The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	13089	67731	3063698	holin,transposase,bacteriocin,protease	unidentified_phage(20.0%)	54	NA	NA
WP_003574021.1|13089_14010_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003568540.1|15500_16520_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003568474.1|16546_16741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003581645.1|16813_17407_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003584064.1|17800_18196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019890870.1|18483_19899_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_049176623.1|19977_20280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003604001.1|20558_21416_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|21495_21678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659010.1|21728_21908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908369.1|22405_23641_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003604017.1|23844_26418_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|26430_27132_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003604018.1|27411_27996_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022671185.1|28006_28813_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003568494.1|28817_29138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604021.1|29363_30044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659016.1|29976_30480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003604022.1|30499_32650_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_100908370.1|32994_33768_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003600709.1|33945_34551_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003604023.1|34619_35513_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_100908371.1|35561_36200_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100908681.1|36947_37307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016367437.1|37325_37607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049176626.1|38086_39463_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003562527.1|39685_40030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|40105_40465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003584098.1|40705_42148_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003604031.1|42342_42978_+	membrane protein	NA	NA	NA	NA	NA
WP_003604033.1|43027_43339_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003604036.1|43507_43696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604037.1|43827_44439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673947.1|44795_45269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604040.1|45513_47664_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_003604041.1|48014_48725_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003592450.1|48711_49041_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_003659037.1|49278_49569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003604042.1|49921_50137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003604043.1|50487_51363_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003562571.1|51708_52359_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003604044.1|52756_53449_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003604045.1|53725_54082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604046.1|54146_54467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604047.1|54655_55531_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	27.3	8.0e-12
WP_003572923.1|55623_57216_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	1.1e-11
WP_022671222.1|57553_58927_-	MFS transporter	NA	NA	NA	NA	NA
WP_003604050.1|59607_62919_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|62915_63518_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|63768_64029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|64242_64905_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|64904_65834_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|65845_66475_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562598.1|66477_67731_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
>prophage 2
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	366537	395181	3063698	transposase,protease	unidentified_phage(50.0%)	26	NA	NA
WP_016365202.1|366537_367953_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_019890870.1|368106_369522_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_191982761.1|369536_369998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604275.1|370061_370748_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_022667326.1|370830_371220_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003577580.1|371251_371776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045601082.1|371765_372401_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	3.0e-24
WP_022667336.1|372414_373140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022667344.1|373139_373820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|373896_374817_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_100908391.1|374909_375653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908684.1|379027_379996_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003573439.1|379996_380308_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003604283.1|380449_381736_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003604285.1|381752_382175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|382196_383057_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003604288.1|383170_383812_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003563255.1|384098_384929_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003563257.1|384921_385791_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_045600130.1|385830_386826_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_019890870.1|387502_388918_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003604293.1|388949_389729_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	25.4	5.9e-06
WP_157786364.1|389914_390130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003604295.1|392196_392595_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003563277.1|392707_393079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|394260_395181_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 3
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	406677	431611	3063698	transposase	Lactobacillus_phage(100.0%)	24	NA	NA
WP_157810990.1|406677_407421_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.8	3.1e-137
