The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	233318	295154	3267348	transposase,integrase	Bacillus_phage(20.0%)	57	266172:266187	298499:298514
WP_100222603.1|233318_234409_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005087083.1|234628_235360_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_075314497.1|235527_236067_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075314499.1|236280_236937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004641424.1|236983_237601_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_002116767.1|237600_238194_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_004641423.1|238298_238676_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_004641419.1|239325_239757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004641416.1|239823_240543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017396591.1|240679_242194_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004641411.1|242315_243770_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	1.3e-14
WP_004641409.1|243788_244553_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	1.7e-29
WP_100833093.1|244941_247296_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_100833094.1|247447_247969_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_100833095.1|248180_249011_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017395581.1|249089_249800_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_005087073.1|249796_250114_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005088555.1|250162_250918_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005088554.1|251026_251911_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005088552.1|252011_252776_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005088550.1|252917_253295_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008941122.1|253395_254490_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004641380.1|254598_255486_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004641379.1|255734_257012_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.3	9.6e-14
WP_100833096.1|257309_258971_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.4e-43
WP_075314523.1|259459_259843_+	cation transporter	NA	NA	NA	NA	NA
WP_005087061.1|260006_260192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005088536.1|260342_260771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833097.1|260825_262247_+	TolC family protein	NA	NA	NA	NA	NA
WP_100833098.1|262251_263493_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005088530.1|263482_266626_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
266172:266187	attL	CGATTTTTACTTTATT	NA	NA	NA	NA
WP_005087053.1|266910_267855_+	cation transporter	NA	NA	NA	NA	NA
WP_004641358.1|267879_268218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833099.1|268444_270064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004641354.1|270232_271168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157809284.1|271457_272372_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_157809285.1|272371_273112_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	45.7	6.5e-31
WP_100833100.1|273227_273587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|273649_274675_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_100833101.1|274665_275121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833102.1|275684_277052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833103.1|277178_277853_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100833104.1|277910_278555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833105.1|278900_280298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833106.1|280382_280598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833107.1|280897_282799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833108.1|282795_283392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833109.1|283393_284245_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_100833110.1|284259_284487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157809302.1|284689_284944_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.8	8.5e-07
WP_100833111.1|286880_287354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833112.1|287350_288538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833113.1|288792_289203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833114.1|290329_291475_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010326927.1|291598_292624_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_100833115.1|292845_294069_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	34.7	7.4e-56
WP_100833116.1|294329_295154_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	30.7	2.1e-14
298499:298514	attR	CGATTTTTACTTTATT	NA	NA	NA	NA
>prophage 2
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	1016274	1056921	3267348	transposase,protease	uncultured_virus(20.0%)	41	NA	NA
WP_020899668.1|1016274_1017102_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.0	1.7e-43
WP_100833413.1|1017599_1018022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833414.1|1018036_1018339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833415.1|1018637_1019540_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	33.7	1.3e-44
WP_100833416.1|1019549_1019783_+	dynamin family protein	NA	NA	NA	NA	NA
WP_100833417.1|1019785_1020058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157809288.1|1020065_1021700_+	dynamin family protein	NA	NA	NA	NA	NA
WP_100223916.1|1021723_1022888_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.2	3.4e-50
WP_100833419.1|1022904_1023582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833420.1|1023595_1024501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833421.1|1024530_1026165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833422.1|1026055_1027381_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100833423.1|1027408_1028538_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100833423.1|1028750_1029880_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100833425.1|1030903_1031305_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_100833426.1|1031320_1031974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833427.1|1032148_1032505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|1032674_1033700_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_100833429.1|1033902_1034100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833430.1|1034270_1034864_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_005081710.1|1035362_1036211_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.4	2.1e-25
