The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	0	17404	4075361		Bacillus_virus(16.67%)	14	NA	NA
WP_003421192.1|461_611_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003429494.1|636_858_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003421190.1|877_1420_+	transcription termination/antitermination factor NusG	NA	G3MAW2	Bacillus_virus	30.9	1.6e-10
WP_003421189.1|1458_1884_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003421188.1|1954_2653_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003421187.1|2875_3382_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003421186.1|3439_3805_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003436172.1|4195_4984_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.2	1.3e-05
WP_003436174.1|5454_9171_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.8	3.0e-47
WP_003429485.1|9212_12698_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	28.0	2.0e-74
WP_003436176.1|12986_13409_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003421180.1|13532_14003_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003436178.1|14051_16118_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	27.0	1.3e-60
WP_009887863.1|16210_17404_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	28.8	9.6e-08
>prophage 2
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	33735	39166	4075361	tRNA	Planktothrix_phage(33.33%)	7	NA	NA
WP_003435660.1|33735_34569_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.0	4.6e-17
WP_003435657.1|34556_35423_+	energy-coupling factor transporter ATPase	NA	A0A1V0SE00	Indivirus	30.6	8.2e-17
WP_003427737.1|35416_36220_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003435654.1|36251_36983_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003421107.1|37102_37534_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003421105.1|37562_37955_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003435644.1|38413_39166_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A067ZJB6	Vibrio_phage	30.5	4.9e-10
>prophage 3
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	53214	56127	4075361		Clostridium_phage(100.0%)	2	NA	NA
WP_003436320.1|53214_55566_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	44.5	4.9e-173
WP_003432598.1|55587_56127_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	45.3	1.1e-30
>prophage 4
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	77054	80500	4075361		Bacillus_phage(50.0%)	2	NA	NA
WP_011860638.1|77054_78401_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.1	8.3e-24
WP_003432446.1|78667_80500_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.8	1.1e-116
>prophage 5
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	84799	94753	4075361	protease	Clostridium_phage(40.0%)	9	NA	NA
WP_003432452.1|84799_85864_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	36.0	4.1e-34
WP_003432453.1|85929_86598_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003420727.1|86695_86956_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	58.7	2.1e-16
WP_003420729.1|87152_88172_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_021373188.1|88187_88616_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_009887970.1|88726_89236_-|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	40.4	3.8e-30
WP_003432462.1|89664_90858_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	68.3	2.4e-152
WP_003425444.1|91172_92270_+	membrane protein	NA	NA	NA	NA	NA
WP_021373189.1|92533_94753_+	ATP-dependent RecD-like DNA helicase	NA	A0A0H3UZA5	Geobacillus_virus	32.4	1.5e-70
>prophage 6
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	104552	108349	4075361		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_009895216.1|104552_107228_+	preprotein translocase subunit SecA	NA	V5LQX0	Emiliania_huxleyi_virus	61.4	7.7e-05
WP_177451831.1|107242_108349_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	53.4	2.1e-09
>prophage 7
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	116003	117020	4075361	tRNA	Moraxella_phage(100.0%)	1	NA	NA
WP_011860650.1|116003_117020_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	44.1	1.0e-71
>prophage 8
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	126311	126974	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_003434446.1|126311_126974_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.3e-30
>prophage 9
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	130402	133095	4075361		Bacillus_phage(66.67%)	3	NA	NA
WP_009895237.1|130402_131089_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.2	2.9e-25
WP_009895239.1|131099_132341_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	7.1e-22
WP_003434455.1|132411_133095_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	4.8e-36
>prophage 10
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	143848	145762	4075361		Tupanvirus(100.0%)	1	NA	NA
WP_003434478.1|143848_145762_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.4	2.6e-63
>prophage 11
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	152782	153970	4075361		Orpheovirus(100.0%)	1	NA	NA
WP_021362125.1|152782_153970_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	34.1	4.2e-48
>prophage 12
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	159643	164177	4075361		Clostridium_phage(33.33%)	5	NA	NA
WP_003434503.1|159643_160666_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	55.8	4.3e-33
WP_003434504.1|160961_161882_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	42.5	7.1e-59
WP_003434506.1|161920_162613_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_021364990.1|162605_163508_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003420885.1|163592_164177_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	28.1	2.2e-05
>prophage 13
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	170347	176479	4075361		uncultured_virus(50.0%)	6	NA	NA
WP_003420907.1|170347_170632_+	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	42.6	1.4e-13
WP_021373200.1|170664_172293_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.7	5.8e-157
WP_003435015.1|172554_173295_+	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	44.8	4.0e-20
WP_003435017.1|173378_174113_+	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_021373201.1|174142_174562_+	DUF111 family protein	NA	NA	NA	NA	NA
WP_003425341.1|174943_176479_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.7	1.2e-23
>prophage 14
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	180136	183565	4075361		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_021373205.1|180136_183565_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	37.6	2.2e-177
>prophage 15
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	193613	211732	4075361	transposase	Synechococcus_phage(20.0%)	16	NA	NA
WP_003435056.1|193613_194012_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	96.2	2.5e-69
WP_016729235.1|194008_195172_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	98.7	5.0e-219
WP_009895309.1|195555_196068_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	87.6	3.5e-84
WP_021373210.1|196517_196994_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	6.9e-26
WP_003420966.1|196999_197698_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	43.9	1.5e-45
WP_003425288.1|197709_199077_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.0	2.6e-49
WP_021373211.1|199070_200147_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.2	2.9e-64
WP_003436064.1|200140_200734_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.4	4.3e-25
WP_003436063.1|200726_202259_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	49.7	2.3e-38
WP_003436062.1|202269_203520_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_021373212.1|203544_207351_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.5	1.0e-31
WP_021373213.1|207556_208429_+	dTDP-4-dehydrorhamnose reductase	NA	H9NCE8	Sphingomonas_phage	30.0	2.3e-14
WP_003436059.1|208537_209407_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	61.1	8.1e-97
WP_003436058.1|209455_210013_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.6	1.3e-47
WP_021358779.1|210050_211034_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.0	1.1e-78
WP_021373214.1|211063_211732_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	47.7	1.1e-24
>prophage 16
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	229997	231089	4075361		Moumouvirus(100.0%)	1	NA	NA
WP_021364180.1|229997_231089_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	32.9	3.7e-38
>prophage 17
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	250305	251007	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_009901765.1|250305_251007_+	FliA/WhiG family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	25.6	2.1e-07
>prophage 18
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	256042	257980	4075361		Catovirus(100.0%)	1	NA	NA
WP_003435963.1|256042_257980_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	32.0	4.6e-60
>prophage 19
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	274263	276480	4075361		Clostridium_phage(50.0%)	3	NA	NA
WP_003435932.1|274263_275358_+	helix-turn-helix transcriptional regulator	NA	A0A090D830	Clostridium_phage	33.7	1.2e-07
WP_003425157.1|275362_275563_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021360108.1|275562_276480_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.8	2.1e-31
>prophage 20
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	283309	284821	4075361		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003435916.1|283309_284821_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	2.2e-17
>prophage 21
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	295189	297965	4075361		Streptococcus_phage(100.0%)	2	NA	NA
WP_003437587.1|295189_295555_+	helix-turn-helix domain-containing protein	NA	E4ZFI8	Streptococcus_phage	40.4	7.2e-15
WP_021360114.1|295577_297965_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.9	5.1e-117
>prophage 22
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	306320	309027	4075361		Staphylococcus_phage(50.0%)	3	NA	NA
WP_021362166.1|306320_307244_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.4	4.3e-40
WP_003434209.1|307400_308324_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_009895385.1|308325_309027_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	1.5e-32
>prophage 23
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	314366	320391	4075361		Acanthocystis_turfacea_Chlorella_virus(33.33%)	5	NA	NA
WP_009895392.1|314366_315185_+	energy-coupling factor ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	27.8	8.6e-08
WP_009888186.1|315439_317704_+	DUF3553 domain-containing protein	NA	A7KV33	Bacillus_phage	44.5	6.7e-143
WP_021373235.1|317720_319019_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003434193.1|319049_319802_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_003434191.1|319866_320391_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.6	4.2e-24
>prophage 24
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	329198	329870	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_003434821.1|329198_329870_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	2.6e-34
>prophage 25
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	358314	359313	4075361		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003431407.1|358314_359313_-	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	34.8	3.7e-45
>prophage 26
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	372033	382846	4075361		Erysipelothrix_phage(25.0%)	6	NA	NA
WP_003434581.1|372033_373395_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	34.8	6.8e-58
WP_100852712.1|373792_375856_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003434587.1|375852_377718_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	22.2	5.3e-13
WP_074049750.1|378680_379169_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.0	8.9e-53
WP_003434602.1|379682_379910_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003434605.1|379906_382846_+	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	21.7	4.6e-11
>prophage 27
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	388724	390658	4075361		Clostridium_phage(66.67%)	3	NA	NA
WP_003426228.1|388724_388928_+	DUF4236 domain-containing protein	NA	A0A0A8WIL0	Clostridium_phage	74.1	1.5e-14
WP_003434650.1|389098_390259_+	cell wall-binding protein Cwp27	NA	A0A2R2ZGK6	Clostridioides_phage	49.5	2.9e-70
WP_003434654.1|390517_390658_+	hypothetical protein	NA	A0A0A8WIQ0	Clostridium_phage	90.7	2.3e-14
>prophage 28
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	404847	405708	4075361		Streptococcus_phage(100.0%)	1	NA	NA
WP_009895481.1|404847_405708_+	helix-turn-helix transcriptional regulator	NA	D0R0F8	Streptococcus_phage	33.0	2.2e-06
>prophage 29
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	409917	410601	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_009888282.1|409917_410601_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	7.1e-32
>prophage 30
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	414619	415282	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_021373248.1|414619_415282_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	1.8e-24
>prophage 31
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	425483	425870	4075361		Clostridium_phage(100.0%)	1	NA	NA
WP_003417583.1|425483_425870_-	BlaI/MecI/CopY family transcriptional regulator	NA	X5JAW5	Clostridium_phage	31.7	3.7e-09
>prophage 32
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	430429	438243	4075361		Bacillus_phage(50.0%)	7	NA	NA
WP_003434737.1|430429_431134_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.6	4.7e-55