WP_003586983.1|407572_407824_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_100908393.1|407918_409211_+	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_019917722.1|409226_409724_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003604307.1|409766_410507_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003604309.1|410651_411449_-	tributyrin esterase	NA	NA	NA	NA	NA
WP_003586715.1|411459_412302_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_049176466.1|412305_413073_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003586720.1|413098_413608_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003586723.1|413635_414043_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012490941.1|414337_417076_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_045599945.1|417117_418413_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_157810990.1|418819_419563_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.8	3.1e-137
WP_003586983.1|419714_419966_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_045599948.1|421308_421779_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003586733.1|421780_422722_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_019890870.1|423120_424536_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003586737.1|424792_425110_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014566402.1|425125_426211_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_045599958.1|426233_427208_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_012490949.1|427214_427901_+	D-lyxose/D-mannose family sugar isomerase	NA	NA	NA	NA	NA
WP_012490950.1|428019_429486_+	xylulokinase	NA	NA	NA	NA	NA
WP_003586747.1|429668_430112_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_094515910.1|430824_431611_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	573304	626934	3063698	integrase,transposase	Lactobacillus_phage(60.0%)	47	605189:605205	613318:613334
WP_016365202.1|573304_574720_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003604425.1|576651_577350_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	2.6e-29
WP_003604428.1|577337_578453_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003604430.1|578555_579437_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	7.3e-21
WP_045600486.1|579433_580582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604434.1|580610_581150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100908407.1|581339_588035_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_191982757.1|588576_593997_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_022671486.1|594502_597037_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.0	1.5e-66
WP_003577866.1|597620_599063_+	amino acid permease	NA	NA	NA	NA	NA
WP_003563498.1|599172_599676_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003573683.1|599854_600748_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	3.0e-06
WP_003577882.1|600902_601769_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003604439.1|601785_602619_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003604440.1|602715_603612_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003604441.1|603763_604981_+	MFS transporter	NA	NA	NA	NA	NA
WP_100908409.1|604999_605899_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
605189:605205	attL	CATTTTCTGGGTGGTAA	NA	NA	NA	NA
WP_003573694.1|606343_607159_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_022671487.1|607192_608122_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
WP_016365202.1|608350_609766_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_100908410.1|609884_610430_-	hydrophobic protein	NA	NA	NA	NA	NA
WP_003569067.1|610750_611920_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003606553.1|612032_612293_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	3.2e-09
WP_003574021.1|612323_613244_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003586911.1|613436_614057_+	hypothetical protein	NA	NA	NA	NA	NA
613318:613334	attR	CATTTTCTGGGTGGTAA	NA	NA	NA	NA
WP_003586913.1|614468_615176_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_157810981.1|615685_616528_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	3.9e-157
WP_003586983.1|616581_616833_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_003572184.1|617103_617457_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|617700_617949_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|617990_618191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586916.1|618161_618995_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	38.1	5.6e-47
WP_010493122.1|619055_619814_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
WP_003572193.1|619814_619994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606636.1|619986_620238_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003586919.1|620303_620660_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	2.2e-61
WP_003572201.1|620744_620948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|620930_621476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661649.1|621656_621971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586926.1|621963_622710_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	1.7e-34
WP_003574014.1|622724_623549_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	2.3e-117
WP_003574016.1|623548_624067_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003564822.1|624113_624536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572217.1|624537_625275_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.0	1.3e-47
WP_010493149.1|625286_625574_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_003586929.1|625643_625976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493154.1|626490_626934_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
>prophage 5
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	631883	679149	3063698	integrase,transposase	Lactobacillus_phage(25.0%)	38	634132:634191	659804:661370
WP_100908412.1|631883_632192_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100908413.1|632237_632966_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	39.6	2.9e-31
WP_014951815.1|632899_633841_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
634132:634191	attL	TAGTGGCTGTTGAACTAGGCCACCATATCTTCGACCCTTGTAGTAAATTTATAGCGAATT	NA	NA	NA	NA
WP_019890870.1|634145_635561_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_049176765.1|636966_638397_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003586951.1|638648_638927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566886.1|638938_639205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566884.1|640772_641249_+	PcfB family protein	NA	NA	NA	NA	NA