WP_005081711.1|1036261_1036930_+	methyltransferase	NA	NA	NA	NA	NA
WP_100833431.1|1037056_1037341_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005081715.1|1037397_1037820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005081717.1|1038107_1039622_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_005081720.1|1039674_1040433_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	9.1e-20
WP_075315975.1|1040672_1042193_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_100833432.1|1042228_1044424_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_100833433.1|1044785_1045142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833434.1|1045155_1046010_+	immunity 49 family protein	NA	NA	NA	NA	NA
WP_100833435.1|1046228_1048058_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_100833436.1|1048454_1049393_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_100833437.1|1049373_1050126_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_004652030.1|1050317_1050608_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.4	2.2e-14
WP_004638311.1|1050665_1052300_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.6	2.1e-175
WP_100833438.1|1052452_1053190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005081744.1|1053245_1053620_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_100833439.1|1053811_1054879_+	4-phosphoerythronate dehydrogenase	NA	A0A285PXZ1	Cedratvirus	31.0	2.8e-19
WP_008940900.1|1054875_1055862_+	EF-P lysine aminoacylase GenX	NA	A0A1V0SAC0	Catovirus	27.8	5.5e-25
WP_005081751.1|1055910_1056090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004638319.1|1056303_1056921_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	1104991	1147492	3267348	transposase,protease	Faecalibacterium_phage(30.0%)	37	NA	NA
WP_100833453.1|1104991_1105654_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_004282326.1|1105949_1106831_+|transposase	IS982-like element ISAba9 family transposase	transposase	NA	NA	NA	NA
WP_100833454.1|1106822_1107044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171265824.1|1107285_1107930_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004638369.1|1108116_1110945_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.5e-22
WP_004638370.1|1111000_1111495_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	28.7	5.4e-05
WP_100833456.1|1111742_1112831_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_004638372.1|1112853_1113549_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_100833457.1|1113689_1114757_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_100834249.1|1114771_1115866_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_100833458.1|1115912_1116380_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017394962.1|1116494_1117127_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005091100.1|1117176_1117878_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_075315915.1|1118345_1119716_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.6e-25
WP_005091096.1|1121483_1122515_+	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	40.1	1.9e-65
WP_100833459.1|1122613_1123615_+	phosphate ABC transporter permease family protein	NA	NA	NA	NA	NA
WP_171055781.1|1123674_1124541_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.3e-14
WP_100833460.1|1124810_1125773_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	25.0	4.7e-21
WP_100833461.1|1126017_1128204_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_100833462.1|1128233_1128881_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_100833463.1|1128919_1129270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833464.1|1129412_1129811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833465.1|1129807_1130356_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_100833466.1|1130355_1132341_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_005081912.1|1132582_1133101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004638396.1|1133162_1134476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171261732.1|1134549_1135212_+	adenylate kinase	NA	NA	NA	NA	NA
WP_100833467.1|1135275_1135458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171265853.1|1135454_1136126_-	endonuclease III	NA	NA	NA	NA	NA
WP_100834250.1|1136142_1136940_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_100833469.1|1137112_1139893_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	50.5	7.1e-280
WP_100833470.1|1139894_1141304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833471.1|1141303_1141741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100834251.1|1141902_1143015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|1143684_1144710_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_010326927.1|1145503_1146529_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_100833472.1|1146556_1147492_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.4	1.3e-23
>prophage 4
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	1753363	1785532	3267348	capsid,transposase	uncultured_virus(20.0%)	28	NA	NA
WP_100833698.1|1753363_1754454_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_100833699.1|1754567_1755047_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_161401269.1|1755335_1756733_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005090707.1|1756761_1757790_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005080952.1|1757789_1758911_-	YdcF family protein	NA	NA	NA	NA	NA
WP_100833701.1|1758925_1759954_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_004638887.1|1759971_1760478_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_001055589.1|1761331_1761715_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|1761711_1762047_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_044099894.1|1762121_1763705_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	3.2e-144
WP_004638885.1|1763859_1764447_+	cytochrome b	NA	NA	NA	NA	NA
WP_020846310.1|1764867_1765800_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_100833702.1|1766063_1767224_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_100833703.1|1767220_1767664_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_100833704.1|1767706_1769743_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	34.3	6.0e-42
