The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025053	Pseudomonas aeruginosa strain PB354 chromosome, complete genome	6434352	622161	744018	6434352	terminase,lysis,head,tail,tRNA,portal,plate,capsid	Pseudomonas_phage(53.85%)	130	NA	NA
WP_033876353.1|622161_623283_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	25.8	4.1e-08
WP_003113217.1|623541_623679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725766.1|624281_624464_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	54.2	2.2e-09
WP_019725767.1|624496_624919_+	transcriptional regulator	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	46.7	6.1e-26
WP_031672615.1|625164_626136_-	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	94.1	2.9e-172
WP_023126965.1|626120_626813_-	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	40.3	1.5e-40
WP_031672617.1|626809_627352_-	hypothetical protein	NA	A0A0U4J942	Pseudomonas_phage	87.1	1.3e-81
WP_100882537.1|627348_628272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100199590.1|628268_628586_-|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	70.3	3.3e-32
WP_019725774.1|628741_631363_-	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	53.7	5.9e-159
WP_100882538.1|631372_631897_-|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	95.4	8.6e-94
WP_034018116.1|631889_633062_-	phage protein	NA	A0A0U4JJ14	Pseudomonas_phage	91.3	4.0e-208
WP_019725777.1|633058_633376_-	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	94.2	1.2e-45
WP_100882539.1|633372_635742_-|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	64.1	7.7e-251
WP_031673345.1|635919_636207_-	phage protein	NA	A0A0U4B0P2	Pseudomonas_phage	80.0	1.4e-34
WP_031673343.1|636203_636719_-|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	70.8	6.1e-44
WP_031673342.1|636715_637177_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	94.1	1.5e-73
WP_031673341.1|637173_637479_-	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	38.6	1.7e-09
WP_100882540.1|637475_637688_-	conjugal transfer protein TraR	NA	A0A0U4IIN4	Pseudomonas_phage	82.6	2.1e-27
WP_023122750.1|637687_638137_-	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	85.2	4.0e-68
WP_023107713.1|638140_639256_-	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	83.3	6.5e-176
WP_031673337.1|639268_639937_-	virion morphogenesis protein	NA	A0A0U4ISN1	Pseudomonas_phage	92.2	6.4e-110
WP_019725788.1|639929_640367_-|tail	tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	91.0	3.8e-71
WP_019725789.1|640366_640828_-|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	95.4	3.8e-77
WP_100882541.1|640925_641660_-|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	99.6	1.0e-132
WP_012074147.1|641656_642679_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	100.0	1.1e-193
WP_100882542.1|642678_643824_-|capsid	capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	100.0	4.3e-146
WP_100882543.1|643789_645838_+|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	99.7	0.0e+00
WP_025982286.1|645749_646604_+|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	100.0	3.1e-133
WP_019725794.1|646648_646906_+	transcriptional regulator	NA	R9TNQ2	Vibrio_phage	42.9	3.6e-13
WP_019725795.1|647471_647750_-	hypothetical protein	NA	A0A0U4B0R1	Pseudomonas_phage	100.0	1.4e-47
WP_019725796.1|647746_647977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725797.1|647973_648219_-	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	100.0	1.0e-36
WP_019725798.1|648211_648478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725799.1|648548_648908_-	hypothetical protein	NA	A0A0U4JXA4	Pseudomonas_phage	100.0	3.5e-62
WP_100199592.1|648937_649261_-	hypothetical protein	NA	A0A0U4JP55	Pseudomonas_phage	100.0	4.4e-56
WP_019725801.1|649300_649702_-	hypothetical protein	NA	A0A0U4IIM6	Pseudomonas_phage	100.0	6.4e-73
WP_100882544.1|650143_652834_-	hypothetical protein	NA	A0A0U3TH43	Pseudomonas_phage	99.9	0.0e+00
WP_019725803.1|652843_653074_-	hypothetical protein	NA	A0A0U4KLD7	Pseudomonas_phage	100.0	8.2e-33
WP_019725804.1|653171_653411_+	helix-turn-helix transcriptional regulator	NA	A0A0U4ISL7	Pseudomonas_phage	100.0	2.6e-37
WP_100882545.1|654634_658372_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