WP_003434740.1|431130_431901_+	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_009895519.1|431897_432677_+	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_003434748.1|432728_433421_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	4.1e-27
WP_021363246.1|433439_434864_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.6	3.7e-30
WP_021373251.1|435103_437572_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016728742.1|437574_438243_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	6.1e-36
>prophage 33
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	441915	445706	4075361		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_003426351.1|441915_442743_-	carbon-nitrogen hydrolase family protein	NA	M1HRJ8	Acanthocystis_turfacea_Chlorella_virus	28.9	2.1e-22
WP_003417824.1|443124_443445_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_003426355.1|443577_444258_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_021362218.1|444653_445706_+	galactitol-1-phosphate 5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.2	1.3e-13
>prophage 34
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	448875	450229	4075361		Clostridioides_phage(100.0%)	2	NA	NA
WP_021373253.1|448875_450015_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	93.7	2.5e-199
WP_003426367.1|450040_450229_+	hypothetical protein	NA	A0A1V0E014	Clostridioides_phage	88.7	1.4e-19
>prophage 35
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	455408	460476	4075361		Clostridioides_phage(33.33%)	5	NA	NA
WP_021373819.1|455408_456119_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	36.7	4.7e-26
WP_003439054.1|456257_456386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021373255.1|456379_457699_+	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	38.1	5.5e-73
WP_003439058.1|458164_459463_+	radical SAM protein	NA	NA	NA	NA	NA
WP_021358865.1|459459_460476_+	radical SAM protein	NA	D5GV91	Campylobacter_virus	29.7	1.6e-08
>prophage 36
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	465806	469866	4075361		Planktothrix_phage(33.33%)	3	NA	NA
WP_021358866.1|465806_466481_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.9e-29
WP_003439072.1|466464_468207_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	2.5e-36
WP_003439074.1|468621_469866_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	31.1	1.8e-09
>prophage 37
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	476358	482930	4075361		Hokovirus(50.0%)	4	NA	NA
WP_003439079.1|476358_477966_+	DUF4118 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.8	4.6e-13
WP_003439080.1|477956_478661_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011860847.1|478947_479106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011860848.1|479831_482930_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	29.3	1.7e-08
>prophage 38
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	492291	499530	4075361		Streptococcus_phage(25.0%)	8	NA	NA
WP_003439096.1|492291_493203_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	33.5	5.6e-16
WP_003439097.1|493377_493875_+	effector binding domain-containing protein	NA	NA	NA	NA	NA
WP_003439098.1|494618_494981_+	response regulator	NA	A0A220YL79	Alteromonas_virus	29.2	3.5e-06
WP_032506523.1|495045_495663_+	chemotaxis protein CheC	NA	NA	NA	NA	NA
WP_003425085.1|495659_496145_+	chemotaxis protein CheD	NA	NA	NA	NA	NA
WP_009888332.1|496187_496706_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_009895564.1|496841_497801_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	1.4e-25
WP_003425090.1|497826_499530_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.5e-09
>prophage 39
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	504856	505846	4075361		Klosneuvirus(100.0%)	1	NA	NA
WP_003439110.1|504856_505846_+	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	30.4	5.5e-17
>prophage 40
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	512565	513837	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_003425119.1|512565_513837_-	spore cortex-lytic protein SleC	NA	A0A127AWA8	Bacillus_phage	42.0	6.2e-05
>prophage 41
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	523067	523904	4075361		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003438990.1|523067_523904_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.5	2.1e-30
>prophage 42
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	527885	530123	4075361		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003438993.1|527885_530123_+	ATP-binding protein	NA	A0A2H4UU76	Bodo_saltans_virus	32.7	9.9e-06
>prophage 43
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	539335	545124	4075361	transposase,tRNA	Tupanvirus(50.0%)	3	NA	NA
WP_009888359.1|539335_541255_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.9	1.3e-144
WP_021360187.1|542022_543114_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_021381444.1|543783_545124_+	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	38.6	2.0e-78
>prophage 44
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	551346	556941	4075361		Hokovirus(50.0%)	4	NA	NA
WP_011860863.1|551346_553914_+	pyruvate, phosphate dikinase	NA	A0A1V0SGR7	Hokovirus	38.9	4.6e-47
WP_021360195.1|554173_554323_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021369859.1|554531_555413_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011860865.1|555762_556941_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	27.3	1.5e-08
>prophage 45
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	569841	576435	4075361		Streptococcus_phage(100.0%)	6	NA	NA
WP_021387349.1|569841_571941_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.5	3.7e-71
WP_003438917.1|571983_572379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011860871.1|573400_573589_+	lipoprotein	NA	NA	NA	NA	NA
WP_003438911.1|573772_574213_-	DUF3788 domain-containing protein	NA	NA	NA	NA	NA
WP_003438907.1|574567_575881_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	40.8	2.8e-93
WP_003429542.1|575898_576435_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	69.7	1.2e-63
>prophage 46
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	579816	580350	4075361		Streptococcus_phage(100.0%)	1	NA	NA
WP_009902015.1|579816_580350_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	49.4	1.2e-34
>prophage 47
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	588479	589817	4075361		Clostridium_phage(100.0%)	1	NA	NA
WP_021365097.1|588479_589817_-	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	23.9	1.5e-12
>prophage 48
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	593534	594287	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_009895631.1|593534_594287_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	6.9e-28
>prophage 49
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	602093	605557	4075361		Clostridioides_phage(50.0%)	2	NA	NA
WP_021373281.1|602093_603332_+	conserved phage C-terminal domain-containing protein	NA	A0A1V0E018	Clostridioides_phage	35.1	2.5e-11
WP_003437698.1|604255_605557_+	AAA family ATPase	NA	A0A218KST2	Xenohaliotis_phage	29.3	1.1e-20
>prophage 50
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	622794	624711	4075361		Bacillus_phage(50.0%)	2	NA	NA
WP_021373287.1|622794_623712_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.6	1.6e-18
WP_021373288.1|623784_624711_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.4	2.3e-41
>prophage 51
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	639353	642447	4075361		Streptococcus_phage(50.0%)	3	NA	NA
WP_021362269.1|639353_640610_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.8	1.1e-94
WP_016728654.1|640672_641866_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003434522.1|642066_642447_+	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WHZ2	Clostridium_phage	63.4	3.5e-36
>prophage 52
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	651448	651949	4075361	holin	Clostridium_phage(100.0%)	1	NA	NA
WP_003434540.1|651448_651949_+|holin	holin-like glycosylating toxin export protein TcdE	holin	A0A090D848	Clostridium_phage	83.5	1.8e-56
>prophage 53
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	661143	661842	4075361		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004454330.1|661143_661842_-	glycosylating toxin anti-sigma factor TcdC	NA	O64371	Lactobacillus_phage	54.2	8.4e-20
>prophage 54
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	665387	670781	4075361		Staphylococcus_phage(25.0%)	4	NA	NA
WP_009895699.1|665387_666302_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	1.0e-41
WP_009888460.1|666472_667180_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	4.2e-35
WP_021373293.1|667224_668631_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.2	1.9e-07
WP_003426867.1|670391_670781_+	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WFF9	Clostridium_phage	47.2	2.1e-28
>prophage 55
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	687169	693387	4075361		Aeromonas_phage(33.33%)	4	NA	NA
WP_003439138.1|687169_688768_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	26.0	5.4e-22
WP_003429728.1|688802_689825_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003439135.1|690301_691705_-	AAA family ATPase	NA	H8ZJI5	Ostreococcus_tauri_virus	44.7	6.2e-99
WP_011860916.1|692877_693387_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.5	5.9e-15
>prophage 56
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	711308	712328	4075361	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003436795.1|711308_712328_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.4	4.3e-33
>prophage 57
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	716974	731819	4075361	tRNA	Phage_TP(25.0%)	9	NA	NA
WP_021373300.1|716974_719557_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.2	2.1e-28
WP_003436878.1|719660_720239_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003436879.1|720272_720749_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_009895755.1|721266_722088_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_032507379.1|722310_724824_+	transporter substrate-binding domain-containing protein	NA	G3MA91	Bacillus_virus	30.8	5.3e-16
WP_003436882.1|725027_726479_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_009895762.1|726797_729176_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	31.9	4.6e-09
WP_003436884.1|729243_729657_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_003436885.1|730118_731819_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	38.4	3.4e-99
>prophage 58
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	748094	749480	4075361		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_021373304.1|748094_749480_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	4.2e-47
>prophage 59
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	759104	760043	4075361		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_021366239.1|759104_760043_+	radical SAM protein	NA	A0A1B1IVD8	uncultured_Mediterranean_phage	27.8	4.9e-07
>prophage 60
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	775380	785806	4075361		Pseudomonas_phage(25.0%)	6	NA	NA
WP_009895801.1|775380_778410_+	EAL domain-containing protein	NA	A0A2K8I9Y5	Pseudomonas_phage	42.7	6.0e-06
WP_003436959.1|778486_780553_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	31.7	1.9e-83
WP_003432207.1|781706_782522_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009888558.1|782549_783227_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003432205.1|783285_784008_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.9e-28
WP_009895806.1|784654_785806_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	29.3	2.9e-33
>prophage 61
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	792074	798258	4075361		Tetraselmis_virus(66.67%)	4	NA	NA
WP_021373310.1|792074_792809_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	30.0	2.3e-28
WP_009902143.1|792968_795200_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.7	7.7e-184
WP_003437463.1|795492_796554_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_003437464.1|796644_798258_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	38.3	2.7e-69
>prophage 62
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	807229	807994	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_011860953.1|807229_807994_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0A0RV91	Bacillus_phage	43.4	5.7e-46
>prophage 63
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	821711	823262	4075361		Klosneuvirus(100.0%)	1	NA	NA
WP_009902156.1|821711_823262_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	32.0	3.5e-58
>prophage 64
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	827358	832921	4075361		Streptococcus_phage(33.33%)	7	NA	NA
WP_009895825.1|827358_828003_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.8	8.8e-32
WP_003437529.1|828088_828466_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003437532.1|828465_828852_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003437535.1|829030_829786_+	NAD(+) synthase	NA	E3SLH5	Synechococcus_phage	34.5	1.8e-28
WP_003437537.1|829868_830588_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003437541.1|830754_831759_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009892786.1|832024_832921_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	33.8	2.9e-33
>prophage 65
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	857742	860438	4075361		Bacillus_phage(33.33%)	3	NA	NA
WP_009888625.1|857742_858435_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	8.5e-33
WP_021404140.1|858431_859367_+	HAMP domain-containing histidine kinase	NA	A0A2K9L114	Tupanvirus	24.2	1.8e-09