WP_100908414.1|641248_643150_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_003571730.1|643167_643374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571732.1|643393_644227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157810982.1|644414_645257_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	6.7e-157
WP_003586983.1|645310_645562_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_003587109.1|646729_646993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587111.1|647052_649875_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
WP_100908416.1|650182_650969_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016363761.1|650966_651128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586668.1|651486_652074_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.7	8.3e-21
WP_003586674.1|652150_652429_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003586676.1|652428_652803_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_016365202.1|653072_654488_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003587210.1|654896_655364_+	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
WP_003587212.1|655610_656354_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	2.6e-27
WP_010620835.1|656331_657579_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003587215.1|657583_658255_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019890870.1|658433_659849_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_100908686.1|662373_662922_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
659804:661370	attR	AATTCGCTATAAATTTACTACAAGGGTCGAAGATATGGTGGCCTAGTTCAACAGCCACTACTTAGCGGTCATTTGAACGCTAAGTACAGAAGTGGCTTTGGTCGTTGCTACGCGTGTTCGTTTGTTAATCTGCTAGTATCGTCATTTTATTCAACAAACTAGTTTGTAACTGGCTGAGTGTGGTCGTCATGTAGACCGGGTAAAGATCTGGGTTGACGAGCCGCTGGGTTGTTCGTGGGAGCTCGGCAAGTTTAGCCTGGGTCGTTGCCTGAATGGTTGTAACCGGAATTGACGTGGTGTTGGACAAATCTACCGGCGCGAGTAAGGGCCGGACTTCAAAATGGGTGAGTCGCTGTTGACGGTCGACACTGAGTGGGTCACTGTTGACGACGGTTAGGCTGGTCGCATCAACGATCGTCTCGGTAGCTAGTGCAATCAAATCAGCAAAGGCCCGCTGAGTTCCTGGTTCGTACAAACGATAGACTTGCTTATCACCAGGAATCGTTAGTTTTTCGCGACTGGCACTGACCTTGATCTTGGGGGTGCTCTGACCATTGCTCTCAGTTGCCGCAAGCTTGTAGACGCCACTTAGAACCGGTGCGGACGCGCTAGTGATGAGCTTTTCACCGATACCAAAATTATCGATCGGTGCGCCTTCGTGCAACAGCGAGGTAATGATGTGTTCATCCAATGCGTTAGAAATAGTGATTTTGGCATTGGGAAAGCCAGCCGCGTCCAATTGTGTCCGGGCAGCTTGTGATAAAGTCGTGACGTCCCCGAATCGATTCGAATACCGACGGGTTCATGCCCAGCTGCTCGTAGCTCCTTAAAGACCGTCACCGCGTTAGGGATCCCAGAGTTAGAACCTGTCTAGTATCTGCTGAATCTGGTAGAATTGTGGAAAACCGACTGAGGAGTTTGTCATGCCAGATTATCCAAGCAATATTTCTCGAGCGCAATTTGCGTTAATACAACCTGATTTAGAAAACTTCCGCAAGCATACAAGACCGCGTCGTTATGATCTTCATGACGTATTCAATGCCATCCTTTACTCGCTTACTACAGGGTGTCAATGGCGTGAATTACCGCACGATTTCCCGGAATGGCACACTGTCTACCGCTATTACGATATGTGGCGAGATAAACCAGACCCGACAGCTGATTCGCTATTAGAAAGGCTTTTAAAAAAACTGTCGCTTCCTATCGTTTTGCACAGGGCCGATCGGCCCGAACGTCGTTTGTGATTGTTGATGCTCAAAGTGTTAAAACCACTGATTTAACGAAAAATAGTGGCTACGATGGCGGCAAAAAGATTTCAGGGATTAAGCGTCCCCAGTTTACAATTCAAGTGCAACACCCTGACGACTAGACCAAAAAGGCCATGAAGACCTATTCTTGTTAGTGCTAGCTAAACAAGAAAGCAGGAATCTTCATGACCCACTCTCAGACTAACACCCACAAGCATTACCAACAACTCAGTTTTAGCGACCGTGCTACAATTCAGGCCCTTCAGGCTGCTGGTGACACCGCGACCGTGATTGCACAGAAGCTTCATCGCAGTAAAGCG	NA	NA	NA	NA
WP_003582479.1|662931_663153_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_016377436.1|663194_665093_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.0	3.5e-105
WP_099973806.1|665638_666426_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003607154.1|666706_667138_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_003606758.1|670844_672377_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003606756.1|672376_673315_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	7.3e-27
WP_003589055.1|673544_674606_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003606755.1|674610_675282_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	2.6e-26
WP_049169626.1|675388_676072_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.2	1.6e-60
WP_003586786.1|676314_676743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019890870.1|677733_679149_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	1063144	1072486	3063698		Streptococcus_phage(33.33%)	8	NA	NA
WP_003564244.1|1063144_1066036_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
WP_003564246.1|1066387_1066927_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|1067089_1067977_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_100908449.1|1067973_1069002_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	50.9	1.1e-89
WP_003564251.1|1069006_1069954_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564253.1|1070339_1070795_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|1070911_1071502_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_003604721.1|1071823_1072486_-	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	67.3	6.5e-14
>prophage 7
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	1345760	1366545	3063698	transposase	Lactobacillus_phage(28.57%)	15	NA	NA
WP_003574021.1|1345760_1346681_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003604982.1|1347082_1347970_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	6.2e-20
WP_003604983.1|1348166_1349393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003604985.1|1349590_1349995_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003604987.1|1349987_1350314_+	YrdB family protein	NA	NA	NA	NA	NA
WP_003604989.1|1350926_1353104_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_029327644.1|1353363_1354206_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
WP_003586983.1|1354259_1354511_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_022671568.1|1354632_1355070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908474.1|1355753_1357556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574796.1|1359482_1359896_-|transposase	transposase	transposase	S5VTD3	Leptospira_phage	36.5	1.3e-12
WP_003574798.1|1359941_1360496_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	29.5	1.1e-14
WP_191982760.1|1361020_1361401_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003574805.1|1361402_1361573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908377.1|1365522_1366545_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	7.6e-38
>prophage 8
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	2039614	2094354	3063698	transposase,protease	Lactobacillus_phage(16.67%)	42	NA	NA
WP_003605487.1|2039614_2040376_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_022668584.1|2040362_2040569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019882126.1|2040550_2041318_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003586983.1|2042491_2042743_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_029327644.1|2042796_2043639_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