WP_003085035.1|658478_660332_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_023910070.1|660411_662406_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_003085042.1|662488_662938_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085057.1|663007_663223_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003129196.1|663423_664449_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|664527_665097_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|665180_665534_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_023122963.1|665524_666067_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|666039_667272_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_023113350.1|667315_667822_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|667916_669470_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|669466_670738_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|670838_672761_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|673039_673372_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|673415_674267_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|674266_674647_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|674683_675490_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_031633752.1|675605_676592_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|676588_677881_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_031633753.1|677861_680636_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_023128360.1|680762_681779_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003117959.1|681775_682450_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|682451_683210_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003099546.1|683210_684272_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003113207.1|684423_686817_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|686862_687495_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|687623_688658_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|688891_690001_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_100882546.1|690056_691103_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|691217_692465_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|692570_693401_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_100882547.1|693524_694199_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|694198_695017_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_015649712.1|695089_696568_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|696885_697200_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|697299_698070_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_100882548.1|698527_698728_+	conjugal transfer protein TraR	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003459419.1|698775_699135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|699497_699947_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|699968_700484_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003121844.1|700480_701038_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003085143.1|701190_701517_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003161928.1|701513_702401_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003118911.1|702393_702927_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_003161927.1|702928_705034_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.7	3.0e-222
WP_016852415.1|705041_705482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019681189.1|705524_706685_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.2	2.0e-188
WP_003085175.1|706697_707201_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_100882549.1|707215_707560_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_031633756.1|707729_709967_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_100882550.1|709976_710849_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	5.1e-75
WP_003101635.1|710823_711030_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003109053.1|711087_712077_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.3e-106
WP_031633757.1|712109_712739_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_004355109.1|712735_713098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118919.1|713094_713352_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|713668_714163_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_004352265.1|714174_714522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|714551_714806_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_031633760.1|714852_716691_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|716683_717025_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_049290815.1|717032_717728_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003113184.1|717730_718501_+	hypothetical protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_034083863.1|718555_719158_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	6.5e-53
WP_031633762.1|719216_722876_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.2	0.0e+00