WP_100833705.1|1769935_1771099_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005090721.1|1771325_1772387_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_100833423.1|1772592_1773721_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100833706.1|1773762_1774209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075315513.1|1774581_1775148_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004638870.1|1775679_1775997_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100833707.1|1776065_1777772_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	21.5	5.4e-12
WP_075315511.1|1777964_1779167_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_004638863.1|1779173_1779854_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_100833708.1|1779857_1780394_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_075315510.1|1780511_1781771_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_100833423.1|1782480_1783610_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100833709.1|1783684_1785532_-|capsid	phage capsid protein	capsid	A0A1D8EQB5	Escherichia_phage	36.9	7.4e-108
>prophage 5
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	1996386	2091321	3267348	tRNA,transposase,protease,coat	uncultured_Caudovirales_phage(13.04%)	87	NA	NA
WP_100833423.1|1996386_1997516_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100833805.1|1997590_1998241_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_171265834.1|1998233_2000030_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	35.4	1.2e-09
WP_004907081.1|2000022_2000952_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	1.4e-51
WP_100833807.1|2001002_2001569_-	DNA adenine methylase	NA	A0A1P8BMM5	Lactococcus_phage	35.6	2.6e-11
WP_010326927.1|2001596_2002622_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_100833808.1|2003298_2003829_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_100833809.1|2005701_2006115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833810.1|2006341_2008333_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_100833811.1|2008337_2009255_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_005089856.1|2009269_2010229_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_171265835.1|2010310_2010613_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_161412362.1|2010599_2012630_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_004639622.1|2012895_2013465_-	elongation factor P	NA	NA	NA	NA	NA
WP_004639623.1|2013820_2014837_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_075315312.1|2014850_2016605_+	GTPase	NA	NA	NA	NA	NA
WP_075315311.1|2016586_2018680_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004639630.1|2018790_2019015_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_075315310.1|2019214_2020183_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004639634.1|2020322_2020724_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_100833814.1|2020726_2022904_-	MFS transporter	NA	NA	NA	NA	NA
WP_100833815.1|2023091_2025725_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005084828.1|2025789_2026719_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100833816.1|2026866_2027697_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	2.6e-12
WP_004639644.1|2027807_2028581_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	3.4e-54
WP_005084823.1|2028733_2029105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004282326.1|2029250_2030132_+|transposase	IS982-like element ISAba9 family transposase	transposase	NA	NA	NA	NA
WP_100833817.1|2031520_2032540_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_100833818.1|2032536_2035068_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004897297.1|2035068_2035869_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004897296.1|2035888_2036404_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004897294.1|2036415_2036970_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_075316573.1|2037030_2037567_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_075316574.1|2037724_2038258_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155771060.1|2038367_2038577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833423.1|2039220_2040350_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075315307.1|2040749_2041112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005084819.1|2041291_2041687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005089835.1|2041839_2042988_+	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	38.1	2.8e-65
WP_017396770.1|2043085_2043625_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017396771.1|2043880_2044369_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_100833819.1|2044373_2045507_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004639780.1|2045525_2046257_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_005084804.1|2046311_2047700_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	6.8e-98
WP_100833820.1|2047802_2048195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157809303.1|2048218_2048986_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	36.1	9.8e-22
WP_100833423.1|2049013_2050143_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100833822.1|2051695_2052526_-	protein kinase	NA	A0A1V0SH95	Hokovirus	30.0	4.8e-06
WP_005084723.1|2052500_2054009_-	DUF3336 domain-containing protein	NA	NA	NA	NA	NA
WP_075315290.1|2054190_2055081_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100833823.1|2055180_2056281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833824.1|2056460_2057039_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100833825.1|2057035_2057959_+	EamA family transporter	NA	NA	NA	NA	NA
WP_100833826.1|2058055_2058559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639865.1|2058756_2059764_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.1	5.3e-124
WP_005084707.1|2059908_2060124_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004639869.1|2060153_2060600_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	4.2e-17
WP_100833827.1|2060675_2061035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833828.1|2061071_2061437_-	GFA family protein	NA	NA	NA	NA	NA
WP_100833829.1|2061485_2061980_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100833830.1|2062004_2063447_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_100834267.1|2063571_2064159_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_100833831.1|2064260_2065226_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	27.4	1.0e-15
