The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	6000	60564	2125517	integrase,protease,tRNA,transposase,bacteriocin	Streptococcus_phage(47.06%)	47	2354:2398	53615:53659
2354:2398	attL	ATACTCAATGAAAATCAAAGAGCAAACTAGGAAGCTAGCCGCAGG	NA	NA	NA	NA
WP_032495994.1|6000_6969_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.4e-33
WP_000466653.1|6991_7573_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000526317.1|7602_10953_+	DEAD/DEAH box helicase family protein	NA	A0A2H4P9W3	Gordonia_phage	24.8	2.4e-11
WP_001042998.1|11541_12012_-	arginine repressor	NA	NA	NA	NA	NA
WP_054363793.1|12028_14302_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_054363794.1|14647_17749_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.6	1.5e-113
WP_000820852.1|17831_18839_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042808.1|18897_20403_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000536835.1|21474_21729_-	phage repressor protein	NA	B3GVX0	Streptococcus_phage	61.2	3.3e-19
WP_000749604.1|22164_23037_+	DUF4300 family protein	NA	NA	NA	NA	NA
WP_000420569.1|23669_23981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000759777.1|23984_24701_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617836.1|24829_25645_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123613.1|25641_26547_-	permease	NA	NA	NA	NA	NA
WP_000359141.1|27003_29133_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778592.1|29119_29569_+	SprT family protein	NA	NA	NA	NA	NA
WP_001085044.1|29627_29900_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000680766.1|30253_30445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173358.1|30872_31631_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.7e-27
WP_100931657.1|31632_33621_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_162828736.1|33662_34307_-	VIT family protein	NA	NA	NA	NA	NA
WP_001153866.1|34332_35328_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	36.0	2.4e-36
WP_000661000.1|36034_37510_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001837031.1|37475_38192_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000366713.1|38447_39308_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000088777.1|39304_40564_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000764350.1|40563_41691_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_000969445.1|41687_42773_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.5	1.6e-89
WP_001246755.1|42782_43658_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.1e-77
WP_000593564.1|43838_44648_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602452.1|44919_45141_+|bacteriocin	SP_0924 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000745370.1|45194_45866_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001025704.1|46107_47016_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
WP_000745389.1|47012_47474_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403193.1|47463_48351_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000728269.1|48353_50237_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	22.9	1.2e-09
WP_001844793.1|50316_51447_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.1e-114
WP_000254675.1|51456_52719_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	64.5	2.5e-139
WP_000689710.1|52722_53520_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.9	1.2e-59
WP_000033390.1|53739_54378_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	67.6	6.4e-75
53615:53659	attR	CCTGCGGCTAGCTTCCTAGTTTGCTCTTTGATTTTCATTGAGTAT	NA	NA	NA	NA
WP_000806714.1|54374_55265_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.7	4.9e-73
WP_000358228.1|55304_55622_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166880.1|55624_56494_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	76.1	2.7e-116
WP_001261452.1|56720_57239_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_100931658.1|57982_58787_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001809096.1|58763_59036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083696.1|59229_60564_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	366488	430158	2125517	holin,protease,transposase	Bacillus_phage(28.57%)	59	NA	NA
WP_054363775.1|366488_367442_+|transposase	IS30-like element ISSpn8 family transposase	transposase	H7BWC8	unidentified_phage	35.2	2.1e-34
WP_000705304.1|367761_368610_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.5	4.2e-34
WP_000643970.1|368705_369395_-	NTP transferase domain-containing protein	NA	A0A127AW70	Bacillus_phage	45.0	3.4e-05
WP_000837609.1|369406_370285_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000411210.1|370274_371144_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_000609894.1|371160_372183_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000638527.1|372187_372895_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000835899.1|373230_374718_+	type IV teichoic acid flippase TacF	NA	NA	NA	NA	NA
WP_000811874.1|374727_375531_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	27.1	5.3e-10
WP_001199652.1|375532_376342_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	30.3	9.1e-10
WP_001126409.1|376616_379793_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_000166701.1|380105_381185_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.9	6.3e-59
WP_001293845.1|381234_382158_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.7	8.7e-25
WP_000850024.1|382176_382698_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_000244451.1|382908_383538_-	endonuclease III	NA	NA	NA	NA	NA
WP_000773226.1|383537_384080_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_000389597.1|384249_384567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001812708.1|384805_386365_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	27.5	9.3e-11
WP_000895736.1|386513_387413_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_000219823.1|387414_387975_-	LemA family protein	NA	NA	NA	NA	NA
WP_000801941.1|388068_388782_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000808288.1|389231_390515_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.3	4.0e-60
WP_000863651.1|390709_392281_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000402071.1|392292_392625_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_001246397.1|392715_393081_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_001003498.1|393164_394469_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.2	1.7e-26
WP_000023503.1|394481_395288_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_000002875.1|395498_397274_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_000868700.1|397759_398941_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_000722391.1|398953_400174_-	caspase family protein	NA	NA	NA	NA	NA