WP_157814485.1|723173_723851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031633763.1|723938_724991_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	50.6	6.4e-64
WP_003113177.1|724990_725293_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003161916.1|725289_725520_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	70.3	1.4e-24
WP_023098405.1|725938_726544_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|726545_727595_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|727591_728428_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
WP_003085214.1|728489_729134_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085219.1|729405_729828_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003085223.1|730147_730942_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085224.1|730996_731644_-	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_003085225.1|731743_732082_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003101642.1|732160_733642_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.5	6.7e-67
WP_003113172.1|733681_734482_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003459458.1|734542_735619_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003117983.1|735740_736709_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085245.1|736725_737148_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_058180648.1|737438_738473_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_100882551.1|738472_739192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120826.1|739192_739615_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|739692_740043_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_016252941.1|740096_741188_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_073652934.1|741190_742534_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003101660.1|742818_744018_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP025053	Pseudomonas aeruginosa strain PB354 chromosome, complete genome	6434352	1240916	1277431	6434352	terminase,integrase,head,tRNA,holin,portal,protease	uncultured_Caudovirales_phage(38.1%)	39	1250980:1250997	1273961:1273978
WP_003113794.1|1240916_1243769_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	1.0e-148
WP_023085547.1|1243889_1244258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100593.1|1244269_1244698_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_003092867.1|1244694_1246182_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	1.0e-51
WP_023113283.1|1246518_1247331_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034050628.1|1247414_1248338_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003092864.1|1248529_1249648_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003092863.1|1249640_1250708_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003100603.1|1250839_1251337_-	RDD family protein	NA	NA	NA	NA	NA
1250980:1250997	attL	AGCGCAGCAGCGCCTGGA	NA	NA	NA	NA
WP_003092861.1|1251466_1253047_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_079388247.1|1253543_1254545_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	98.6	6.8e-156
WP_075116609.1|1254625_1255612_+	hypothetical protein	NA	A4PE73	Ralstonia_virus	38.4	6.4e-50
WP_034065893.1|1255614_1255902_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_100882582.1|1255959_1256259_-	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	93.0	4.0e-48
WP_100882583.1|1256367_1257720_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	43.9	4.1e-79
WP_100882969.1|1257706_1258138_-	hypothetical protein	NA	H2BD44	Pseudomonas_phage	90.0	6.0e-61
WP_100882584.1|1258134_1260132_-	DNA cytosine methyltransferase	NA	J7HXB9	Pseudomonas_phage	94.7	0.0e+00
WP_086823673.1|1260128_1260674_-	phosphohydrolase	NA	A0A2D1GNL9	Pseudomonas_phage	47.7	2.4e-30
WP_031630972.1|1260682_1261417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031630969.1|1261842_1262079_-	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	39.0	1.4e-06
WP_031630967.1|1262075_1262444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025325120.1|1262440_1262725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100882585.1|1262736_1263306_-	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	49.5	3.0e-44
WP_031630962.1|1263302_1263608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078452081.1|1263977_1264643_-	peptidase S24	NA	U5P0T5	Shigella_phage	31.9	3.8e-22
WP_031630957.1|1264724_1264958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726643.1|1265121_1265622_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	61.3	1.6e-33