WP_003566292.1|2044978_2046532_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
WP_003566294.1|2046704_2047631_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
WP_003580005.1|2047786_2048149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003575717.1|2048195_2048486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100908535.1|2048549_2049959_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003566302.1|2050291_2050768_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003566303.1|2050772_2053064_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003605537.1|2054015_2055845_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003566310.1|2055900_2056806_+	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003605539.1|2056863_2057325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003607459.1|2057436_2058789_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003605545.1|2058775_2059741_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003566320.1|2059898_2060558_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003585113.1|2060908_2062717_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003566323.1|2062729_2063488_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.9e-33
WP_003607460.1|2063788_2065444_+	amino acid permease	NA	NA	NA	NA	NA
WP_003566327.1|2065578_2066460_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_003566329.1|2066597_2067893_+	GTPase HflX	NA	NA	NA	NA	NA
WP_013245870.1|2068030_2069017_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_049182019.1|2069326_2071651_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_003566334.1|2071938_2072988_-	EpsG family protein	NA	NA	NA	NA	NA
WP_003580031.1|2073066_2073702_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003592231.1|2073759_2074452_-	tyrosine-protein kinase modulator	NA	NA	NA	NA	NA
WP_003570792.1|2074695_2076135_-	histidine kinase	NA	NA	NA	NA	NA
WP_003592233.1|2076149_2077286_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016372934.1|2077340_2078306_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.8	3.9e-07
WP_049182023.1|2078715_2080389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100908538.1|2080543_2082283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908539.1|2082478_2084560_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_070707348.1|2084698_2086186_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_100908540.1|2086436_2087450_+	acyltransferase	NA	NA	NA	NA	NA
WP_100908377.1|2087549_2088572_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	7.6e-38
WP_003574021.1|2088782_2089703_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_049181299.1|2089864_2090857_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	35.4	5.0e-42
WP_049181302.1|2090928_2092071_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.2	5.2e-27
WP_003591294.1|2092332_2093199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2093433_2094354_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 9
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	2131210	2204211	3063698	integrase,transposase,protease	Enterobacteria_phage(15.38%)	57	2202282:2202341	2205886:2206224
WP_003607498.1|2131210_2133361_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.7	1.4e-121
WP_003570845.1|2133742_2134507_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_100908546.1|2134684_2135578_+	LCP family protein	NA	NA	NA	NA	NA
WP_100908547.1|2135901_2137146_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_100908548.1|2137468_2137624_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_100908549.1|2137799_2137985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157810988.1|2138390_2139488_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_100908551.1|2139492_2139930_+|transposase	transposase	transposase	S5VTP8	Leptospira_phage	38.8	1.1e-17
WP_100908552.1|2140308_2140977_-	sugar transferase	NA	NA	NA	NA	NA
WP_100908553.1|2141696_2142539_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_100908554.1|2142609_2143635_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.2	4.7e-72
WP_100908555.1|2143637_2144210_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.3	1.7e-34
WP_100908556.1|2144209_2145085_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	62.5	7.8e-100
WP_100908557.1|2145471_2146332_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_100908558.1|2146806_2147688_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_100908559.1|2147738_2148434_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.4	5.6e-08
WP_100908560.1|2148430_2149249_-	dTDP-rhamnosyl transferase	NA	NA	NA	NA	NA
WP_100908694.1|2149530_2150775_-	polymerase	NA	NA	NA	NA	NA
WP_100908695.1|2151074_2152016_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_100908696.1|2152286_2153729_-	flippase	NA	NA	NA	NA	NA
WP_100908561.1|2153769_2154894_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	70.5	6.9e-149
WP_100908562.1|2154969_2155722_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_100908563.1|2155735_2156650_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_100908564.1|2157887_2158607_+	acyltransferase	NA	NA	NA	NA	NA
WP_049144801.1|2158888_2159389_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_049144802.1|2159499_2160213_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_049144803.1|2160209_2160434_-	DUF2829 domain-containing protein	NA	K4N0H8	Escherichia_phage	32.9	1.4e-05
WP_016382355.1|2160718_2161030_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049144804.1|2161289_2161928_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003570960.1|2162236_2163214_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	34.1	5.8e-11
WP_003566704.1|2163215_2164268_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.3e-20
WP_003566706.1|2164279_2165278_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566708.1|2165277_2166201_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_100908565.1|2166375_2167998_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003566713.1|2170086_2170650_-	elongation factor P	NA	NA	NA	NA	NA
WP_003607240.1|2171869_2172577_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003570969.1|2172569_2174054_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003570970.1|2174050_2174833_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003566723.1|2175302_2175869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003591381.1|2176120_2176456_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_100908566.1|2176512_2177613_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_003607251.1|2177722_2178133_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003566730.1|2178104_2178311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566732.1|2178307_2179732_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_100908567.1|2180533_2182756_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_016388190.1|2182818_2183562_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_100908568.1|2183838_2184585_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_100908569.1|2184930_2187513_-	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.4	1.2e-50