WP_000427010.1|400267_401122_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001812200.1|401353_401521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068669.1|401801_402149_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000237416.1|402267_402597_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.8	6.3e-10
WP_000712097.1|402590_402965_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000362434.1|402961_403228_-	chorismate mutase	NA	NA	NA	NA	NA
WP_001162129.1|403343_403787_-	flavodoxin	NA	NA	NA	NA	NA
WP_000401770.1|403890_404826_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_001808393.1|404879_405164_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000028149.1|405220_405439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199556.1|407015_408362_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000711939.1|408857_409028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161801419.1|409040_409610_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	38.5	9.5e-14
WP_000424224.1|411629_412079_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001000318.1|412583_413039_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_000272437.1|413060_414521_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000239905.1|414583_416161_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_001180442.1|416229_417669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000577773.1|417682_418612_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_001071050.1|418622_419555_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000448317.1|419555_420242_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_078063964.1|420958_421717_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001165927.1|421894_422503_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_088778796.1|422737_424089_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.9	5.9e-62
WP_000807140.1|424383_424521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000945307.1|424654_425974_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000356590.1|425976_426717_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	7.0e-09
WP_001058021.1|427538_428942_-	phosphotransferase	NA	NA	NA	NA	NA
WP_000821289.1|429570_430158_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	516398	522176	2125517		Streptococcus_phage(50.0%)	9	NA	NA
WP_001272941.1|516398_517010_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
WP_044792798.1|517054_517783_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272318.1|517821_518733_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	3.8e-89
WP_000926599.1|518798_519023_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590970.1|519100_519844_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.7e-29
WP_001103449.1|519843_520644_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889095.1|520801_521158_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	2.0e-33
WP_001170343.1|521151_521682_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.3	1.4e-46
WP_000405832.1|521681_522176_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.1	1.9e-42
>prophage 4
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	615920	622674	2125517	protease	Streptococcus_phage(50.0%)	9	NA	NA
WP_000081003.1|615920_616889_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	100.0	2.8e-66
WP_000011310.1|616922_617834_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	99.3	9.8e-154
WP_001231105.1|617830_618808_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	99.7	4.4e-184
WP_000163033.1|618804_619695_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	3.9e-06
WP_001140412.1|619746_620127_-	RidA family protein	NA	NA	NA	NA	NA
WP_000422599.1|620137_620725_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_000106346.1|620733_621966_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	4.2e-131
WP_000442275.1|621997_622168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162484.1|622167_622674_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	42.5	6.7e-27
>prophage 5
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	886751	894083	2125517		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_000167845.1|886751_887453_+	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	35.1	1.7e-33
WP_000777248.1|887875_888835_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.8	4.0e-57
WP_001193658.1|888824_889781_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000764303.1|889777_890530_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	5.6e-14
WP_000858241.1|890625_891591_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000821640.1|891815_892058_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.4	1.3e-17
WP_001222228.1|892057_892780_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000105310.1|892766_893336_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	5.0e-15
WP_000351907.1|893354_894083_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.3	5.3e-09
>prophage 6
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	1172782	1251451	2125517	holin,tRNA,protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_000753884.1|1172782_1174768_-|holin	choline-binding protein PcpA	holin	NA	NA	NA	NA
WP_001812165.1|1175102_1175285_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_088795594.1|1175229_1176078_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_076742467.1|1176150_1176513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000251325.1|1176890_1178771_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_000150719.1|1178764_1179634_-	ROK family protein	NA	NA	NA	NA	NA
WP_000432779.1|1179717_1182363_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_000640528.1|1182453_1183734_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_000803398.1|1183904_1185989_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_000721458.1|1186028_1187708_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_000094616.1|1188462_1189692_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000185363.1|1189749_1190766_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000013418.1|1190930_1191878_+	carbamate kinase	NA	NA	NA	NA	NA
WP_001290378.1|1192088_1193600_+	YfcC family protein	NA	NA	NA	NA	NA
WP_000686962.1|1193621_1194953_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_000657757.1|1195618_1195870_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_001808444.1|1196268_1197153_-	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	32.5	6.8e-35