WP_019726642.1|1265614_1265857_+	repressor, PtrB	NA	Q9ZXI6	Pseudomonas_virus	53.0	2.7e-10
WP_031632199.1|1265853_1268592_+	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	64.2	0.0e+00
WP_157814486.1|1268931_1269489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031630948.1|1269687_1270053_+	hypothetical protein	NA	E5E3W4	Burkholderia_phage	48.2	1.0e-13
WP_025325111.1|1270057_1270336_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_100882586.1|1270338_1271076_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.6	1.1e-43
WP_023087718.1|1271331_1271922_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	54.5	8.8e-47
WP_100882587.1|1271925_1273941_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	63.9	3.3e-258
WP_019396964.1|1273952_1274177_+	hypothetical protein	NA	NA	NA	NA	NA
1273961:1273978	attR	AGCGCAGCAGCGCCTGGA	NA	NA	NA	NA
WP_100882588.1|1274176_1275643_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	65.8	2.5e-175
WP_100882589.1|1275626_1276799_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.6	1.0e-86
WP_023096402.1|1276795_1277431_+|head	head decoration protein	head	NA	NA	NA	NA
>prophage 3
NZ_CP025053	Pseudomonas aeruginosa strain PB354 chromosome, complete genome	6434352	1284074	1301351	6434352	tRNA	Pseudomonas_phage(25.0%)	17	NA	NA
WP_100882591.1|1284074_1287626_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	34.9	2.2e-177
WP_016561962.1|1287625_1288627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023103635.1|1288623_1289484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882592.1|1289480_1291241_+	hypothetical protein	NA	A0A2I7S8R8	Vibrio_phage	24.1	1.1e-23
WP_003096116.1|1291240_1291477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882593.1|1291722_1292352_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	88.5	3.9e-101
WP_100882594.1|1292348_1292717_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	80.3	4.8e-43
WP_100882595.1|1292713_1292974_+	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	75.6	1.4e-28
WP_058164654.1|1293118_1293922_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	65.0	1.4e-100
WP_023130683.1|1293991_1294258_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	96.6	3.5e-43
WP_100882596.1|1294239_1294926_-	SOS response-associated peptidase	NA	A0A2K8I970	Pseudomonas_phage	87.7	5.0e-118
WP_043553536.1|1294963_1295479_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	94.7	4.5e-95
WP_003143120.1|1295941_1296985_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003100607.1|1296997_1298116_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.9	6.7e-96
WP_003092856.1|1298159_1298498_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.4	5.8e-11
WP_003100609.1|1298557_1300420_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003100612.1|1300430_1301351_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.9	1.9e-51
>prophage 4
NZ_CP025053	Pseudomonas aeruginosa strain PB354 chromosome, complete genome	6434352	1523616	1532645	6434352		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1523616_1524252_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003143263.1|1524297_1525191_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1525295_1526300_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1526726_1527050_-	Ferredoxin 1	NA	NA	NA	NA	NA
WP_003113873.1|1527116_1529684_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_033993593.1|1529809_1530817_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1530964_1531471_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1531604_1532645_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 5
NZ_CP025053	Pseudomonas aeruginosa strain PB354 chromosome, complete genome	6434352	2647736	2654630	6434352	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003160440.1|2647736_2649017_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	4.8e-98
WP_003160439.1|2649018_2650416_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2650420_2651395_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2651482_2652466_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|2652462_2652798_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|2652794_2653100_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2653099_2653459_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2653455_2653851_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2653961_2654630_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 6
NZ_CP025053	Pseudomonas aeruginosa strain PB354 chromosome, complete genome	6434352	3438565	3493980	6434352	terminase,integrase,head,tail,holin,portal,protease,capsid	Pseudomonas_phage(72.73%)	75	3436057:3436072	3493707:3493722