WP_100833832.1|2065243_2065894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833833.1|2066161_2067262_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_100833834.1|2067404_2067752_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100833835.1|2067741_2068206_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_100833836.1|2068267_2069566_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	46.3	9.8e-107
WP_004639896.1|2069570_2070182_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	55.3	2.8e-48
WP_004639899.1|2070472_2070703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026056278.1|2070847_2071075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639915.1|2072465_2072684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833837.1|2073301_2075941_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.9	1.8e-35
WP_008942028.1|2076050_2076590_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004639922.1|2076838_2077168_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_171055802.1|2077343_2078000_+	peptidase M15	NA	NA	NA	NA	NA
WP_100834268.1|2078134_2078803_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	36.7	1.3e-25
WP_100833839.1|2078922_2079765_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.6	5.0e-35
WP_100833840.1|2079881_2080499_-	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.8	8.2e-11
WP_075315236.1|2080488_2081088_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.7	8.5e-21
WP_075315232.1|2081181_2082372_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005084652.1|2086232_2086979_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-21
WP_005084650.1|2086978_2087527_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_008942035.1|2087510_2088059_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004639946.1|2088103_2088643_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_100833841.1|2088646_2089624_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	8.9e-36
WP_004639950.1|2089899_2091321_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.7	1.6e-54
>prophage 6
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	2584807	2635842	3267348	transposase,tRNA,protease	uncultured_Mediterranean_phage(20.0%)	50	NA	NA
WP_100834012.1|2584807_2586589_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.0	4.5e-17
WP_004908914.1|2586749_2586971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100834013.1|2586976_2587849_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_004697721.1|2587870_2588707_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_004697719.1|2588866_2589775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004697717.1|2589835_2590783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004907081.1|2591685_2592615_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	1.4e-51
WP_151831383.1|2593356_2593818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100834014.1|2593821_2594733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100834015.1|2594787_2595546_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_100834016.1|2595561_2596557_-	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_042874730.1|2596588_2597344_-	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	27.6	5.9e-11
WP_100834017.1|2597510_2598671_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	49.2	4.7e-100
WP_017396019.1|2598812_2599739_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_100834279.1|2599767_2602515_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_100834018.1|2602587_2603859_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	4.4e-19
WP_100834019.1|2604318_2605353_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_075314797.1|2605416_2606403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100834020.1|2606508_2607537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100834021.1|2607599_2608169_+	LemA family protein	NA	NA	NA	NA	NA
WP_005083369.1|2608265_2609393_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.2	2.2e-94
WP_004640804.1|2609492_2609822_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_004640806.1|2609874_2611776_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004640807.1|2611786_2612755_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.1	5.4e-33
WP_100834022.1|2612817_2613465_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_004640809.1|2613524_2614934_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004640811.1|2615308_2616451_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_004640812.1|2616450_2617149_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004640814.1|2617173_2618466_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005083384.1|2618462_2619578_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_100834023.1|2619599_2620394_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005083387.1|2620384_2621137_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_100834024.1|2621202_2622438_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_004640823.1|2622558_2622990_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	2.0e-19
WP_004640824.1|2623099_2623300_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004640826.1|2623382_2623934_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_100834025.1|2623957_2625244_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_100834026.1|2625441_2626287_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A0U4JGQ0	Vibrio_phage	36.5	7.0e-05
WP_100834027.1|2626286_2627099_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_100834028.1|2627134_2628100_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_100834029.1|2628186_2628828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004282326.1|2628886_2629768_-|transposase	IS982-like element ISAba9 family transposase	transposase	NA	NA	NA	NA
WP_004640836.1|2630073_2630502_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004640839.1|2630514_2630901_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004640842.1|2631032_2631689_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_100834030.1|2631702_2632128_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	47.3	7.3e-27
WP_004640846.1|2632143_2632800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100222603.1|2633304_2634395_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_100834031.1|2634428_2634704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100222603.1|2634752_2635842_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	2754633	2831153	3267348	transposase	Faecalibacterium_phage(18.18%)	59	NA	NA