WP_004454245.1|859514_860438_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.7	1.3e-41
>prophage 66
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	868584	869694	4075361		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_009888643.1|868584_869694_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	38.5	3.2e-58
>prophage 67
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	875739	883168	4075361	protease	Clostridioides_phage(66.67%)	8	NA	NA
WP_016728722.1|875739_876261_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	38.5	7.4e-21
WP_004453624.1|876449_876761_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_009895864.1|876788_877475_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011860969.1|877706_878591_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004453621.1|878689_879865_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	S4VT61	Pandoravirus	24.4	7.2e-16
WP_004454225.1|879992_880847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009895871.1|880890_882126_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004454223.1|882226_883168_+	cell wall-binding protein Cwp25	NA	A0A2R2ZGK6	Clostridioides_phage	41.8	7.7e-61
>prophage 68
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	894157	895183	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_004454207.1|894157_895183_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.5	9.7e-17
>prophage 69
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	903891	904752	4075361		Tupanvirus(100.0%)	1	NA	NA
WP_021395349.1|903891_904752_+	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	35.9	1.1e-34
>prophage 70
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	912472	916815	4075361		Indivirus(100.0%)	4	NA	NA
WP_003437183.1|912472_913228_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	30.3	6.1e-16
WP_003439333.1|913214_914117_-	ABC transporter	NA	NA	NA	NA	NA
WP_021364075.1|914925_915963_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021363131.1|916059_916815_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	28.8	1.7e-13
>prophage 71
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	920723	921767	4075361		Moumouvirus(100.0%)	1	NA	NA
WP_003437173.1|920723_921767_+	SPFH/Band 7/PHB domain protein	NA	A0A2P1EMF1	Moumouvirus	33.3	2.1e-19
>prophage 72
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	934349	936892	4075361		Cyanophage(33.33%)	4	NA	NA
WP_003418655.1|934349_934763_+	adenosylmethionine decarboxylase	NA	A0A1D7SEZ2	Cyanophage	45.7	1.1e-16
WP_009888722.1|934792_935644_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	28.3	1.3e-19
WP_009888724.1|935633_936512_+	agmatinase	NA	NA	NA	NA	NA
WP_003418660.1|936691_936892_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	66.7	3.8e-18
>prophage 73
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	946082	947219	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_003437132.1|946082_947219_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.5	8.0e-28
>prophage 74
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	958861	959308	4075361		Clostridioides_phage(100.0%)	1	NA	NA
WP_009892857.1|958861_959308_+	hypothetical protein	NA	A0A1V0E019	Clostridioides_phage	37.7	2.9e-10
>prophage 75
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	966951	978206	4075361		Bacillus_virus(50.0%)	7	NA	NA
WP_003437082.1|966951_967893_+	D-3-phosphoglycerate dehydrogenase	NA	M1I539	Acanthocystis_turfacea_Chlorella_virus	30.3	3.0e-28
WP_003437079.1|967924_969175_+	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_003437076.1|969994_973543_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	35.3	6.8e-17
WP_003437073.1|973727_975662_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	41.3	6.3e-49
WP_009895950.1|975767_976763_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009888755.1|976734_977520_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003437066.1|977507_978206_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	3.6e-23
>prophage 76
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	988543	990031	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_003437034.1|988543_990031_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.4	1.3e-22
>prophage 77
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	993114	996741	4075361		Bacillus_phage(100.0%)	2	NA	NA
WP_003437027.1|993114_994842_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	4.6e-51
WP_003437025.1|994878_996741_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	2.4e-53
>prophage 78
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1002613	1003657	4075361		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003437017.1|1002613_1003657_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.7	2.4e-39
>prophage 79
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1009106	1010363	4075361		Catovirus(100.0%)	1	NA	NA
WP_003437008.1|1009106_1010363_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	25.9	1.0e-07
>prophage 80
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1013642	1015819	4075361		Catovirus(50.0%)	2	NA	NA
WP_003437003.1|1013642_1014767_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	8.4e-22
WP_003437000.1|1014844_1015819_+	glucosaminidase domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	50.6	8.9e-36
>prophage 81
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1021267	1023286	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_021359059.1|1021267_1023286_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	35.6	3.9e-17
>prophage 82
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1034565	1043164	4075361		Bacillus_phage(50.0%)	3	NA	NA
WP_021404677.1|1034565_1038393_+	helicase-exonuclease AddAB subunit AddA	NA	S5M596	Bacillus_phage	23.9	1.4e-12
WP_003437948.1|1038438_1039650_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_021361404.1|1039636_1043164_+	AAA family ATPase	NA	G3MAB6	Bacillus_virus	26.8	6.1e-10
>prophage 83
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1050187	1051048	4075361		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009896018.1|1050187_1051048_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	3.0e-19
>prophage 84
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1060720	1062096	4075361		Clostridium_phage(50.0%)	2	NA	NA
WP_003437972.1|1060720_1061725_+	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	79.6	2.3e-151
WP_003418905.1|1061868_1062096_-	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	45.5	2.6e-07
>prophage 85
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1078033	1078939	4075361		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003438004.1|1078033_1078939_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.0	6.4e-12
>prophage 86
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1082619	1084320	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_003438014.1|1082619_1084320_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.4	2.3e-63
>prophage 87
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1088951	1095478	4075361		Clostridioides_phage(25.0%)	5	NA	NA
WP_003438019.1|1088951_1089665_+	two-component system response regulator RgbR	NA	A0A2R2ZGH8	Clostridioides_phage	37.7	7.0e-30
WP_003438020.1|1089658_1091038_+	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	30.4	6.7e-37
WP_011861120.1|1091278_1091968_+	lipoprotein	NA	NA	NA	NA	NA
WP_003438022.1|1092188_1094561_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A1S6UAD4	Serratia_phage	43.4	8.0e-06
WP_003438023.1|1094575_1095478_+	glycyl-radical enzyme activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	30.3	1.5e-13
>prophage 88
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1102678	1106485	4075361		Bacillus_phage(100.0%)	3	NA	NA
WP_009896068.1|1102678_1105327_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	38.2	4.0e-54
WP_003438041.1|1105335_1105938_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003438043.1|1105930_1106485_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	36.2	3.1e-09
>prophage 89
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1110015	1111290	4075361		Clostridium_phage(100.0%)	1	NA	NA
WP_021362447.1|1110015_1111290_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	44.6	3.8e-26
>prophage 90
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1141089	1141656	4075361	integrase	Bacillus_phage(100.0%)	1	1139445:1139459	1143320:1143334
1139445:1139459	attL	TATACTATTAAACAT	NA	NA	NA	NA
WP_003438082.1|1141089_1141656_-|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	35.2	3.4e-11
WP_003438082.1|1141089_1141656_-|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	35.2	3.4e-11
1143320:1143334	attR	ATGTTTAATAGTATA	NA	NA	NA	NA
>prophage 91
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1147474	1148866	4075361		Tupanvirus(100.0%)	1	NA	NA
WP_003438093.1|1147474_1148866_+	FAD-binding oxidoreductase	NA	A0A2K9L3G7	Tupanvirus	28.1	1.2e-06
>prophage 92
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1157698	1161937	4075361		Trichoplusia_ni_ascovirus(33.33%)	4	NA	NA
WP_003428442.1|1157698_1158448_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.8e-19
WP_003419132.1|1158501_1158726_+	acyl carrier protein	NA	A0A2C9CY51	Yersinia_phage	44.4	1.6e-09
WP_021372428.1|1158754_1159993_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_021362458.1|1160218_1161937_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.4e-15
>prophage 93
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1177159	1179472	4075361		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_003438130.1|1177159_1178365_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.3	1.2e-50
WP_003428410.1|1178366_1178582_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_021362460.1|1178584_1179472_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.2	1.9e-05
>prophage 94
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1188007	1188832	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_003424711.1|1188007_1188832_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	31.7	3.9e-08
>prophage 95
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1195101	1209217	4075361	integrase	Escherichia_phage(16.67%)	12	1187769:1187786	1216351:1216368
1187769:1187786	attL	TACAAAATAATAAAATTA	NA	NA	NA	NA
WP_021362463.1|1195101_1196016_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	26.4	8.1e-07
WP_021362464.1|1196057_1197230_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_009888977.1|1197276_1198089_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.3	2.7e-62
WP_009896135.1|1198292_1199618_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	56.0	1.3e-130
WP_021362465.1|1199830_1200910_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_021365300.1|1201081_1201756_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_021373382.1|1201742_1202990_+	U32 family peptidase	NA	Q6DW11	Phage_TP	37.6	3.6e-58
WP_016729536.1|1203061_1204732_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003419254.1|1204828_1205113_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021362467.1|1205135_1206653_-	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	49.3	1.0e-126
WP_009896138.1|1206777_1207599_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_021362468.1|1207789_1209217_+	cell wall-binding protein Cwp26	NA	A0A2R2ZGK6	Clostridioides_phage	43.7	3.4e-76
1216351:1216368	attR	TACAAAATAATAAAATTA	NA	NA	NA	NA
>prophage 96
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1213548	1213932	4075361		Clostridioides_phage(100.0%)	1	NA	NA
WP_003433385.1|1213548_1213932_-	hypothetical protein	NA	A0A1V0E007	Clostridioides_phage	66.1	1.7e-38
>prophage 97
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1217161	1219584	4075361		Clostridium_phage(66.67%)	4	NA	NA
WP_003438185.1|1217161_1217551_+	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WJP7	Clostridium_phage	55.9	9.6e-34
WP_003438188.1|1217870_1218380_+	glycopeptide resistance protein VanZ1	NA	NA	NA	NA	NA
WP_003419284.1|1218481_1218676_-	hypothetical protein	NA	A0A0A8WI84	Clostridium_phage	39.6	4.7e-05
WP_003438191.1|1219191_1219584_-	sigma-70 family RNA polymerase sigma factor	NA	S6ANS0	Bacillus_phage	38.6	5.7e-10
>prophage 98
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1223753	1224464	4075361		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_003428341.1|1223753_1224464_+	ribonuclease III	NA	L7RCJ8	Acanthamoeba_polyphaga_moumouvirus	33.9	4.2e-27
>prophage 99
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1240643	1243668	4075361		Clostridioides_phage(50.0%)	2	NA	NA
WP_021373385.1|1240643_1242833_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	A0A2R2ZGN9	Clostridioides_phage	64.3	9.4e-211
WP_003438239.1|1242900_1243668_+	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	38.6	1.5e-22
>prophage 100
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1248150	1249086	4075361		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021373387.1|1248150_1249086_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.7	2.2e-23
>prophage 101
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1254329	1266256	4075361	tRNA	Catovirus(20.0%)	9	NA	NA
WP_021373390.1|1254329_1256417_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	36.4	1.1e-104
WP_003438268.1|1256581_1257367_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_021366517.1|1257473_1258739_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	43.4	1.1e-83
WP_003438272.1|1258769_1259540_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003419409.1|1259648_1260095_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_009905390.1|1260112_1261306_+	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	40.2	5.6e-40