3436057:3436072	attL	CGGCGAGCAGGGCCGC	NA	NA	NA	NA
WP_100882743.1|3438565_3438829_-	hypothetical protein	NA	J7I447	Pseudomonas_phage	96.6	1.1e-44
WP_100882744.1|3438864_3439125_-	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	88.4	2.6e-35
WP_100882745.1|3439222_3439525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157814488.1|3439524_3439701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882747.1|3439866_3440259_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	84.4	1.1e-45
WP_025297798.1|3440255_3440690_-	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	100.0	5.1e-76
WP_019395862.1|3441021_3441354_-	hypothetical protein	NA	A0A127KNU7	Pseudomonas_phage	97.5	1.0e-39
WP_100882748.1|3441815_3443072_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_034080588.1|3443136_3444807_-	hypothetical protein	NA	A0A2H5BQA0	Pseudomonas_phage	71.3	6.8e-177
WP_100882749.1|3444867_3447597_-	hypothetical protein	NA	H2BD95	Pseudomonas_phage	98.2	0.0e+00
WP_033946887.1|3447568_3447976_-	C40 family peptidase	NA	J7HX80	Pseudomonas_phage	97.0	1.1e-72
WP_033867886.1|3447980_3448472_-	DUF1833 domain-containing protein	NA	H2BDC5	Pseudomonas_virus	98.8	3.5e-89
WP_033936236.1|3448455_3448935_-	hypothetical protein	NA	Q9MCA0	Pseudomonas_phage	98.1	2.5e-92
WP_100882750.1|3448931_3451460_-|tail	phage tail tape measure protein	tail	A0A0U4JEA4	Pseudomonas_phage	89.9	0.0e+00
WP_003158969.1|3451786_3452146_-	hypothetical protein	NA	Q9MCA4	Pseudomonas_phage	100.0	1.2e-59
WP_034076445.1|3452155_3452677_-|tail	phage major tail protein	tail	A0A0U4ISC1	Pseudomonas_phage	99.4	2.6e-95
WP_003158971.1|3452751_3453117_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	100.0	9.9e-65
WP_100882751.1|3453119_3453614_-	HK97 gp10 family phage protein	NA	Q9MCA7	Pseudomonas_phage	98.6	2.6e-76
WP_100882975.1|3453606_3454164_-	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	97.8	1.0e-108
WP_003140663.1|3454174_3455002_-	hypothetical protein	NA	D4FUL8	Pseudomonas_phage	87.3	1.2e-147
WP_003140666.1|3455005_3455365_-	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	70.0	1.0e-42
WP_023081903.1|3455426_3456149_-	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	100.0	8.9e-134
WP_033969598.1|3456353_3456710_-|head	phage head closure protein	head	Q9XJT0	Pseudomonas_phage	94.1	1.2e-59
WP_012614021.1|3456710_3457031_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0U4JX27	Pseudomonas_phage	100.0	1.8e-54
WP_012614020.1|3457011_3457608_-	hypothetical protein	NA	H2BDB2	Pseudomonas_virus	92.4	2.8e-109
WP_033979590.1|3457774_3458962_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	99.0	8.4e-214
WP_033955147.1|3458958_3459849_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	100.0	1.7e-166
WP_033979592.1|3459980_3461243_-|portal	phage portal protein	portal	Q9XJT5	Pseudomonas_phage	97.1	1.4e-235
WP_033979594.1|3461396_3463088_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	98.2	0.0e+00
WP_012614015.1|3463089_3463470_-	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	99.2	1.2e-65
WP_058200136.1|3463682_3463997_-	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	97.1	1.8e-54
WP_033942785.1|3464246_3464498_-	hypothetical protein	NA	Q9MC38	Pseudomonas_phage	98.8	3.1e-41
WP_100882753.1|3464497_3464716_-	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	87.9	1.2e-25
WP_003101053.1|3465066_3465351_-|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	100.0	5.0e-48
WP_023104105.1|3465343_3465712_-	hypothetical protein	NA	A0A0S2SYH4	Pseudomonas_phage	100.0	1.3e-61
WP_100883011.1|3466434_3467013_-	hypothetical protein	NA	A0A125RNL1	Pseudomonas_phage	96.9	5.5e-102
WP_033945916.1|3467080_3467398_-	hypothetical protein	NA	Q9MC45	Pseudomonas_phage	94.3	8.1e-47
WP_100883012.1|3467397_3468042_-	hypothetical protein	NA	A0A0S2SY91	Pseudomonas_phage	91.1	2.2e-107
WP_024007938.1|3468038_3468509_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	72.4	3.5e-62
WP_100883013.1|3468501_3468717_-	conjugal transfer protein TraR	NA	A0A0S2SYW7	Pseudomonas_phage	78.6	1.4e-23
WP_034011419.1|3468718_3469228_-	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	99.4	5.8e-87
WP_023081923.1|3469340_3470726_-	replicative DNA helicase	NA	A0A127KNK8	Pseudomonas_phage	52.3	2.7e-123
WP_073663221.1|3470718_3471414_-	helix-turn-helix domain-containing protein	NA	H2BD69	Pseudomonas_phage	62.5	1.0e-30
WP_052154638.1|3471425_3472016_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_100883014.1|3472213_3472786_-	hypothetical protein	NA	A0A0S2SYA8	Pseudomonas_phage	98.9	4.8e-98