WP_010326927.1|2754633_2755659_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_100222603.1|2756312_2757402_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004637744.1|2757766_2758411_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.0	4.1e-21
WP_005083749.1|2758434_2759451_-	ferrochelatase	NA	NA	NA	NA	NA
WP_075316280.1|2759520_2760549_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_100834089.1|2760646_2761534_-	glutamate racemase	NA	NA	NA	NA	NA
WP_100834090.1|2761575_2762187_-	DUF1285 domain-containing protein	NA	NA	NA	NA	NA
WP_004637739.1|2762374_2764087_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_100834091.1|2764210_2764468_-	sulfurtransferase TusA	NA	NA	NA	NA	NA
WP_017395247.1|2764673_2765483_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_100834092.1|2765479_2767039_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_004637735.1|2767126_2767471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004637734.1|2767734_2768364_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_075316285.1|2768363_2769569_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_100834093.1|2769717_2771943_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_100834094.1|2771983_2773801_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005083783.1|2773909_2774782_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_100834095.1|2774891_2775242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100834096.1|2775405_2776368_+	DnaJ domain-containing protein	NA	M1PC06	Moumouvirus	53.0	5.7e-11
WP_004637727.1|2776379_2776706_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100834097.1|2776735_2777959_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_171265868.1|2778043_2780131_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_004637724.1|2780384_2780654_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_100834099.1|2780891_2782190_+	serine hydrolase	NA	NA	NA	NA	NA
WP_100834100.1|2782585_2783239_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_100834101.1|2783608_2785414_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	22.0	3.3e-20
WP_100834102.1|2785453_2789167_-	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	22.3	1.3e-10
WP_100834103.1|2789170_2792821_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_004637719.1|2793026_2793527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942295.1|2793710_2795042_+	MFS transporter	NA	NA	NA	NA	NA
WP_100834104.1|2795071_2796490_-	phosphate--AMP phosphotransferase	NA	NA	NA	NA	NA
WP_005083809.1|2796695_2797403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075316296.1|2797594_2798536_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_100834105.1|2798546_2799233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004637712.1|2799245_2800865_+	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.0	3.9e-28
WP_017396560.1|2801168_2802548_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_100834106.1|2802634_2803543_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_100834107.1|2803554_2804352_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.2e-33
WP_100834108.1|2804562_2805879_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_100834109.1|2805904_2806285_+	VOC family protein	NA	NA	NA	NA	NA
WP_005083825.1|2806376_2807144_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_100834110.1|2807153_2808662_+	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	35.8	1.7e-78
WP_100834111.1|2808776_2810159_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005083831.1|2810405_2813249_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005083834.1|2813250_2813619_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005088013.1|2813618_2815430_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_004637698.1|2815429_2815957_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_004637697.1|2815953_2816229_+	monovalent cation/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_100834112.1|2816240_2816606_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_125501153.1|2816726_2817125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171265840.1|2817277_2817973_-	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_100834114.1|2817934_2819078_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100834115.1|2819118_2819310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171265841.1|2819328_2822964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100834117.1|2822902_2826457_-	calcium-binding protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	42.0	1.8e-17
WP_010326927.1|2826472_2827498_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_100834118.1|2827535_2828261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100834119.1|2829310_2830096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020846310.1|2830220_2831153_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
>prophage 8
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	2987047	3031336	3267348	transposase,integrase	uncultured_Caudovirales_phage(20.0%)	31	2982828:2982843	3006558:3006573
2982828:2982843	attL	TTTGATAGTTATCAGA	NA	NA	NA	NA
WP_000999878.1|2987047_2988937_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_023188010.1|2988929_2989628_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_100834137.1|2989766_2990393_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100834288.1|2990440_2991229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100834138.1|2991650_2992421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100834139.1|2992916_2994242_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_075316355.1|2994345_2994873_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	1.3e-60
WP_004637541.1|2994991_2995390_-	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	40.5	6.2e-12
WP_005087879.1|2995539_2995926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100834140.1|2995994_2997674_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	4.8e-37
WP_004637538.1|2997830_3000050_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.7	7.1e-81
WP_005087871.1|3000159_3000804_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004637533.1|3000856_3001339_-	YchJ family protein	NA	NA	NA	NA	NA
WP_004637531.1|3001541_3003125_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	1.1e-38