WP_003438275.1|1261359_1261800_+	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	53.5	2.3e-31
WP_003438277.1|1262088_1263168_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_009889064.1|1263616_1266256_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.8	1.7e-65
>prophage 102
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1273661	1274825	4075361		Stx2-converting_phage(100.0%)	1	NA	NA
WP_003428267.1|1273661_1274825_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.3	9.9e-34
>prophage 103
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1277959	1367657	4075361	tRNA,plate,tail,protease,integrase,portal	Clostridium_phage(37.14%)	85	1296250:1296268	1369134:1369152
WP_003428258.1|1277959_1278499_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.0	1.6e-18
WP_003438288.1|1278660_1279290_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_003419458.1|1279243_1279672_+	GerW family sporulation protein	NA	NA	NA	NA	NA
WP_021373391.1|1279919_1280360_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021373392.1|1280375_1281827_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	40.7	7.5e-55
WP_003438292.1|1281917_1282586_-	YwaF family protein	NA	NA	NA	NA	NA
WP_003419462.1|1282854_1282995_+	hypothetical protein	NA	B6SBZ7	Clostridium_virus	53.7	1.5e-05
WP_003428248.1|1283169_1283490_-	MazG-like family protein	NA	NA	NA	NA	NA
WP_003428245.1|1283609_1284347_-	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	32.9	2.6e-27
WP_021373393.1|1284561_1286385_+	N-acetylglucosaminidase	NA	Q4ZE13	Staphylococcus_virus	33.8	1.0e-21
WP_003438301.1|1286599_1290898_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	40.1	1.7e-25
WP_003438303.1|1291101_1291563_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003428238.1|1291592_1292747_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003419469.1|1292753_1293035_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003419470.1|1293024_1293336_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003438306.1|1293357_1295298_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	26.6	3.7e-25
WP_003428234.1|1295340_1295721_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003438308.1|1295701_1296685_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
1296250:1296268	attL	TGAAATGGCAAAAAATTTA	NA	NA	NA	NA
WP_003428232.1|1296697_1297603_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003438310.1|1297733_1298663_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_003419491.1|1298766_1299024_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_009889099.1|1299263_1300109_+	DegV family protein	NA	NA	NA	NA	NA
WP_003438316.1|1300233_1302345_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_021373395.1|1302610_1303354_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_021373396.1|1303511_1304759_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	35.4	1.7e-52
WP_003419503.1|1304793_1305039_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_003438324.1|1305048_1306272_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003428224.1|1306384_1307119_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_003438328.1|1307241_1309653_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.4	3.3e-92
WP_003438330.1|1309655_1310714_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_003438333.1|1310707_1312042_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_021370268.1|1312028_1312571_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003428218.1|1312858_1313905_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.5	2.7e-123
WP_003428216.1|1314080_1315622_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_003438341.1|1315935_1318272_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.0e-17
WP_003438344.1|1318653_1320435_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_009902411.1|1320516_1321047_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003438350.1|1321086_1321911_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_009889110.1|1322167_1323076_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003438353.1|1323219_1324665_+	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_003419561.1|1324975_1325428_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003438357.1|1325762_1326959_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003438360.1|1327343_1328294_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003438367.1|1328454_1329207_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.6	1.9e-57
WP_003438370.1|1329298_1330075_-	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003428202.1|1330389_1332288_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_003438374.1|1332415_1333537_-	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_009889116.1|1333735_1334068_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003438377.1|1334054_1335113_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_003438380.1|1335105_1336176_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_003428196.1|1336277_1336814_+	lipoprotein	NA	NA	NA	NA	NA
WP_016729592.1|1336929_1337637_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.9	4.3e-56
WP_003438387.1|1337638_1338355_+	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_021363441.1|1338356_1339115_+	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_021368953.1|1339249_1340638_+	two-component system sensor histidine kinase	NA	NA	NA	NA	NA
WP_003438396.1|1340713_1341535_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_003438399.1|1341770_1342940_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_003419624.1|1343122_1343323_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	66.2	2.7e-16
WP_009889129.1|1343743_1344172_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_009889131.1|1344314_1345070_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003428186.1|1345770_1346277_-	hypothetical protein	NA	A0A0A8WEK1	Clostridium_phage	67.1	4.0e-56
WP_003428185.1|1346358_1346679_-	XRE family transcriptional regulator	NA	A0A0A8WE28	Clostridium_phage	54.5	3.7e-23
WP_003419641.1|1346847_1347045_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003428183.1|1347149_1347590_+	hypothetical protein	NA	A0A090EUN5	Clostridium_phage	51.4	6.0e-32
WP_021373399.1|1347838_1348282_+	hypothetical protein	NA	A0A1V0DZX9	Clostridioides_phage	35.4	2.2e-18
WP_011861188.1|1348286_1349351_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1V0DZX4	Clostridioides_phage	53.1	4.4e-97
WP_021373400.1|1349364_1349793_+|tail	phage tail tube protein	tail	A0A1V0DZX1	Clostridioides_phage	51.1	6.2e-34
WP_003419647.1|1349918_1350365_+|portal	phage portal protein	portal	A0A090EUD0	Clostridium_phage	36.0	8.2e-13
WP_003419648.1|1350391_1350559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021373401.1|1350558_1353012_+	hypothetical protein	NA	A0A1V0DZX3	Clostridioides_phage	55.7	6.1e-17
WP_003428168.1|1353011_1353434_+	hypothetical protein	NA	A0A090DBR9	Clostridium_phage	71.1	1.7e-52
WP_009902435.1|1353715_1355245_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	81.1	1.0e-243
WP_003438447.1|1355260_1355587_+	DUF2577 family protein	NA	J9QE86	Clostridium_phage	94.4	1.0e-52
WP_003428161.1|1355586_1356015_+	DUF2634 domain-containing protein	NA	A0A0A8WJ32	Clostridium_phage	82.4	5.8e-64
WP_021373402.1|1356007_1357060_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WFP3	Clostridium_phage	70.7	4.6e-139
WP_003428156.1|1357056_1357755_+	DUF2313 domain-containing protein	NA	A0A090D815	Clostridium_phage	56.9	5.5e-48
WP_021366456.1|1357755_1358739_+|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	47.8	8.3e-58
WP_021373403.1|1358755_1364077_+	regulator of chromosome condensation (RCC1) repeat family protein	NA	A0A0A8WEY5	Clostridium_phage	37.4	7.8e-118
WP_003438464.1|1364093_1364447_+	hypothetical protein	NA	A0A0A8WJF2	Clostridium_phage	42.1	1.6e-11
WP_003438465.1|1364709_1364970_+	hypothetical protein	NA	A0A0A8WE78	Clostridium_phage	91.6	6.4e-34
WP_003419674.1|1365190_1365646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003438466.1|1365873_1366293_-	helix-turn-helix transcriptional regulator	NA	S5MUV6	Brevibacillus_phage	37.2	5.4e-06
WP_003428146.1|1366591_1366801_+	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	47.2	5.9e-06
WP_009889160.1|1366832_1367042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003428144.1|1367258_1367657_-	helix-turn-helix domain-containing protein	NA	A0A1L2JY18	Aeribacillus_phage	29.7	2.7e-07
1369134:1369152	attR	TAAATTTTTTGCCATTTCA	NA	NA	NA	NA
>prophage 104
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1379117	1380185	4075361		Oenococcus_phage(100.0%)	1	NA	NA
WP_003438474.1|1379117_1380185_+	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	27.0	1.7e-16
>prophage 105
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1392978	1401065	4075361		Tupanvirus(66.67%)	5	NA	NA
WP_003438500.1|1392978_1393710_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	34.2	2.0e-24
WP_003438504.1|1394040_1396230_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	25.8	2.1e-56
WP_009896311.1|1396641_1398570_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_003438510.1|1398556_1398904_+	PqqD family protein	NA	NA	NA	NA	NA
WP_021373412.1|1399145_1401065_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.7	8.1e-57
>prophage 106
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1404584	1405841	4075361		Pseudomonas_phage(100.0%)	1	NA	NA
WP_021373413.1|1404584_1405841_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	34.7	1.1e-14
>prophage 107
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1410528	1411464	4075361		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021373414.1|1410528_1411464_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	61.6	4.5e-45
>prophage 108
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1419419	1422238	4075361		Bacillus_phage(100.0%)	2	NA	NA
WP_009902497.1|1419419_1421153_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	3.2e-12
WP_009889222.1|1421392_1422238_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.4	1.9e-10
>prophage 109
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1427331	1428006	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_003429376.1|1427331_1428006_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	46.7	1.7e-17
>prophage 110
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1431614	1437707	4075361		Bacillus_phage(33.33%)	3	NA	NA
WP_021373419.1|1431614_1434734_+	DEAD/DEAH box helicase family protein	NA	A0A127AW80	Bacillus_phage	24.1	1.2e-30
WP_009889235.1|1434751_1435351_+	viroplasmin family protein	NA	A0A2H4JH24	uncultured_Caudovirales_phage	39.9	8.7e-34
WP_003438605.1|1435577_1437707_-	peroxiredoxin	NA	A0A2K9KZQ8	Tupanvirus	25.4	1.3e-18
>prophage 111
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1445302	1458925	4075361		Pandoravirus(30.0%)	15	NA	NA
WP_003429405.1|1445302_1446169_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.3	1.9e-29
WP_003438621.1|1446410_1447220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016728685.1|1447363_1448428_+	peptidase	NA	U5Q1E2	Bacillus_phage	50.8	4.2e-23
WP_009896360.1|1448455_1449175_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_009896362.1|1449198_1449783_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	52.6	1.4e-57
WP_003438631.1|1449784_1451134_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	41.2	2.2e-37
WP_021373424.1|1451123_1451867_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_009896367.1|1451900_1452602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003429416.1|1452627_1453200_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	51.6	3.0e-44
WP_003438639.1|1453263_1454055_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.8	1.1e-23
WP_009889257.1|1454065_1454431_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003438641.1|1454423_1454930_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	35.2	1.2e-12
WP_003419887.1|1454910_1455696_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	27.9	1.7e-13
WP_009896376.1|1455950_1457741_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	32.6	1.2e-51
WP_003429425.1|1457758_1458925_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	36.8	9.6e-37
>prophage 112
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1466120	1468122	4075361		Bacillus_phage(50.0%)	2	NA	NA
WP_021359153.1|1466120_1467365_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.6	3.0e-20
WP_021373425.1|1467444_1468122_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-31
>prophage 113
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1472339	1475381	4075361		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_021373426.1|1472339_1475381_-	cell wall-binding protein Cwp20	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	25.3	1.8e-10
>prophage 114
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1478645	1482257	4075361		Bacillus_phage(100.0%)	2	NA	NA
WP_100882493.1|1478645_1480421_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	5.2e-42
WP_021373832.1|1480433_1482257_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	3.8e-40
>prophage 115
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1491950	1492682	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_003434123.1|1491950_1492682_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	3.1e-25
>prophage 116
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1497407	1502735	4075361		Planktothrix_phage(50.0%)	4	NA	NA
WP_009896423.1|1497407_1498373_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.1e-33
WP_003434110.1|1498365_1499022_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003434107.1|1499057_1499849_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003434104.1|1499996_1502735_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.8	9.2e-22