WP_057391093.1|3472821_3473058_-	hypothetical protein	NA	O48419	Enterobacteria_phage	49.1	1.5e-05
WP_078451938.1|3473256_3473895_+	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	63.5	2.1e-54
WP_100883015.1|3474605_3475127_+	HNH endonuclease	NA	A0A1B1W266	Salmonella_phage	43.2	7.6e-26
WP_157814489.1|3475199_3475361_+	hypothetical protein	NA	A0A0S3UG60	Pseudomonas_phage	100.0	1.3e-24
WP_033942813.1|3475403_3475622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882767.1|3476208_3476697_+	DUF1566 domain-containing protein	NA	H2BDH2	Pseudomonas_virus	88.3	1.1e-74
WP_100882976.1|3476892_3477399_+	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	49.3	8.4e-30
WP_023875446.1|3477436_3477793_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_100882768.1|3478065_3479205_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.4	6.5e-46
WP_077148986.1|3479227_3479440_+	DUF551 domain-containing protein	NA	W6MW45	Pseudomonas_phage	97.0	7.3e-36
WP_100882769.1|3479456_3479729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096306278.1|3479763_3480177_+	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	99.3	1.3e-76
WP_023098762.1|3480667_3480892_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	100.0	3.7e-38
WP_100882770.1|3480888_3481248_+	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	86.8	5.7e-57
WP_157814490.1|3481244_3481781_+	hypothetical protein	NA	A0A2H4J611	uncultured_Caudovirales_phage	33.7	2.4e-19
WP_100882773.1|3482096_3482312_+	hypothetical protein	NA	H2BDF4	Pseudomonas_virus	59.0	2.3e-13
WP_100882774.1|3482618_3483683_+	hypothetical protein	NA	B5WZW5	Pseudomonas_phage	97.5	4.6e-86
WP_079864584.1|3483823_3484444_+	ERF family protein	NA	Q9MC70	Pseudomonas_phage	100.0	2.3e-106
WP_003097967.1|3484447_3485074_+	exonuclease	NA	A0A125RNR2	Pseudomonas_phage	100.0	6.4e-120
WP_100882775.1|3485070_3485406_+	LytTR family transcriptional regulator	NA	H2BDF6	Pseudomonas_virus	96.4	1.9e-54
WP_100882777.1|3487197_3487476_+	hypothetical protein	NA	W6MVL9	Pseudomonas_phage	65.1	2.7e-30
WP_100882778.1|3487468_3487849_+	hypothetical protein	NA	A0A0U4K5D6	Pseudomonas_phage	94.4	4.6e-57
WP_100882779.1|3487845_3488259_+	hypothetical protein	NA	A0A218M341	Acidovorax_phage	62.9	2.6e-05
WP_157814491.1|3488432_3489014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882780.1|3489168_3489441_+	hypothetical protein	NA	A0A127KNQ8	Pseudomonas_phage	73.6	1.7e-29
WP_100882781.1|3489437_3489704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882782.1|3489696_3490518_+	ead/Ea22-like family protein	NA	Q9MC82	Pseudomonas_phage	52.7	1.4e-53
WP_100882977.1|3490685_3490892_+	hypothetical protein	NA	B5WZV2	Pseudomonas_phage	96.6	4.8e-24
WP_100882783.1|3491142_3492360_+|integrase	site-specific integrase	integrase	A0A0U4B0G7	Pseudomonas_phage	99.0	9.5e-229
WP_003111315.1|3492390_3493980_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	5.9e-61
3493707:3493722	attR	CGGCGAGCAGGGCCGC	NA	NA	NA	NA
>prophage 7
NZ_CP025053	Pseudomonas aeruginosa strain PB354 chromosome, complete genome	6434352	4788430	4880764	6434352	terminase,integrase,head,tail,tRNA,holin,portal,protease,capsid	Pseudomonas_phage(69.86%)	113	4821203:4821222	4884513:4884532
WP_003085573.1|4788430_4789399_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003101974.1|4789489_4790236_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003101972.1|4790228_4790930_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|4790990_4791908_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|4791900_4792590_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_023086589.1|4792586_4792964_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003101969.1|4793132_4793987_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003085555.1|4793992_4795792_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	1.5e-20
WP_003101964.1|4795941_4797366_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.0	3.4e-28
WP_003110245.1|4797405_4797861_-	positive regulator for alginate biosynthesis MucC	NA	NA	NA	NA	NA
WP_003101960.1|4797857_4798808_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|4798816_4799401_-	sigma factor AlgU negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|4799432_4800014_-	RNA polymerase sigma-H factor	NA	NA	NA	NA	NA
WP_023118258.1|4800422_4802039_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003114181.1|4802007_4802460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085532.1|4802443_4802698_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_003101947.1|4802970_4803915_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|4804015_4804852_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_003101943.1|4804860_4806243_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|4806235_4806907_-	response regulator	NA	NA	NA	NA	NA