WP_004282326.1|3003414_3004296_+|transposase	IS982-like element ISAba9 family transposase	transposase	NA	NA	NA	NA
WP_008942400.1|3004434_3005061_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.0	3.0e-13
WP_100834142.1|3005115_3007110_-	alkaline phosphatase	NA	NA	NA	NA	NA
3006558:3006573	attR	TTTGATAGTTATCAGA	NA	NA	NA	NA
WP_100834143.1|3007274_3008663_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_100834144.1|3008768_3009530_+	glycoside hydrolase family 25 protein	NA	A0A1U9WQS3	Geobacillus_phage	31.9	2.4e-20
WP_171265870.1|3009531_3010587_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_005084062.1|3010984_3011347_+	RidA family protein	NA	NA	NA	NA	NA
WP_004637523.1|3011343_3011874_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_100834146.1|3012192_3014577_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.7	4.3e-116
WP_100222603.1|3014941_3016031_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_171265842.1|3015926_3016421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004282326.1|3017027_3017909_+|transposase	IS982-like element ISAba9 family transposase	transposase	NA	NA	NA	NA
WP_005084075.1|3018816_3019368_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_171057128.1|3019418_3020348_-	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	51.5	4.8e-71
WP_100834147.1|3020534_3020921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100834148.1|3020953_3022573_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_010326927.1|3030310_3031336_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
>prophage 9
NZ_CP018260	Acinetobacter haemolyticus strain XH900 chromosome, complete genome	3267348	3068133	3127723	3267348	transposase,tRNA,integrase	Enterobacteria_phage(18.18%)	53	3086706:3086753	3139500:3139547
WP_075316385.1|3068133_3069933_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004637470.1|3070292_3070904_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_005085700.1|3070963_3071617_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_100834151.1|3071713_3072112_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005085704.1|3072108_3073056_-	pirin family protein	NA	NA	NA	NA	NA
WP_080546029.1|3073209_3073392_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_100834152.1|3073624_3074116_-	flavin reductase	NA	NA	NA	NA	NA
WP_004637464.1|3074301_3075330_-	methionine synthase	NA	NA	NA	NA	NA
WP_075316391.1|3075357_3076359_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_075316392.1|3076709_3076922_+	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_100834153.1|3077073_3077682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316393.1|3077656_3078538_-	DNA cytosine methyltransferase	NA	F2Y1T1	Organic_Lake_phycodnavirus	43.8	1.6e-60
WP_004637461.1|3078540_3080109_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	8.7e-25
WP_171055760.1|3080556_3081783_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_005092510.1|3081840_3082209_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_004637457.1|3082341_3082764_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004637456.1|3082988_3083630_+	DedA family protein	NA	NA	NA	NA	NA
WP_005085714.1|3083653_3084244_-	LysE family transporter	NA	NA	NA	NA	NA
WP_004637453.1|3084456_3084843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100834154.1|3084855_3085695_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	25.1	4.2e-10
WP_100834155.1|3085776_3086169_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_100834156.1|3086178_3086487_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
3086706:3086753	attL	ACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA	NA	NA	NA	NA
WP_010588955.1|3087254_3087473_-	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	54.8	2.4e-10
WP_004985715.1|3087583_3087799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004985718.1|3087812_3088994_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	30.7	6.5e-41
WP_004985719.1|3088986_3089235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031977697.1|3089303_3089864_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_004985725.1|3089874_3090621_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	39.3	1.3e-47
WP_100222603.1|3090931_3092022_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000543471.1|3093828_3094326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004985686.1|3097016_3097541_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100834157.1|3097555_3097945_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_004985683.1|3097971_3098274_+	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_004985681.1|3098579_3099527_+	pirin family protein	NA	NA	NA	NA	NA
WP_004985679.1|3099523_3099922_+	OsmC family protein	NA	NA	NA	NA	NA
WP_004985675.1|3100022_3100664_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_017396282.1|3100828_3102091_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_001040037.1|3102674_3103607_+|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.9e-59
WP_100834158.1|3103685_3104381_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100834159.1|3105730_3106402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004527.1|3106401_3108729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000557620.1|3112017_3112380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001060549.1|3112503_3114864_+	DEAD/DEAH box helicase family protein	NA	W8W2E1	Invertebrate_iridovirus	29.2	1.3e-32
WP_001005874.1|3115150_3115459_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016164863.1|3115455_3116745_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_016164864.1|3116762_3120110_-	DEAD/DEAH box helicase	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	31.4	3.0e-51
WP_016164865.1|3121440_3122361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005064486.1|3122383_3123316_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
WP_000734101.1|3123428_3123749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004282326.1|3123885_3124767_-|transposase	IS982-like element ISAba9 family transposase	transposase	NA	NA	NA	NA
WP_000733361.1|3124852_3125236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|3125729_3126065_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_044099894.1|3126139_3127723_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	3.2e-144
3139500:3139547	attR	ACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA	NA	NA	NA	NA