WP_000190398.1|1197297_1198449_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000614264.1|1198594_1200361_-	L-fucose isomerase	NA	NA	NA	NA	NA
WP_001031113.1|1200417_1203534_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_000780609.1|1203543_1205838_-	glycoside hydrolase family 95 protein	NA	NA	NA	NA	NA
WP_000981721.1|1205896_1206697_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_000899623.1|1206693_1207467_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_000020990.1|1207491_1207962_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000483180.1|1207952_1208384_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000912115.1|1208376_1208817_-	fucose isomerase	NA	NA	NA	NA	NA
WP_001286140.1|1208828_1209467_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000388564.1|1209581_1210985_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000588550.1|1211160_1211934_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000724073.1|1213102_1214608_-	zinc ABC transporter substrate-binding lipoprotein AdcA	NA	NA	NA	NA	NA
WP_000950018.1|1214617_1215424_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001269488.1|1215416_1216121_-	metal ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	5.7e-08
WP_001249319.1|1216120_1216561_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000919865.1|1216715_1217984_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_000351967.1|1217976_1218216_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_000969737.1|1218229_1219474_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.4	3.2e-22
WP_000066737.1|1219470_1221021_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.2	1.8e-38
WP_000813667.1|1221041_1221173_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_000071459.1|1221493_1222672_-	MFS transporter	NA	NA	NA	NA	NA
WP_001844696.1|1225470_1226079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001127309.1|1226165_1226369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980819.1|1226559_1227264_-	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	33.5	9.3e-27
WP_000395959.1|1227333_1229160_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_000076776.1|1229201_1230710_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000280547.1|1230868_1232296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000357847.1|1232460_1233333_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_000183312.1|1233319_1234300_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_100931681.1|1234518_1236960_-	pneumococcal surface protein PspC, LPXTG-anchored form	NA	NA	NA	NA	NA
WP_000436492.1|1237162_1238419_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	93.8	3.5e-226
WP_100931682.1|1238621_1240742_-|holin	pneumococcal surface protein PspC, choline-binding form	holin	NA	NA	NA	NA
WP_000241935.1|1240820_1241348_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_000594665.1|1241430_1242762_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_001024077.1|1242758_1243412_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001109675.1|1244053_1246486_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.6	5.0e-128
WP_001211273.1|1246487_1246946_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000136224.1|1247064_1247793_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	1.0e-28
WP_000754546.1|1247792_1248800_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001813866.1|1248838_1249597_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000647691.1|1249559_1249850_-	thiamine-binding protein	NA	NA	NA	NA	NA
WP_000698566.1|1250104_1251451_-|holin	choline binding-anchored murein hydrolase CbpD	holin	NA	NA	NA	NA
>prophage 7
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	1260439	1322758	2125517	tRNA,protease,transposase	Streptococcus_phage(17.65%)	53	NA	NA
WP_000646886.1|1260439_1260838_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000808064.1|1261846_1262887_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000268465.1|1262965_1263745_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000727012.1|1263968_1265147_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_001249454.1|1265240_1265735_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001078983.1|1265734_1266553_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000377893.1|1266611_1267406_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000510410.1|1267398_1268238_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.6	5.2e-16
WP_000835715.1|1268222_1269050_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	2.8e-22
WP_000712132.1|1269046_1269592_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|1269602_1270424_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170202.1|1270465_1271749_-	insulinase family protein	NA	A0A0G2Y5U8	Acanthamoeba_polyphaga_mimivirus	31.0	1.6e-16
WP_000424265.1|1271745_1272996_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.1	1.0e-92
WP_000455899.1|1273154_1273523_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	58.7	5.4e-18
WP_000266658.1|1273525_1274623_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073428.1|1274673_1276152_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
WP_000165444.1|1276303_1277329_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000958770.1|1277534_1279157_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.2	3.4e-48
WP_000834685.1|1279218_1281762_+	YfhO family protein	NA	NA	NA	NA	NA
WP_157807009.1|1281862_1282648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000445498.1|1282669_1283539_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000649625.1|1283905_1285159_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	80.8	5.3e-150
WP_001158266.1|1285418_1285961_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001812112.1|1286321_1287719_+|transposase	ISNCY-like element IS1202 family transposase	transposase	NA	NA	NA	NA
WP_000866075.1|1287978_1288731_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025169508.1|1288727_1290053_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_061649796.1|1290065_1290197_-	competence-stimulating peptide ComC	NA	NA	NA	NA	NA
WP_000695929.1|1290478_1290958_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_000681598.1|1291140_1292322_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.1	1.5e-16
WP_000410381.1|1292379_1293138_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	36.1	1.6e-16
WP_000660615.1|1293350_1294712_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000581147.1|1294870_1296007_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	24.1	2.0e-23
WP_000285191.1|1296071_1296266_+	DUF951 family protein	NA	NA	NA	NA	NA