>prophage 117
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1508052	1514974	4075361	transposase	Synechococcus_phage(33.33%)	7	NA	NA
WP_009889336.1|1508052_1508937_+	RNA polymerase sigma factor RpoD/SigA	NA	F4YCU2	Synechococcus_phage	35.0	5.8e-34
WP_003434095.1|1509410_1509818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076629448.1|1510466_1511585_+|transposase	transposase	transposase	A0A0H3UZC2	Geobacillus_virus	53.8	6.3e-110
WP_021374035.1|1511661_1512849_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_003439345.1|1512884_1513544_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003427427.1|1513726_1514095_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021373431.1|1514098_1514974_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.8e-16
>prophage 118
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1524192	1525020	4075361		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_021373435.1|1524192_1525020_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	E4WLQ5	Ostreococcus_tauri_virus	40.1	1.0e-53
>prophage 119
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1544242	1544917	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_003436744.1|1544242_1544917_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	3.7e-33
>prophage 120
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1548255	1549023	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_003436725.1|1548255_1549023_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	3.4e-30
>prophage 121
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1559413	1560160	4075361		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_021364459.1|1559413_1560160_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.6	3.9e-15
>prophage 122
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1567801	1567978	4075361		Clostridium_phage(100.0%)	1	NA	NA
WP_003420092.1|1567801_1567978_-	hypothetical protein	NA	A0A0A8WHZ4	Clostridium_phage	73.2	8.2e-17
>prophage 123
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1573855	1574524	4075361		Klosneuvirus(100.0%)	1	NA	NA
WP_021373443.1|1573855_1574524_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	31.2	1.5e-18
>prophage 124
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1585228	1586917	4075361		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003436643.1|1585228_1586917_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.5	4.2e-49
>prophage 125
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1592454	1601652	4075361		Bacillus_phage(50.0%)	7	NA	NA
WP_003436565.1|1592454_1593669_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	29.7	4.5e-05
WP_021373462.1|1594088_1594610_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021373463.1|1594965_1595763_+	G5 domain-containing protein	NA	S6BUU4	Bacillus_phage	49.5	6.6e-13
WP_003436558.1|1595872_1596463_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_009896733.1|1596528_1598226_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	47.6	2.5e-142
WP_003436555.1|1598439_1599279_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_021373464.1|1599795_1601652_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	29.7	9.3e-26
>prophage 126
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1610758	1612255	4075361		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003436535.1|1610758_1612255_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	7.8e-15
>prophage 127
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1617465	1621313	4075361		Streptococcus_phage(100.0%)	3	NA	NA
WP_003430007.1|1617465_1619523_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	5.5e-35
WP_009896752.1|1619541_1620168_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_003436514.1|1620404_1621313_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	48.4	3.4e-74
>prophage 128
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1629039	1631964	4075361		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_009902652.1|1629039_1630002_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	3.0e-20
WP_009889503.1|1630005_1630464_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_003436478.1|1630819_1631176_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009893181.1|1631247_1631964_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	1.4e-17
>prophage 129
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1638950	1639745	4075361		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003436445.1|1638950_1639745_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	5.6e-20
>prophage 130
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1644559	1645285	4075361		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003436372.1|1644559_1645285_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	8.7e-20
>prophage 131
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1652641	1671656	4075361	transposase	Bacillus_phage(20.0%)	16	NA	NA
WP_003436401.1|1652641_1653343_+	VanG-Cd-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	39.3	1.6e-42
WP_021367800.1|1653392_1654475_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	3.3e-23
WP_003436404.1|1654735_1655836_+	D-alanine--D-serine ligase VanG	NA	NA	NA	NA	NA
WP_003436406.1|1655832_1656639_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_021365438.1|1656656_1658795_+	serine racemase VanT catalytic subunit	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.9	2.0e-32
WP_003436409.1|1659108_1659729_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_009889535.1|1659894_1660431_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_021366642.1|1660543_1661218_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.3	4.4e-50
WP_003436426.1|1661420_1663295_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2P1ELF7	Moumouvirus	30.1	4.7e-25
WP_003436430.1|1663386_1664823_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_003435056.1|1665078_1665477_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	96.2	2.5e-69
WP_016729235.1|1665473_1666637_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	98.7	5.0e-219
WP_003420269.1|1666996_1667575_+	TerD family protein	NA	A0A0S4KZ16	Pseudomonas_phage	36.9	2.1e-16
WP_004454531.1|1667613_1668192_+	TerD family protein	NA	NA	NA	NA	NA
WP_003430074.1|1668277_1668907_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	33.8	1.1e-26
WP_004454529.1|1668896_1671656_+	calcium-translocating P-type ATPase, PMCA-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.6	1.1e-91
>prophage 132
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1682105	1684757	4075361		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_004454520.1|1682105_1683059_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	49.4	1.5e-80
WP_004454519.1|1683048_1684005_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_004454517.1|1684001_1684757_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	1.9e-17
>prophage 133
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1695300	1702012	4075361		Prochlorococcus_phage(66.67%)	3	NA	NA
WP_021373470.1|1695300_1697775_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	36.5	9.1e-61
WP_021367805.1|1697774_1699232_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	42.2	6.7e-88
WP_011861289.1|1699654_1702012_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	29.5	1.2e-38
>prophage 134
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1706511	1707063	4075361		Thermoanaerobacterium_phage(100.0%)	1	NA	NA
WP_004454500.1|1706511_1707063_-	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	50.9	7.1e-06
>prophage 135
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1714150	1718061	4075361		Anomala_cuprea_entomopoxvirus(33.33%)	4	NA	NA
WP_021373474.1|1714150_1715038_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.5	1.5e-26
WP_021360568.1|1715043_1715817_+	ABC-2 transporter family protein	NA	NA	NA	NA	NA
WP_004454491.1|1715928_1716654_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	9.5e-35
WP_009902713.1|1716657_1718061_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.2	3.6e-14
>prophage 136
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1730059	1733315	4075361		Bacillus_phage(33.33%)	4	NA	NA
WP_004454472.1|1730059_1730731_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.9	3.5e-23
WP_004454470.1|1730720_1731953_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003420374.1|1732102_1732420_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.4	3.3e-16
WP_003430157.1|1732436_1733315_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A249XZT7	Enterococcus_phage	27.8	1.2e-18
>prophage 137
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1738370	1744889	4075361		Staphylococcus_phage(60.0%)	5	NA	NA
WP_004454467.1|1738370_1738832_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.8	4.3e-49
WP_009889591.1|1738936_1740130_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	57.0	2.1e-119
WP_004454463.1|1740152_1740818_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.3	2.1e-36
WP_004454461.1|1740851_1741964_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	39.7	3.1e-53
WP_004454459.1|1742405_1744889_+	DNA helicase RecQ	NA	A0A167RIL2	Powai_lake_megavirus	41.4	1.8e-88
>prophage 138
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1785906	1786638	4075361		Clostridioides_phage(100.0%)	1	NA	NA
WP_004454401.1|1785906_1786638_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.7	2.9e-15
>prophage 139
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1795134	1802004	4075361	protease	Clostridium_phage(25.0%)	8	NA	NA
WP_009902746.1|1795134_1797522_+|protease	cell wall-binding cysteine protease Cwp13	protease	A0A0A8WJG0	Clostridium_phage	35.5	2.2e-27
WP_003430242.1|1797752_1797986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003430243.1|1798274_1798865_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009902751.1|1798978_1799824_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	2.6e-23
WP_009902753.1|1799820_1800504_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009902755.1|1800500_1801217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003423694.1|1801313_1801577_+	helix-turn-helix transcriptional regulator	NA	B3RH39	Bacillus_virus	41.9	3.7e-05
WP_003423696.1|1801548_1802004_+	peptide deformylase	NA	A0A142EZU8	Stenotrophomonas_phage	35.3	6.7e-10
>prophage 140
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1818767	1825643	4075361		Tupanvirus(25.0%)	8	NA	NA
WP_003439552.1|1818767_1819262_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	38.4	2.6e-23
WP_003430265.1|1819377_1819755_+	monooxygenase	NA	NA	NA	NA	NA
WP_009893285.1|1819960_1820401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016728608.1|1821045_1822353_+	hypothetical protein	NA	O64084	Bacillus_phage	29.2	4.1e-44
WP_003439548.1|1822826_1823630_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003430270.1|1823667_1824279_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003423753.1|1824310_1824982_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.0e-30
WP_003433620.1|1825280_1825643_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	53.2	3.5e-22
>prophage 141
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1831325	1832759	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_003430278.1|1831325_1832759_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.1	1.1e-34
>prophage 142
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1839088	1840063	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_003439509.1|1839088_1840063_-	exonuclease domain-containing protein	NA	G3MBN3	Bacillus_virus	31.4	2.6e-11
>prophage 143
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1847438	1852953	4075361		Pseudomonas_phage(25.0%)	5	NA	NA
WP_003430302.1|1847438_1848020_-	TerD family protein	NA	W8EDB4	Pseudomonas_phage	33.3	5.2e-15
WP_021373490.1|1848059_1848626_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.9	3.2e-22
WP_003430304.1|1849081_1849942_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	36.2	1.6e-41
WP_011861338.1|1850090_1850981_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_074049771.1|1851198_1852953_+	cell wall-binding protein Cwp23	NA	A0A2R2ZGK6	Clostridioides_phage	42.1	2.5e-65
>prophage 144
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1860943	1862511	4075361		Clostridium_virus(50.0%)	2	NA	NA
WP_003430316.1|1860943_1861321_+	BlaI/MecI/CopY family transcriptional regulator	NA	A3QSD4	Clostridium_virus	58.7	1.2e-33
WP_003439467.1|1861851_1862511_+	hypothetical protein	NA	X5JAC0	Clostridium_phage	50.5	8.9e-48
>prophage 145
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1873123	1875781	4075361		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_021373495.1|1873123_1875781_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.7	1.4e-91
>prophage 146
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1879196	1890870	4075361	protease	Micromonas_pusilla_virus(25.0%)	9	NA	NA
WP_003428619.1|1879196_1881014_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	47.8	2.7e-102
WP_009897026.1|1881191_1883894_+	sensor histidine kinase KdpD	NA	A0A1V0SGX0	Hokovirus	29.6	2.6e-16
WP_021364519.1|1883927_1884626_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003428624.1|1884982_1885939_+	CorA family divalent cation transporter	NA	NA	NA	NA	NA
WP_003428626.1|1886115_1886271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003439427.1|1886400_1887414_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	29.4	7.9e-19