WP_003114177.1|4807117_4808401_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|4808430_4809414_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003101933.1|4809462_4809933_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_023116055.1|4809943_4811461_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003114172.1|4811453_4812491_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106436.1|4812617_4813313_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_023104850.1|4813412_4814234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106441.1|4814290_4815172_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003116510.1|4815304_4816813_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003085499.1|4816824_4817988_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003085498.1|4818053_4818872_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003114169.1|4818930_4820034_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003454697.1|4820145_4821042_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_023120841.1|4821098_4821743_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
4821203:4821222	attL	CGGCAGCCTCCTGCTGCTGG	NA	NA	NA	NA
WP_003098346.1|4821858_4822500_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003159576.1|4822534_4824511_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.8	2.4e-160
WP_100882867.1|4824688_4824952_-	hypothetical protein	NA	J7I447	Pseudomonas_phage	94.3	5.9e-43
WP_073658712.1|4824987_4825248_-	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	89.5	9.0e-36
WP_100882868.1|4825244_4825613_-	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	86.9	3.2e-47
WP_100882869.1|4825609_4826239_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	97.6	1.2e-113
WP_100882870.1|4826283_4828359_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	35.7	9.0e-62
WP_100882871.1|4828371_4830048_-	hypothetical protein	NA	A0A291I973	Pseudomonas_phage	72.6	5.2e-185
WP_100882749.1|4830108_4832838_-	hypothetical protein	NA	H2BD95	Pseudomonas_phage	98.2	0.0e+00
WP_033946887.1|4832809_4833217_-	C40 family peptidase	NA	J7HX80	Pseudomonas_phage	97.0	1.1e-72
WP_033867886.1|4833221_4833713_-	DUF1833 domain-containing protein	NA	H2BDC5	Pseudomonas_virus	98.8	3.5e-89
WP_033936236.1|4833696_4834176_-	hypothetical protein	NA	Q9MCA0	Pseudomonas_phage	98.1	2.5e-92
WP_100882750.1|4834172_4836701_-|tail	phage tail tape measure protein	tail	A0A0U4JEA4	Pseudomonas_phage	89.9	0.0e+00
WP_003158969.1|4837027_4837387_-	hypothetical protein	NA	Q9MCA4	Pseudomonas_phage	100.0	1.2e-59
WP_034076445.1|4837396_4837918_-|tail	phage major tail protein	tail	A0A0U4ISC1	Pseudomonas_phage	99.4	2.6e-95
WP_003158971.1|4837992_4838358_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	100.0	9.9e-65
WP_100882751.1|4838360_4838855_-	HK97 gp10 family phage protein	NA	Q9MCA7	Pseudomonas_phage	98.6	2.6e-76
WP_100882975.1|4838847_4839405_-	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	97.8	1.0e-108
WP_003140663.1|4839415_4840243_-	hypothetical protein	NA	D4FUL8	Pseudomonas_phage	87.3	1.2e-147
WP_003140666.1|4840246_4840606_-	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	70.0	1.0e-42
WP_023081903.1|4840667_4841390_-	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	100.0	8.9e-134
WP_033969598.1|4841594_4841951_-|head	phage head closure protein	head	Q9XJT0	Pseudomonas_phage	94.1	1.2e-59
WP_012614021.1|4841951_4842272_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0U4JX27	Pseudomonas_phage	100.0	1.8e-54
WP_012614020.1|4842252_4842849_-	hypothetical protein	NA	H2BDB2	Pseudomonas_virus	92.4	2.8e-109
WP_033979590.1|4843015_4844203_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	99.0	8.4e-214
WP_033955147.1|4844199_4845090_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	100.0	1.7e-166
WP_033979592.1|4845221_4846484_-|portal	phage portal protein	portal	Q9XJT5	Pseudomonas_phage	97.1	1.4e-235
WP_033979594.1|4846637_4848329_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	98.2	0.0e+00
WP_012614015.1|4848330_4848711_-	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	99.2	1.2e-65
WP_058200136.1|4848923_4849238_-	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	97.1	1.8e-54
WP_033942785.1|4849487_4849739_-	hypothetical protein	NA	Q9MC38	Pseudomonas_phage	98.8	3.1e-41
WP_100882753.1|4849738_4849957_-	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	87.9	1.2e-25