WP_001218707.1|1296349_1297465_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000163928.1|1297535_1298105_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000258130.1|1298105_1301615_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001234978.1|1301672_1301939_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_000041909.1|1301931_1302300_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_001224760.1|1302419_1303688_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001209049.1|1303684_1304962_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7K9Y8	Acanthocystis_turfacea_chlorella_virus	24.6	6.7e-07
WP_000892185.1|1304965_1305508_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.9	4.7e-10
WP_000744551.1|1305523_1307482_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	45.8	2.4e-109
WP_000588911.1|1307603_1308083_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_100931702.1|1313575_1314421_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000939546.1|1315533_1315770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205044.1|1316000_1317287_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.1	2.7e-72
WP_000291875.1|1317487_1317955_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_000701992.1|1318140_1318584_+	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	47.3	2.1e-29
WP_001836031.1|1318585_1319101_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_073176637.1|1319114_1320476_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001809263.1|1320548_1321046_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000272771.1|1321066_1321411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931684.1|1321407_1322758_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.9	5.9e-62
>prophage 8
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	1335463	1346956	2125517		Synechococcus_phage(33.33%)	7	NA	NA
WP_000668270.1|1335463_1337617_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	1.0e-44
WP_000801615.1|1337629_1338979_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043301.1|1339148_1339856_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	39.2	1.8e-41
WP_000361198.1|1339912_1343638_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.8	2.1e-37
WP_000220639.1|1343730_1345173_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	1.1e-53
WP_001284590.1|1345391_1346414_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	2.1e-64
WP_000717506.1|1346410_1346956_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	7.4e-24
>prophage 9
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	1398828	1423639	2125517	bacteriocin,tRNA	Planktothrix_phage(50.0%)	26	NA	NA
WP_001230165.1|1398828_1399116_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000724257.1|1399167_1401276_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000571330.1|1401272_1401914_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	4.3e-23
WP_001038474.1|1402128_1402935_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099516442.1|1402900_1403371_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_001268157.1|1403659_1404523_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000915346.1|1404988_1405327_+	peptidase C39	NA	NA	NA	NA	NA
WP_000424429.1|1405304_1405676_+|bacteriocin	SPH_0218 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000989850.1|1405683_1405896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000513492.1|1406375_1406621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001812063.1|1406777_1407836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000792249.1|1408149_1409127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424417.1|1409503_1409878_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000511668.1|1409884_1410067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000619744.1|1410085_1410988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424449.1|1411043_1411397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001812064.1|1411393_1412122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770314.1|1413257_1413497_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	54.1	7.2e-16
WP_054380318.1|1414047_1416147_+	pneumococcal surface protein A	NA	NA	NA	NA	NA
WP_001282989.1|1416547_1417669_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000193627.1|1417809_1418265_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000220949.1|1418274_1420188_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000331980.1|1420567_1422247_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000639577.1|1422248_1422482_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000974047.1|1423299_1423452_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
WP_000180806.1|1423453_1423639_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibA	bacteriocin	NA	NA	NA	NA
>prophage 10
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	1621785	1665559	2125517	holin,transposase,protease	Streptococcus_phage(23.08%)	36	NA	NA
WP_001063394.1|1621785_1623891_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.6	5.8e-117
WP_000032550.1|1624291_1624774_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000743624.1|1624868_1626353_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_001156836.1|1626505_1628113_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_001022228.1|1628271_1628445_+	S-ribosylhomocysteinase	NA	NA	NA	NA	NA
WP_050237153.1|1629085_1630363_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_000091092.1|1631454_1632900_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	60.3	2.1e-134
WP_000565349.1|1632901_1633633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664170.1|1633641_1634334_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	56.3	1.1e-61
WP_001142518.1|1634343_1635033_+	polysaccharide biosynthesis tyrosine autokinase CpsD	NA	A0A1X9I5D6	Streptococcus_phage	60.9	3.0e-70
WP_000343584.1|1635043_1636411_+	sugar transferase	NA	NA	NA	NA	NA
WP_001205627.1|1636414_1637158_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_001076786.1|1637154_1637979_+	LicD family protein	NA	A0A1V0SD50	Indivirus	38.7	1.8e-05
WP_000458863.1|1637980_1638859_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000120848.1|1638859_1640197_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_001092839.1|1640219_1641641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000723326.1|1641704_1642793_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.3	1.0e-27
WP_000676141.1|1642831_1643701_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	62.8	2.0e-100