WP_009893310.1|1887435_1888500_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_021365480.1|1888499_1889813_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003439421.1|1889790_1890870_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	38.0	1.0e-56
>prophage 147
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1896111	1899546	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_021373497.1|1896111_1899546_+	PAS domain-containing protein	NA	G3MA91	Bacillus_virus	34.6	1.6e-18
>prophage 148
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1906991	1909550	4075361		Clostridium_phage(50.0%)	2	NA	NA
WP_009902811.1|1906991_1908497_-	recombinase family protein	NA	A0A0A7S054	Clostridium_phage	47.0	2.8e-113
WP_003435517.1|1908695_1909550_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	27.5	4.0e-24
>prophage 149
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1913466	1917511	4075361		Staphylococcus_phage(50.0%)	4	NA	NA
WP_021373500.1|1913466_1914333_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.0	4.6e-28
WP_021373501.1|1914353_1915595_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021361882.1|1915818_1916391_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021373502.1|1916776_1917511_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	63.1	1.5e-88
>prophage 150
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1920723	1927381	4075361		Clostridium_phage(50.0%)	6	NA	NA
WP_021359291.1|1920723_1921512_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A8WE15	Clostridium_phage	62.3	2.5e-89
WP_009897045.1|1921650_1922088_-	cytidine/deoxycytidylate deaminase family protein	NA	A7KUY9	Bacillus_phage	54.3	5.9e-32
WP_021373503.1|1922909_1923419_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	43.8	1.0e-06
WP_003435450.1|1923824_1924361_+	signal peptidase II	NA	NA	NA	NA	NA
WP_003435446.1|1924787_1925588_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021359293.1|1925782_1927381_-	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	44.9	4.1e-115
>prophage 151
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1949717	1957939	4075361	integrase	Bacillus_virus(25.0%)	9	NA	NA
WP_003435382.1|1949717_1950317_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.2	4.2e-28
WP_011861393.1|1950486_1951845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003435381.1|1951837_1952470_+	OmpA family protein	NA	NA	NA	NA	NA
WP_003435380.1|1952798_1953956_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	42.2	1.7e-54
WP_009897067.1|1954102_1954738_-	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	43.3	2.8e-14
WP_003435347.1|1954841_1955969_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003435340.1|1956279_1957125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003435338.1|1957154_1957526_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003428736.1|1957678_1957939_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	43.4	2.9e-10
>prophage 152
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1967503	1973663	4075361		Planktothrix_phage(33.33%)	4	NA	NA
WP_009897077.1|1967503_1968190_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	5.5e-32
WP_021373509.1|1968204_1970682_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_021387392.1|1970900_1972304_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	1.2e-20
WP_003435320.1|1972802_1973663_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.5	3.0e-35
>prophage 153
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1979599	1980286	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_003435313.1|1979599_1980286_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	2.3e-30
>prophage 154
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	1984103	1985882	4075361		Bacillus_phage(50.0%)	2	NA	NA
WP_021363597.1|1984103_1985135_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.0	1.2e-17
WP_021363598.1|1985216_1985882_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.1e-34
>prophage 155
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2001812	2007528	4075361		Wolbachia_phage(33.33%)	3	NA	NA
WP_016729024.1|2001812_2003780_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.1	3.7e-73
WP_021373513.1|2003790_2006634_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.4	4.5e-64
WP_003435263.1|2006793_2007528_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	3.3e-11
>prophage 156
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2015989	2017426	4075361		Clostridioides_phage(100.0%)	1	NA	NA
WP_009897130.1|2015989_2017426_-	cell wall-binding protein Cwp28	NA	A0A2R2ZGK6	Clostridioides_phage	48.2	2.7e-73
>prophage 157
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2022586	2023721	4075361	integrase	Lactococcus_phage(50.0%)	2	2015337:2015353	2024055:2024071
2015337:2015353	attL	CATGTTTATATTTTTTT	NA	NA	NA	NA
WP_003431034.1|2022586_2022787_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	68.3	5.0e-18
WP_003435232.1|2023538_2023721_+|integrase	integrase	integrase	A0A090EUH1	Clostridium_phage	83.0	2.5e-16
2024055:2024071	attR	AAAAAAATATAAACATG	NA	NA	NA	NA
>prophage 158
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2035168	2036107	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_009889978.1|2035168_2036107_-	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	45.3	2.9e-60
>prophage 159
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2041759	2042937	4075361		Clostridium_phage(100.0%)	2	NA	NA
WP_003435199.1|2041759_2042017_-	hypothetical protein	NA	J9QD22	Clostridium_phage	56.6	2.2e-18
WP_003428913.1|2042565_2042937_+	helix-turn-helix transcriptional regulator	NA	A0A090D830	Clostridium_phage	39.1	4.3e-15
>prophage 160
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2046398	2051648	4075361		Cronobacter_phage(50.0%)	5	NA	NA
WP_021374051.1|2046398_2048993_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.3	4.5e-127
WP_021373520.1|2049029_2049626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011861430.1|2049642_2050047_-	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_003424232.1|2050413_2050788_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009897173.1|2050793_2051648_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.3	1.7e-22
>prophage 161
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2057553	2058741	4075361		Klosneuvirus(100.0%)	1	NA	NA
WP_021373521.1|2057553_2058741_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.8	7.3e-32
>prophage 162
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2068530	2069943	4075361		Clostridium_phage(50.0%)	2	NA	NA
WP_009897202.1|2068530_2068815_-	hypothetical protein	NA	Q24LG2	Clostridium_phage	60.2	2.8e-22
WP_009897205.1|2069262_2069943_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	26.9	3.8e-17
>prophage 163
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2083613	2135169	4075361	terminase,transposase,tRNA,head,capsid,tail,protease,integrase,portal	Clostridium_phage(34.78%)	50	2073687:2073704	2137160:2137177
2073687:2073704	attL	TCTACTATGTCTTTTTCT	NA	NA	NA	NA
WP_021373524.1|2083613_2085278_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.4	1.1e-171
WP_003435130.1|2085384_2086284_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_003435129.1|2086310_2086949_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_003435128.1|2087285_2088284_-	DUF4003 domain-containing protein	NA	NA	NA	NA	NA
WP_003424324.1|2088381_2088957_-	hypothetical protein	NA	A0A2R2ZGQ3	Clostridioides_phage	57.5	5.4e-49
WP_009897212.1|2089272_2089536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003428999.1|2089972_2090350_-	BlaI/MecI/CopY family transcriptional regulator	NA	A0A2R2ZGM0	Clostridioides_phage	63.9	4.2e-26
WP_009893419.1|2090690_2091803_+|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	77.0	2.7e-161
WP_003435120.1|2092010_2092487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404779.1|2093263_2094601_-	cell wall-binding repeat-containing protein	NA	A0A2R2ZGK6	Clostridioides_phage	52.1	1.0e-74
WP_021404780.1|2094839_2095769_-	3'-5' exoribonuclease	NA	A0A1S5SEW3	Streptococcus_phage	39.5	3.2e-51
WP_032519535.1|2095869_2096226_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WEL4	Clostridium_phage	39.0	7.3e-12
WP_021404782.1|2096401_2096587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021404783.1|2096670_2096913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021425572.1|2097057_2097840_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_021404617.1|2099542_2100685_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	41.7	9.2e-08
WP_021404616.1|2100761_2101067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077707411.1|2101184_2106335_-|tail	phage tail tape measure protein	tail	A0A2R2ZGJ0	Clostridioides_phage	51.8	7.8e-22
WP_021404614.1|2106483_2107314_-	life-span regulatory factor family protein	NA	A0A218KCC2	Bacillus_phage	55.2	1.2e-20
WP_021404613.1|2107428_2108985_-|tail	phage tail tape measure protein	tail	E2ELJ5	Clostridium_phage	49.1	3.4e-37
WP_021404611.1|2109233_2109572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159442176.1|2109558_2110128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404609.1|2110266_2110875_-|tail	phage major tail, phi13 family protein	tail	NA	NA	NA	NA
WP_021404608.1|2110938_2111268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404607.1|2111278_2111659_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_021404606.1|2111658_2112000_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_021404605.1|2111996_2112263_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	50.0	3.9e-18
WP_021404604.1|2112314_2113445_-|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	37.7	5.6e-50
WP_032544523.1|2113483_2114209_-|protease	Clp protease ClpP	protease	A0A0A8WFM9	Clostridium_phage	58.5	9.8e-72
WP_032544525.1|2114177_2115401_-|portal	phage portal protein	portal	A0A0A7S1E7	Clostridium_phage	59.6	2.9e-140
WP_021404601.1|2115434_2117141_-|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	66.7	3.1e-225
WP_021404600.1|2117133_2117595_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7S0C4	Clostridium_phage	62.0	1.6e-40
WP_021404599.1|2117686_2118121_-	HNH endonuclease	NA	A0A0A7RTK8	Clostridium_phage	45.3	3.2e-30
WP_021404598.1|2118123_2118399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404597.1|2118410_2118830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404596.1|2118926_2119364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404595.1|2119558_2120680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404594.1|2120728_2122207_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_032544529.1|2122965_2123760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404619.1|2124089_2124623_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_021404620.1|2124788_2125685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021404621.1|2125763_2126330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404622.1|2126501_2127248_-	ATP-binding protein	NA	A0A1P8BKG9	Lactococcus_phage	27.2	3.0e-07
WP_021404623.1|2127293_2128277_-	hypothetical protein	NA	A0A0A8WHS7	Clostridium_phage	34.8	4.3e-06
WP_021404624.1|2128279_2129215_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZHE2	Clostridioides_phage	27.0	8.6e-12
WP_095916531.1|2129331_2130957_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.2	2.4e-46
WP_003435117.1|2131294_2132314_-	molybdopterin-binding protein	NA	NA	NA	NA	NA
WP_009890188.1|2132310_2132880_-	molybdenum cofactor cytidylyltransferase	NA	NA	NA	NA	NA
WP_021373525.1|2132986_2133709_-	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
WP_021373526.1|2133891_2135169_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.0	7.3e-54
2137160:2137177	attR	TCTACTATGTCTTTTTCT	NA	NA	NA	NA
>prophage 164
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2157349	2157820	4075361		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003434079.1|2157349_2157820_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	4.8e-19
>prophage 165
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2165313	2169592	4075361		Acidithiobacillus_phage(50.0%)	4	NA	NA
WP_003434070.1|2165313_2167248_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.0	1.4e-32
WP_003434069.1|2167276_2167999_-	cell division protein	NA	NA	NA	NA	NA
WP_009893441.1|2168048_2169035_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003434065.1|2169091_2169592_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	35.6	1.1e-13
>prophage 166
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2172596	2173046	4075361		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003434060.1|2172596_2173046_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	30.9	4.1e-12
>prophage 167
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2178774	2182370	4075361		Staphylococcus_phage(33.33%)	3	NA	NA
WP_003434049.1|2178774_2179482_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	1.8e-22
WP_009897250.1|2179734_2180880_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.4	7.5e-42
WP_009897252.1|2180993_2182370_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.6	8.7e-53
>prophage 168
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2185755	2186430	4075361		Synechococcus_phage(100.0%)	1	NA	NA
WP_021373535.1|2185755_2186430_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	37.3	1.3e-33
>prophage 169
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2189639	2196867	4075361		Bacillus_phage(25.0%)	6	NA	NA
WP_003424455.1|2189639_2190308_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.1	1.7e-41
WP_003434034.1|2190467_2192969_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	5.2e-104
WP_003424459.1|2193252_2193444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003424461.1|2193591_2193834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003430621.1|2194045_2195869_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	28.5	2.3e-24