WP_003101053.1|4850307_4850592_-|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	100.0	5.0e-48
WP_003158986.1|4850584_4850953_-	hypothetical protein	NA	A0A0S2SYH4	Pseudomonas_phage	97.5	1.3e-59
WP_058181479.1|4851254_4851452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100882756.1|4852591_4853170_-	hypothetical protein	NA	Q9MC44	Pseudomonas_phage	96.4	2.7e-101
WP_100882757.1|4853237_4853819_-	hypothetical protein	NA	A0A125RNK9	Pseudomonas_phage	87.2	2.3e-95
WP_079386495.1|4853815_4854082_-	hypothetical protein	NA	H2BDI6	Pseudomonas_virus	84.1	2.4e-36
WP_100882758.1|4854177_4854480_-	hypothetical protein	NA	A0A2R3UAJ1	Myoviridae_environmental_samples	47.8	1.8e-19
WP_100882759.1|4854476_4854893_-	hypothetical protein	NA	A0A0S2SYC1	Pseudomonas_phage	97.1	4.1e-75
WP_100882760.1|4854885_4855122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140689.1|4855121_4855319_-	hypothetical protein	NA	A0A0U4JX40	Pseudomonas_phage	100.0	5.4e-33
WP_100882761.1|4855318_4855522_-	conjugal transfer protein TraR	NA	A0A0S2SYW7	Pseudomonas_phage	97.0	1.5e-30
WP_100882762.1|4855514_4855916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100882763.1|4856031_4857861_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	92.4	0.0e+00
WP_049228436.1|4857857_4858730_-	YdaU family protein	NA	A0A2I7RGZ2	Vibrio_phage	74.1	6.3e-41
WP_100882764.1|4858729_4858915_-	hypothetical protein	NA	A0A0U4IIX2	Pseudomonas_phage	95.1	2.7e-26
WP_100882765.1|4859111_4859684_-	hypothetical protein	NA	A0A0S2SYA8	Pseudomonas_phage	98.9	5.7e-99
WP_023108940.1|4859719_4859920_-	hypothetical protein	NA	A0A0U4K5A6	Pseudomonas_phage	100.0	1.4e-28
WP_015648588.1|4860028_4860808_+	hypothetical protein	NA	A0A0U4JEE2	Pseudomonas_phage	100.0	7.6e-139
WP_033942807.1|4860837_4861488_+	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	100.0	3.4e-124
WP_023102151.1|4861643_4862162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023120647.1|4862158_4862914_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_157814489.1|4863603_4863765_+	hypothetical protein	NA	A0A0S3UG60	Pseudomonas_phage	100.0	1.3e-24
WP_033942813.1|4863807_4864026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882767.1|4864612_4865101_+	DUF1566 domain-containing protein	NA	H2BDH2	Pseudomonas_virus	88.3	1.1e-74
WP_100882976.1|4865296_4865803_+	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	49.3	8.4e-30
WP_023875446.1|4865840_4866197_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_100882768.1|4866469_4867609_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.4	6.5e-46
WP_077148986.1|4867631_4867844_+	DUF551 domain-containing protein	NA	W6MW45	Pseudomonas_phage	97.0	7.3e-36
WP_100882769.1|4867860_4868133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096306278.1|4868167_4868581_+	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	99.3	1.3e-76
WP_023098762.1|4869071_4869296_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	100.0	3.7e-38
WP_100882770.1|4869292_4869652_+	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	86.8	5.7e-57
WP_157814490.1|4869648_4870185_+	hypothetical protein	NA	A0A2H4J611	uncultured_Caudovirales_phage	33.7	2.4e-19
WP_100882773.1|4870500_4870716_+	hypothetical protein	NA	H2BDF4	Pseudomonas_virus	59.0	2.3e-13
WP_100882774.1|4871022_4872087_+	hypothetical protein	NA	B5WZW5	Pseudomonas_phage	97.5	4.6e-86
WP_079864584.1|4872227_4872848_+	ERF family protein	NA	Q9MC70	Pseudomonas_phage	100.0	2.3e-106
WP_003097967.1|4872851_4873478_+	exonuclease	NA	A0A125RNR2	Pseudomonas_phage	100.0	6.4e-120
WP_100882775.1|4873474_4873810_+	LytTR family transcriptional regulator	NA	H2BDF6	Pseudomonas_virus	96.4	1.9e-54
WP_100882777.1|4875601_4875880_+	hypothetical protein	NA	W6MVL9	Pseudomonas_phage	65.1	2.7e-30
WP_100882778.1|4875872_4876253_+	hypothetical protein	NA	A0A0U4K5D6	Pseudomonas_phage	94.4	4.6e-57
WP_100882779.1|4876249_4876663_+	hypothetical protein	NA	A0A218M341	Acidovorax_phage	62.9	2.6e-05
WP_157814491.1|4876836_4877418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882780.1|4877572_4877845_+	hypothetical protein	NA	A0A127KNQ8	Pseudomonas_phage	73.6	1.7e-29
WP_100882781.1|4877841_4878108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100882782.1|4878100_4878922_+	ead/Ea22-like family protein	NA	Q9MC82	Pseudomonas_phage	52.7	1.4e-53
WP_100882977.1|4879089_4879296_+	hypothetical protein	NA	B5WZV2	Pseudomonas_phage	96.6	4.8e-24
WP_100882783.1|4879546_4880764_+|integrase	site-specific integrase	integrase	A0A0U4B0G7	Pseudomonas_phage	99.0	9.5e-229
4884513:4884532	attR	CGGCAGCCTCCTGCTGCTGG	NA	NA	NA	NA