WP_100908570.1|2187553_2188144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003585334.1|2188569_2189175_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_100908573.1|2189860_2190673_-	sugar kinase	NA	NA	NA	NA	NA
WP_100908574.1|2190994_2192551_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_100908575.1|2195293_2196100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908576.1|2196288_2198343_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_100908577.1|2198332_2200831_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_100908578.1|2200922_2203154_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
2202282:2202341	attL	TATCGTACTAAACAAACGAACTTTGAGAAGATTCCGGGGAGTCCAATCGCATACTGGGCA	NA	NA	NA	NA
WP_100908579.1|2203128_2204211_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	38.4	2.9e-64
WP_100908579.1|2203128_2204211_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	38.4	2.9e-64
2205886:2206224	attR	TGCCCAGTATGCGATTGGACTCCCCGGAATCTTCTCAAAGTTCGTTTGTTTAGTACGATATAAATAAGACACCTCGGGGTTGGAAATTGCGTTCAGCGTTTTCTTTTGTTGTACGTCCATGCCACCAGTAAATCTGGTCAATCTGATATAAGTGCCTAATGTCTGATCTGAAGGAAATCTTTTCTTAATAACGAATGTATCAATTGTAACGTATGCTTCATCGAAGAAAGCATGTGTTTCCATCTGAATCAAGGTAGAGATGGATGTGGCTTTTAAGATCGCTTGCCGAGTTGAATCAAATGTTTTTAGGAACATCCAAACAATCGGTGTCATGTAAGC	NA	NA	NA	NA
>prophage 10
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	2426985	2488986	3063698	tRNA,transposase,bacteriocin,protease	Bacillus_phage(18.18%)	57	NA	NA
WP_016365346.1|2426985_2428392_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.4	2.6e-52
WP_003605020.1|2428632_2430027_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003580771.1|2430152_2430740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567227.1|2430739_2430931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576207.1|2431406_2432900_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003580775.1|2433047_2434028_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_100908625.1|2434152_2434815_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003567235.1|2434998_2435829_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003605023.1|2436291_2437131_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567242.1|2438165_2438540_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003605027.1|2438704_2439976_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003567252.1|2440507_2441623_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003567254.1|2441644_2443009_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2443025_2443568_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2443788_2444079_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2444195_2444573_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003605926.1|2444817_2446137_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	9.2e-60
WP_100908626.1|2446372_2447719_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.5	9.1e-47
WP_100908627.1|2447946_2449047_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003605929.1|2449043_2450240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003576231.1|2450302_2451181_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003567271.1|2451342_2453397_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_100908628.1|2453553_2456184_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.4	6.4e-89
WP_100908629.1|2456345_2456969_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003605932.1|2457468_2458140_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_100908630.1|2458650_2459772_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2459785_2460070_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_100908631.1|2460260_2461283_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003574021.1|2461317_2462238_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003567284.1|2462618_2462825_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2462957_2463215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2463285_2463492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|2463716_2463968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2464295_2465528_+	MFS transporter	NA	NA	NA	NA	NA
WP_003576247.1|2465606_2466863_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	7.3e-99
WP_003588744.1|2466951_2467785_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	9.6e-47
WP_003567298.1|2468101_2468296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571396.1|2468549_2469086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567302.1|2469275_2470499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908632.1|2470734_2471562_-	class C sortase	NA	NA	NA	NA	NA
WP_003605942.1|2471568_2473128_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003605943.1|2473124_2474447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908633.1|2474448_2477454_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_063557695.1|2477731_2478289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003605953.1|2478383_2479580_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003605954.1|2479788_2480844_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003576277.1|2481094_2481724_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_003567322.1|2481859_2482189_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003605955.1|2482185_2482974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567326.1|2483026_2483815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2483859_2484138_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567331.1|2484161_2484446_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003605958.1|2484639_2484936_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2485037_2486393_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2486698_2487010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2487082_2487433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908634.1|2487606_2488986_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
>prophage 11
NZ_CP016355	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 chromosome, complete genome	3063698	2495696	2541504	3063698	transposase,bacteriocin,protease	unidentified_phage(28.57%)	44	NA	NA
