.1|9310_9523_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	46.2	2.2e-08
WP_157812409.1|9743_9890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910607.1|9934_10642_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.4e-38
WP_078188090.1|11129_11390_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_100910609.1|11455_12877_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_098955004.1|13134_13446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098680036.1|13456_13774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098954917.1|13798_14380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910610.1|14395_15526_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	39.8	4.8e-17
WP_100910611.1|15588_18201_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_098954914.1|18197_18710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098954913.1|18769_21352_-	recombinase RmuC	NA	A0A1S5SF64	Streptococcus_phage	28.1	1.7e-86
WP_098954912.1|21311_21860_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_086401784.1|21878_22127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098954911.1|22148_23120_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_098954910.1|23166_23541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098954909.1|23609_23843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098955002.1|23864_24086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098954908.1|24097_24304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098954907.1|24308_25169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098954906.1|25183_27838_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_078185329.1|27863_28091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098771756.1|28163_28388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078185327.1|28482_28668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078186893.1|29352_31173_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	29.3	8.0e-30
WP_078185325.1|33470_33698_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086401740.1|33811_34222_+	helix-turn-helix transcriptional regulator	NA	A0A1B1ILZ9	Lactococcus_phage	31.3	1.5e-05
WP_157812410.1|34460_34619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910612.1|34622_35786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910613.1|36178_37174_+	Replicase RepFR55	NA	NA	NA	NA	NA
WP_100910615.1|38295_39240_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	46.3	9.1e-70
WP_086401744.1|39489_40656_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_100910616.1|40680_41100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078185318.1|41208_41751_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100910617.1|41843_42314_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_078185316.1|42628_42850_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	49.2	9.4e-10
WP_078185315.1|42885_43104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086401748.1|43117_43774_-	hypothetical protein	NA	A0A1B1P7T2	Bacillus_phage	66.7	6.1e-81
WP_100910618.1|43757_44930_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	72.1	1.6e-161
WP_100910619.1|44936_45260_-	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	66.4	2.6e-32
WP_100910620.1|45271_45688_-	hypothetical protein	NA	A0A1B1P7T3	Bacillus_phage	73.8	2.1e-50
WP_100910621.1|46142_47213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910622.1|47354_47711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910652.1|47792_48296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910623.1|48613_49012_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	68.2	6.0e-47
WP_100910624.1|49047_49593_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	75.5	6.6e-65
WP_100910625.1|49654_49897_-	hypothetical protein	NA	A0A218KCK2	Bacillus_phage	67.6	1.5e-24
WP_100910627.1|50383_50626_-	DNA-binding protein	NA	A6M9A5	Geobacillus_virus	47.5	2.1e-07
WP_100910628.1|50745_51186_-	sporulation protein	NA	F8WPS9	Bacillus_phage	53.9	2.9e-34
WP_100910629.1|51203_51776_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	45.0	2.2e-34
WP_100910630.1|52080_53889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910607.1|54280_54988_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.4e-38
55020:55882	attR	CCAGTATTGCCAAGTTTGAAAGAGCATTTTCAAATCATTTCGCTTTTTTGCACCAGAACCAAATTGGCTCATGCTTCTTATATCATGGGGTGCCAGGATCACGGAGTGGCCATCGTTATCGATCCAGGACGTCACATCGAACAATATATGGAATTTGCTAGAAAGCGAGGAGTAGACATCATTGCGGTAACGGAAACACATATTCATGCTGATTTTGTATCTGGTGCAAAGGAGCTTGCATTATCTTGTAACGCAATGTTTTATGCATCAGCTGAAGGGGGAAGCACGTGGAAGTATCAGTATCTCGATCAAGTGCCATACCATCTTGTCAGAGATGGCAGTGAATTTCATATTGGTACGATCCAATTTCAGGTTATTCACACACCAGGACATACGCCTGAAAGTATCTCCTTTCTAGTCATAGATACAAAACAGCATAATGAAACCAATGATAAACCGATAGGGATTTTTACAGGAGATTTTCTATTTGTTGGTGATGTGGGTAGACTAGATTTATTAGAAACCGCTGTGGGTATTCCACATCATGCGAAGGATAGCGCCAAAGACTTATTTCATTCGATCCAAAAAATCAAAACGATGCCGGTATACCTACAAATTTGGCCCTCCCATCGTGCTGGTAGCGCATGCGGAAAATCATTAGGCGCCATTCCCTCTTCTACAATGGGCTATGAGAAACTTTTTAATTGGGCCTTTCAAACAGAGGAACAAAATTCTTTTGTGAGACATGTATTAAGTGGACAGCCGGAACCACCACCTTATTTTTCTAAAATGAAACGAATCAATCAAGCTGGTCCGCCGATTCGTACACAGGGTCTCATAAAAGAAATACATTCTTTCCCTGC	NA	NA	NA	NA
>prophage 1
NZ_CP024658	Bacillus cereus strain MLY1 plasmid pMLY1.3, complete sequence	124659	40953	52192	124659		Bacillus_phage(55.56%)	16	NA	NA
WP_065486450.1|40953_41178_+	DNA-binding protein	NA	A0A0S2MVM0	Bacillus_phage	50.0	2.7e-12
WP_100910770.1|41182_41740_-	hypothetical protein	NA	A0A288WFQ7	Bacillus_phage	45.3	8.7e-28
WP_100910771.1|41771_42068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910840.1|42222_42450_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_100910772.1|42539_43490_-	DUF3895 domain-containing protein	NA	NA	NA	NA	NA
WP_100910773.1|43479_43716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910774.1|43808_44057_-	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	47.4	2.7e-13
WP_098424699.1|44592_44817_+	helix-turn-helix transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	41.9	1.6e-09
WP_100910775.1|44856_45474_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	47.1	1.1e-39
WP_100910776.1|45412_46594_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	55.1	4.4e-122
WP_100910777.1|46693_46879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100910778.1|46880_47177_-	hypothetical protein	NA	H0USY0	Bacillus_phage	45.5	2.9e-14
WP_100910779.1|47432_48476_+	hypothetical protein	NA	A0A1L2JY40	Aeribacillus_phage	36.3	1.7e-45
WP_100910780.1|48600_49335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100910841.1|49821_50811_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_100910781.1|50815_52192_+	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	25.9	5.5e-07