WP_021373538.1|2195958_2196867_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	38.2	9.1e-59
>prophage 170
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2214508	2214712	4075361		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_009890274.1|2214508_2214712_-	helix-turn-helix domain-containing protein	NA	A0A2K5B261	Erysipelothrix_phage	43.5	7.3e-09
>prophage 171
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2232751	2233486	4075361		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003424529.1|2232751_2233486_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	48.5	3.0e-28
>prophage 172
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2237002	2248219	4075361		Erythrobacter_phage(20.0%)	9	NA	NA
WP_021373551.1|2237002_2238187_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	30.8	2.1e-07
WP_021370448.1|2238290_2239349_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_003433990.1|2239562_2240207_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003433989.1|2240394_2241018_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_009903043.1|2241080_2242991_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	27.8	1.9e-18
WP_021373552.1|2243524_2244592_-	RNA ligase RtcB family protein	NA	A0A0K2CNT0	Brevibacillus_phage	25.8	2.0e-25
WP_003433984.1|2244837_2245833_-	protein kinase	NA	A0A285PXS3	Cedratvirus	21.8	6.8e-07
WP_003433982.1|2246091_2247351_-	VanW family protein	NA	NA	NA	NA	NA
WP_003433980.1|2247589_2248219_-	endonuclease/exonuclease/phosphatase family protein	NA	A0A1V0SL41	Klosneuvirus	29.2	7.1e-10
>prophage 173
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2256531	2257851	4075361		Klosneuvirus(100.0%)	1	NA	NA
WP_003430579.1|2256531_2257851_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	24.4	5.2e-23
>prophage 174
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2264205	2267471	4075361		Clostridium_phage(50.0%)	3	NA	NA
WP_009897312.1|2264205_2265336_-	helix-turn-helix domain-containing protein	NA	A0A0A7RTT7	Clostridium_phage	41.0	2.1e-73
WP_021373555.1|2265488_2266442_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_009903063.1|2266565_2267471_-	patatin-like phospholipase family protein	NA	J2YBI2	Acanthamoeba_polyphaga_lentillevirus	34.6	4.4e-05
>prophage 175
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2272410	2285015	4075361		Clostridium_phage(40.0%)	9	NA	NA
WP_021392299.1|2272410_2274588_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	26.7	2.2e-34
WP_021373559.1|2274868_2278048_+	DEAD/DEAH box helicase	NA	E5EQH3	Micromonas_sp._RCC1109_virus	29.7	9.3e-42
WP_016729104.1|2278332_2279097_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009903070.1|2279252_2279486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009897337.1|2279559_2281053_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.3	1.4e-48
WP_003433910.1|2281380_2281923_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A8WFX1	Clostridium_phage	58.1	3.0e-57
WP_021361909.1|2282212_2283160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011861486.1|2283187_2283679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009897343.1|2284121_2285015_-	glucosaminidase domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	48.1	9.3e-32
>prophage 176
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2291973	2293416	4075361		Clostridioides_phage(100.0%)	1	NA	NA
WP_003433893.1|2291973_2293416_-	cell wall-binding repeat-containing protein	NA	A0A2R2ZGK6	Clostridioides_phage	49.4	9.7e-71
>prophage 177
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2301000	2302104	4075361		Pacmanvirus(100.0%)	1	NA	NA
WP_016729098.1|2301000_2302104_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.2	1.5e-23
>prophage 178
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2313634	2320131	4075361		Bacillus_phage(66.67%)	5	NA	NA
WP_003433862.1|2313634_2315467_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	1.0e-45
WP_003433859.1|2315459_2317706_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	6.0e-43
WP_003433857.1|2317773_2318235_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003423380.1|2318539_2319106_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003423377.1|2319792_2320131_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WIP7	Clostridium_phage	54.6	8.7e-23
>prophage 179
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2323979	2324678	4075361		Streptococcus_phage(100.0%)	1	NA	NA
WP_021359398.1|2323979_2324678_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	83.6	3.2e-104
>prophage 180
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2328197	2330565	4075361	integrase	Streptococcus_phage(75.0%)	5	2323535:2323550	2337307:2337322
2323535:2323550	attL	TTTCATATCCAATTCT	NA	NA	NA	NA
WP_021365566.1|2328197_2328605_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	26.7	2.3e-09
WP_003433839.1|2328606_2328837_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021386998.1|2329226_2329430_+	hypothetical protein	NA	A0A1S5SF07	Streptococcus_phage	76.1	1.4e-23
WP_021360730.1|2329507_2329861_+|integrase	integrase DNA-binding domain-containing protein	integrase	A0A1S5SEW7	Streptococcus_phage	67.8	8.4e-37
WP_003433837.1|2329932_2330565_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	42.2	7.8e-25
2337307:2337322	attR	TTTCATATCCAATTCT	NA	NA	NA	NA
>prophage 181
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2341832	2342636	4075361		Vibrio_phage(100.0%)	1	NA	NA
WP_003433827.1|2341832_2342636_-	hypothetical protein	NA	A0A2I7QV58	Vibrio_phage	23.6	9.3e-07
>prophage 182
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2350451	2357876	4075361	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_003430444.1|2350451_2351849_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	39.8	4.9e-88
WP_009890435.1|2352327_2352522_-	DUF3787 domain-containing protein	NA	NA	NA	NA	NA
WP_021365568.1|2352794_2354468_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_003433820.1|2354477_2357876_-	S8 family serine peptidase	NA	A0A127AWU5	Bacillus_phage	32.3	2.6e-05
>prophage 183
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2363908	2365291	4075361		Streptococcus_phage(100.0%)	1	NA	NA
WP_003440226.1|2363908_2365291_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.2	2.1e-14
>prophage 184
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2372314	2375752	4075361		Acinetobacter_phage(100.0%)	2	NA	NA
WP_021374060.1|2372314_2374108_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	39.3	2.4e-127
WP_003430410.1|2374360_2375752_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.4	1.7e-56
>prophage 185
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2390140	2392261	4075361		Indivirus(100.0%)	1	NA	NA
WP_016729072.1|2390140_2392261_-	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	27.0	4.8e-26
>prophage 186
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2395956	2397015	4075361		Tupanvirus(100.0%)	1	NA	NA
WP_021373565.1|2395956_2397015_-	galactitol-1-phosphate 5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	29.0	4.1e-18
>prophage 187
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2404180	2404549	4075361		Clostridium_phage(100.0%)	1	NA	NA
WP_021373566.1|2404180_2404549_+	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WJP7	Clostridium_phage	43.2	1.4e-21
>prophage 188
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2408792	2412727	4075361		Bacillus_phage(66.67%)	3	NA	NA
WP_021362720.1|2408792_2410853_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.2	8.2e-15
WP_004454566.1|2411048_2411741_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	3.1e-35
WP_009897458.1|2412352_2412727_-	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WFF9	Clostridium_phage	95.2	1.3e-56
>prophage 189
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2416564	2422239	4075361		Clostridium_phage(100.0%)	6	NA	NA
WP_021361915.1|2416564_2416717_-	hypothetical protein	NA	X5JAJ2	Clostridium_phage	57.1	4.8e-05
WP_004454587.1|2417989_2418913_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_004454589.1|2419106_2419259_-	hypothetical protein	NA	J9QED5	Clostridium_phage	52.0	9.6e-06
WP_009897482.1|2419532_2419856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004454592.1|2419891_2420146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004454597.1|2421864_2422239_-	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WJU1	Clostridium_phage	88.0	7.1e-50
>prophage 190
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2425268	2433986	4075361		Bacillus_phage(40.0%)	10	NA	NA
WP_004454608.1|2425268_2425469_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	45.8	3.7e-05
WP_021362751.1|2425791_2425968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003423148.1|2426192_2426393_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	71.4	2.0e-19
WP_004454609.1|2427026_2427839_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021413939.1|2427848_2428640_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009893573.1|2428641_2429337_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.3	5.2e-22
WP_021361484.1|2429323_2430055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004454616.1|2430368_2431169_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_004454617.1|2431708_2432425_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.9	2.1e-34
WP_021381512.1|2432393_2433986_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.2	2.5e-11
>prophage 191
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2439071	2441155	4075361		Megavirus(50.0%)	2	NA	NA
WP_009903141.1|2439071_2440103_-	zinc-binding dehydrogenase	NA	K7Z7U2	Megavirus	28.1	1.4e-15
WP_009903144.1|2440102_2441155_-	galactitol-1-phosphate 5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	25.2	4.8e-11
>prophage 192
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2447076	2447727	4075361		Synechococcus_phage(100.0%)	1	NA	NA
WP_003423115.1|2447076_2447727_-	fructose-6-phosphate aldolase	NA	R9TM64	Synechococcus_phage	50.9	5.5e-50
>prophage 193
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2454558	2456058	4075361		Klosneuvirus(100.0%)	1	NA	NA
WP_003423106.1|2454558_2456058_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	33.2	1.8e-56
>prophage 194
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2478008	2478956	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_003416869.1|2478008_2478956_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	43.7	1.3e-63
>prophage 195
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2483765	2484518	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_003430772.1|2483765_2484518_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	9.3e-33
>prophage 196
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2511799	2513937	4075361	protease	Erwinia_phage(50.0%)	3	NA	NA
WP_004454685.1|2511799_2512402_-	peptidoglycan-binding protein	NA	A0A2P1JUA1	Erwinia_phage	44.1	1.7e-08
WP_011861541.1|2512418_2513567_-|protease	protease	protease	NA	NA	NA	NA
WP_003430818.1|2513559_2513937_-	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WFF9	Clostridium_phage	53.2	1.6e-30
>prophage 197
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2517550	2518057	4075361		Clostridium_phage(100.0%)	1	NA	NA
WP_004454691.1|2517550_2518057_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	41.2	2.9e-22
>prophage 198
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2521249	2537828	4075361	tRNA,coat	Escherichia_phage(16.67%)	13	NA	NA
WP_003416734.1|2521249_2522110_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	32.8	9.9e-31
WP_003416732.1|2522378_2522588_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_004454698.1|2522587_2522854_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_003416728.1|2522882_2523455_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_009903185.1|2523689_2524880_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	50.7	5.8e-29
WP_004454700.1|2525139_2525571_-	dUTP diphosphatase	NA	A0A1L2BX65	Bacteriophage	51.0	4.6e-37
WP_004454701.1|2525683_2527912_+	type IA DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	29.0	1.1e-28
WP_004454702.1|2528022_2528508_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021373582.1|2528759_2529983_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011861545.1|2529986_2533121_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.8	1.6e-110
WP_021369655.1|2533154_2534453_+	TolC family protein	NA	NA	NA	NA	NA
WP_009890610.1|2534741_2534987_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_009890612.1|2535200_2537828_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	41.0	4.3e-93
>prophage 199
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2570813	2571929	4075361		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003430896.1|2570813_2571929_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	42.6	1.0e-48
>prophage 200
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2575036	2575480	4075361		Xanthomonas_phage(100.0%)	1	NA	NA
WP_003430905.1|2575036_2575480_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	3.0e-23
>prophage 201
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2579709	2582118	4075361		Clostridioides_phage(100.0%)	1	NA	NA
WP_021373587.1|2579709_2582118_-	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	75.7	0.0e+00
>prophage 202
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2586465	2595082	4075361		Mycoplasma_phage(25.0%)	6	NA	NA
WP_009903205.1|2586465_2587575_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	33.8	4.9e-22