WP_032675994.1|2495696_2495870_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567358.1|2495904_2496093_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003605975.1|2496414_2496639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003576301.1|2497439_2498252_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003574021.1|2498368_2499289_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003576302.1|2499591_2499750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576304.1|2499865_2500198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908637.1|2500449_2500641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576308.1|2500956_2501292_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003588841.1|2501410_2502007_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003659595.1|2502277_2502586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567374.1|2502721_2502937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567376.1|2502933_2503167_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567378.1|2503438_2504392_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	6.3e-10
WP_003580891.1|2504596_2505331_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_100908638.1|2505356_2506520_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003576316.1|2506907_2508284_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003567386.1|2508416_2509175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567390.1|2509466_2511074_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003605976.1|2511461_2514179_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	29.0	2.6e-61
WP_003567394.1|2514478_2514844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003591813.1|2514997_2516371_-	MFS transporter	NA	NA	NA	NA	NA
WP_003585581.1|2516410_2517940_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003567401.1|2518066_2518258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567403.1|2518386_2519025_+	cation transporter	NA	NA	NA	NA	NA
WP_003567405.1|2519045_2519378_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003567408.1|2519498_2520440_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567411.1|2520436_2521333_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567413.1|2521329_2522073_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
WP_003605981.1|2522348_2523815_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003567416.1|2524015_2524285_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003567418.1|2524373_2524493_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003576335.1|2524693_2525611_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567422.1|2525850_2526492_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_045603212.1|2526609_2527242_-	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003576340.1|2527398_2527923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003605988.1|2528185_2529982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003605989.1|2530132_2531035_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567431.1|2531278_2531428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019890870.1|2532498_2533914_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003605991.1|2534241_2534922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157810981.1|2537344_2538187_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	3.9e-157
WP_003586983.1|2538240_2538492_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_003574021.1|2540583_2541504_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 1
NZ_CP016356	Lactobacillus paracasei subsp. paracasei strain TMW 1.1434 plasmid pL11434-1, complete sequence	106416	18344	65837	106416	transposase,holin	Lactobacillus_phage(28.57%)	37	NA	NA
WP_003586983.1|18344_18596_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_029327644.1|18649_19492_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
WP_100908707.1|19616_20036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049180014.1|20028_21273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016370737.1|21314_21560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049173609.1|21546_24084_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_021353390.1|25533_25623_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003592338.1|26089_27439_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	49.7	8.6e-122
WP_071799104.1|27480_27675_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099973776.1|28022_28809_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003606765.1|28796_29120_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003589800.1|29463_30342_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_049179988.1|30462_32196_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003589794.1|32222_33647_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_003589792.1|33695_34031_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003590051.1|35536_36094_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_003590049.1|36059_37244_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_004559989.1|37285_38197_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	40.8	7.7e-58
WP_100908377.1|39312_40335_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	7.6e-38
WP_019881966.1|40679_40964_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_003586220.1|40969_41620_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_191982765.1|41695_42505_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_100908727.1|42690_43647_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_019890870.1|43758_45174_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_191982766.1|45175_47362_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002816607.1|47471_48155_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_100908710.1|49013_52598_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.7	1.7e-07
WP_157810991.1|53353_54094_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	4.7e-138
WP_076642703.1|54147_54399_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.7e-37
WP_004559982.1|56031_56610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660088.1|56599_57658_-	replication initiator protein A	NA	A0A220GFI5	Streptococcus_phage	44.4	9.1e-18
WP_049176765.1|57856_59287_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003660085.1|59851_60661_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	58.1	5.2e-82
WP_004559981.1|60662_61061_+	hypothetical protein	NA	F0PIG7	Enterococcus_phage	34.3	9.3e-08
WP_003660079.1|61656_61803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100908712.1|62632_64447_+	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_100908713.1|64916_65837_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	3.4e-37