WP_000131456.1|1643701_1644298_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	H9NC63	Sphingomonas_phage	33.1	3.9e-10
WP_000141499.1|1644307_1645357_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.5	8.3e-72
WP_000600901.1|1645422_1646274_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.0	2.5e-26
WP_025169503.1|1646370_1646784_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	24.6	9.0e-06
WP_000245755.1|1646856_1647114_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_050239038.1|1647159_1647306_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001811052.1|1647376_1647535_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_000842609.1|1647733_1649716_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_100931688.1|1650015_1655334_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_001040025.1|1655500_1657660_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_000248787.1|1657656_1658253_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	33.9	8.7e-18
WP_000179555.1|1658318_1658846_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_000146522.1|1658915_1659245_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_000711391.1|1659730_1660888_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_000039276.1|1660900_1662295_+	mid-cell-anchored protein MapZ	NA	NA	NA	NA	NA
WP_000158781.1|1662370_1663795_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.6	1.6e-41
WP_000518016.1|1663806_1664496_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000771105.1|1664593_1665559_+|holin	choline-binding protein CbpC	holin	NA	NA	NA	NA
>prophage 11
NZ_CP025076	Streptococcus pneumoniae strain BHN97x chromosome, complete genome	2125517	1739856	1800973	2125517	bacteriocin,tRNA,transposase	Streptococcus_phage(15.38%)	57	NA	NA
WP_100931690.1|1739856_1741149_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.7	1.1e-240
WP_000989519.1|1741126_1741360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904589.1|1741385_1742447_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000260643.1|1742794_1745119_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	32.9	7.9e-115
WP_100931691.1|1745160_1746453_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	96.5	3.1e-238
WP_000359824.1|1746906_1747464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000384133.1|1747456_1747741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001812228.1|1748352_1748523_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001812227.1|1749083_1749305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001812226.1|1749316_1749541_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001809506.1|1749667_1751107_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000691685.1|1751110_1752460_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_001063601.1|1752647_1753496_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_000403162.1|1753510_1754059_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000693286.1|1754065_1754323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656531.1|1754424_1756107_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.5e-19
WP_001148103.1|1756091_1756922_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000181374.1|1757114_1757618_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000185835.1|1758070_1758634_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000653428.1|1758623_1759274_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000867290.1|1759301_1759691_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_000333647.1|1759695_1760145_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000418402.1|1760272_1760860_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_000105232.1|1761249_1762857_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.0	2.0e-141
WP_000026646.1|1763415_1765047_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000795172.1|1765339_1770319_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001096743.1|1770408_1771605_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000119900.1|1771740_1772268_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_000659547.1|1772344_1772701_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122900.1|1772737_1774084_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_001808898.1|1774179_1774299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410533.1|1774263_1774413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001220774.1|1774864_1776145_+	restriction endonuclease subunit S	NA	A0A1V0SKS6	Klosneuvirus	29.8	2.4e-12
WP_000651181.1|1776201_1776999_+	tyrosine-type DNA invertase PsrA	NA	A0A0H4TI16	Erysipelothrix_phage	28.7	1.7e-21
WP_061450986.1|1777009_1777615_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_050262906.1|1777562_1779113_-	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	25.6	1.7e-12
WP_000029046.1|1779112_1780576_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_000229085.1|1780588_1782922_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	28.9	2.0e-25
WP_001088687.1|1783529_1784039_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_000255769.1|1784202_1785237_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_000046031.1|1785263_1785788_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000034662.1|1786267_1788091_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.2	1.3e-133
WP_000114421.1|1788092_1788449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066301.1|1788850_1789987_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.0	1.7e-22
WP_001812223.1|1790308_1790548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777760.1|1790709_1790997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278301.1|1791006_1791417_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	31.6	3.4e-05
WP_000889919.1|1791484_1792216_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.1e-25
WP_000653766.1|1792212_1793262_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000132572.1|1793429_1793759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000876675.1|1794034_1794373_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001219120.1|1794377_1795115_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001017644.1|1795128_1796469_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000358817.1|1796510_1796666_-	quorum-sensing system pheromone BlpC	NA	NA	NA	NA	NA
WP_001069082.1|1796722_1798084_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_001093257.1|1800499_1800754_+|bacteriocin	two-peptide bacteriocin subunit BlpM	bacteriocin	NA	NA	NA	NA
WP_001099490.1|1800769_1800973_+|bacteriocin	two-peptide bacteriocin subunit BlpN	bacteriocin	NA	NA	NA	NA