WP_021373589.1|2587604_2588372_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009903209.1|2588559_2589933_-	MFS transporter	NA	S4TR35	Salmonella_phage	22.0	2.5e-07
WP_003416574.1|2589968_2590904_-	ROK family protein	NA	NA	NA	NA	NA
WP_004454751.1|2591869_2593024_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	30.6	5.1e-30
WP_003430934.1|2593234_2595082_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	52.4	3.7e-131
>prophage 203
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2599838	2603130	4075361	tRNA	unidentified_phage(50.0%)	2	NA	NA
WP_016728782.1|2599838_2601176_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.8	2.5e-97
WP_004454760.1|2601324_2603130_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.4	2.6e-25
>prophage 204
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2613086	2621044	4075361	tRNA	Clostridium_botulinum_C_phage(25.0%)	8	NA	NA
WP_011861569.1|2613086_2613923_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	39.3	9.9e-44
WP_003430963.1|2614064_2614772_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_009890693.1|2615261_2616101_-	G5 domain-containing protein	NA	L0LBX4	Bacillus_phage	44.1	7.7e-12
WP_003416528.1|2616349_2617024_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	45.3	5.2e-51
WP_003416526.1|2617060_2617432_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_021373593.1|2617498_2618557_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004454774.1|2618747_2619926_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_021363727.1|2619979_2621044_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	23.6	5.5e-15
>prophage 205
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2627855	2632582	4075361		Hokovirus(50.0%)	2	NA	NA
WP_021373594.1|2627855_2630594_-	sporulation-associated two-component system sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.9	8.1e-26
WP_004454786.1|2630698_2632582_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	30.3	3.1e-21
>prophage 206
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2640924	2644725	4075361		Faustovirus(50.0%)	2	NA	NA
WP_011861572.1|2640924_2642028_+	histidinol-phosphate aminotransferase family protein	NA	A0A142C026	Faustovirus	25.4	8.3e-14
WP_004454800.1|2642085_2644725_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	31.7	2.6e-98
>prophage 207
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2661665	2663488	4075361		Clostridium_phage(50.0%)	2	NA	NA
WP_004454815.1|2661665_2661824_-	hypothetical protein	NA	J9QED5	Clostridium_phage	65.4	1.3e-08
WP_021373596.1|2662117_2663488_-	cell wall-binding protein Cwp29	NA	A0A2R2ZGK6	Clostridioides_phage	45.1	2.6e-73
>prophage 208
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2666824	2671328	4075361	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_021362796.1|2666824_2669245_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	48.6	9.1e-215
WP_003416416.1|2669598_2669949_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003431048.1|2670065_2670638_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_003416411.1|2670638_2671328_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	30.0	9.1e-19
>prophage 209
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2681817	2683928	4075361		Planktothrix_phage(50.0%)	2	NA	NA
WP_021360829.1|2681817_2682501_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.3e-37
WP_021362799.1|2682617_2683928_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	5.8e-14
>prophage 210
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2693498	2694917	4075361		Pseudomonas_phage(100.0%)	1	NA	NA
WP_009897741.1|2693498_2694917_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.8	6.2e-54
>prophage 211
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2710121	2710619	4075361		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003416314.1|2710121_2710619_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.1	2.0e-23
>prophage 212
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2725273	2728298	4075361		Bacillus_phage(100.0%)	2	NA	NA
WP_016729393.1|2725273_2727607_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.5	6.2e-19
WP_003431132.1|2727581_2728298_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.2	2.6e-32
>prophage 213
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2733335	2735351	4075361		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004454897.1|2733335_2735351_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	30.1	9.2e-27
>prophage 214
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2740097	2746354	4075361	tRNA	Prochlorococcus_phage(25.0%)	6	NA	NA
WP_003431156.1|2740097_2741027_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.9	8.8e-09
WP_003431159.1|2741041_2741482_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	47.1	7.6e-19
WP_004454900.1|2741499_2744025_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_004454901.1|2744263_2745463_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.2	9.2e-51
WP_003431167.1|2745467_2745734_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004454902.1|2745736_2746354_-	guanylate kinase	NA	U5J9X2	Bacillus_phage	37.8	3.1e-18
>prophage 215
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2751705	2754868	4075361		Streptococcus_phage(50.0%)	2	NA	NA
WP_021369082.1|2751705_2753358_-	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	35.3	1.7e-66
WP_009897793.1|2753656_2754868_-	ABC transporter permease	NA	Q9KX94	Enterobacteria_phage	34.2	1.3e-55
>prophage 216
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2761640	2765387	4075361		Clostridioides_phage(66.67%)	4	NA	NA
WP_004454923.1|2761640_2762843_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	36.9	3.2e-19
WP_004454924.1|2763708_2764455_+	LytTR family response regulator CdtR	NA	A0A1V0E029	Clostridioides_phage	57.5	3.8e-79
WP_004454925.1|2764843_2765026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004454926.1|2765243_2765387_+	hypothetical protein	NA	A0A1V0E017	Clostridioides_phage	71.4	6.7e-09
>prophage 217
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2772755	2779191	4075361	tRNA	Streptococcus_phage(50.0%)	5	NA	NA
WP_009890830.1|2772755_2773598_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	27.1	1.3e-22
WP_004454936.1|2773781_2774354_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009890831.1|2774516_2774789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003426922.1|2774915_2775788_-	YitT family protein	NA	NA	NA	NA	NA
WP_004454939.1|2776083_2779191_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	32.4	2.3e-162
>prophage 218
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2802768	2807989	4075361		Bacillus_phage(75.0%)	7	NA	NA
WP_003426968.1|2802768_2804058_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	37.7	3.4e-35
WP_003416112.1|2804086_2804779_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.0	5.3e-43
WP_011861621.1|2804793_2805555_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_004454958.1|2805551_2806013_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003416105.1|2806034_2806298_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_003416101.1|2806401_2807175_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0A0RV91	Bacillus_phage	41.0	1.6e-43
WP_003416098.1|2807266_2807989_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	43.5	4.0e-17
>prophage 219
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2826215	2828782	4075361		Bacillus_virus(50.0%)	2	NA	NA
WP_011861628.1|2826215_2827502_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.2	7.9e-24
WP_004454972.1|2827516_2828782_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.5	1.2e-35
>prophage 220
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2841595	2843545	4075361		Bacillus_virus(50.0%)	2	NA	NA
WP_003427052.1|2841595_2842567_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	7.3e-14
WP_009897854.1|2842567_2843545_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.9	2.1e-16
>prophage 221
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2853956	2854889	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_011861639.1|2853956_2854889_+	sporulation protein	NA	U5Q0C0	Bacillus_phage	62.4	2.4e-38
>prophage 222
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2863964	2867106	4075361		Bacillus_virus(50.0%)	4	NA	NA
WP_003416009.1|2863964_2864186_-	alpha/beta-type small acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	50.0	1.3e-11
WP_003427089.1|2864269_2865496_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004455002.1|2865557_2866490_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003416006.1|2866578_2867106_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.0	4.2e-08
>prophage 223
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2870358	2871360	4075361		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003427105.1|2870358_2871360_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	42.3	1.8e-60
>prophage 224
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2882216	2883560	4075361		Moraxella_phage(100.0%)	1	NA	NA
WP_003421552.1|2882216_2883560_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.2	7.4e-49
>prophage 225
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2897143	2899050	4075361		Tupanvirus(50.0%)	2	NA	NA
WP_003431452.1|2897143_2898157_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	50.8	2.4e-92
WP_014466379.1|2898180_2899050_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.7	1.5e-82
>prophage 226
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2919273	2920518	4075361		Heliothis_zea_nudivirus(100.0%)	1	NA	NA
WP_022621901.1|2919273_2920518_-	serine hydroxymethyltransferase	NA	Q8JKP0	Heliothis_zea_nudivirus	48.0	4.7e-98
>prophage 227
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2931730	2936029	4075361	tRNA	Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_009903317.1|2931730_2932537_-	carbon-nitrogen hydrolase	NA	M1I5Z5	Acanthocystis_turfacea_Chlorella_virus	29.8	4.5e-17
WP_004454141.1|2932550_2933783_-	cytosine permease	NA	NA	NA	NA	NA
WP_004454140.1|2934241_2936029_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2I2L4Y8	Orpheovirus	31.7	3.8e-08
>prophage 228
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2940104	2947038	4075361		Bacillus_phage(50.0%)	4	NA	NA
WP_003422921.1|2940104_2942312_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	45.9	2.7e-16
WP_003426450.1|2942385_2942898_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	49.7	1.0e-35
WP_004454135.1|2942910_2945361_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.5	3.0e-88
WP_021373614.1|2945373_2947038_-	AarF/ABC1/UbiB kinase family protein	NA	E5ES62	Bathycoccus_sp._RCC1105_virus	33.7	1.2e-45
>prophage 229
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2957850	2966323	4075361		Paramecium_bursaria_Chlorella_virus(25.0%)	8	NA	NA
WP_003431790.1|2957850_2959584_-	N-6 DNA methylase	NA	A7RAG0	Paramecium_bursaria_Chlorella_virus	23.5	3.8e-05
WP_003426473.1|2959623_2960022_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_004454122.1|2960024_2961572_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004454121.1|2961886_2962792_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	35.2	2.2e-20
WP_003422884.1|2962834_2963479_-	di-trans,poly-cis-decaprenylcistransferase	NA	A0A076FI83	Aureococcus_anophage	24.7	1.2e-12
WP_009891020.1|2963617_2964088_+	DUF4358 domain-containing protein	NA	NA	NA	NA	NA
WP_004454119.1|2964210_2964999_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_004454117.1|2965366_2966323_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	27.3	2.3e-12
>prophage 230
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	2970183	2999393	4075361		Catovirus(26.67%)	22	NA	NA
WP_011861674.1|2970183_2970891_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	50.4	4.8e-31
WP_016728921.1|2971089_2973003_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.8	1.1e-26
WP_003431768.1|2973086_2974178_-	glycosyltransferase	NA	A0A1V0SL50	Klosneuvirus	26.2	1.8e-16
WP_169460753.1|2974183_2975527_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	43.6	2.3e-90
WP_003426498.1|2975504_2976257_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	40.5	4.6e-16
WP_004454111.1|2976304_2977213_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003422862.1|2977234_2977984_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.8	1.2e-16
WP_009891031.1|2978012_2979188_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_009897935.1|2979202_2980042_-	glycosyltransferase family 2 protein	NA	A0A2P1ELT8	Moumouvirus	26.3	7.0e-05
WP_003426507.1|2980044_2981202_-	membrane protein	NA	NA	NA	NA	NA
WP_003426509.1|2981217_2981940_-	glycosyl transferase	NA	A0A1V0SBR5	Catovirus	34.3	9.3e-06
WP_003426511.1|2981951_2983025_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	29.6	1.3e-32
WP_004454107.1|2983046_2984753_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	45.1	2.2e-138
WP_004454106.1|2984798_2986355_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_004454105.1|2986469_2987525_-	cell wall-binding protein Cwp7	NA	A0A0A8WJG0	Clostridium_phage	28.9	5.9e-17
WP_009891044.1|2987619_2988306_-	sugar transferase	NA	NA	NA	NA	NA
WP_021371417.1|2988525_2990550_-	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	34.9	9.5e-16
WP_192574314.1|2990803_2992201_-	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
WP_004454101.1|2992334_2993912_-	cell wall-binding protein Cwp5	NA	A7KUY3	Bacillus_phage	28.6	2.9e-12
WP_021373618.1|2994208_2996620_-	cell wall-binding repeat-containing protein	NA	A0A0A8WJG0	Clostridium_phage	35.6	2.9e-27
WP_021373619.1|2996809_2997211_+	GtrA family protein	NA	NA	NA	NA	NA
WP_021374085.1|2997275_2999393_-	cell wall-binding repeat-containing protein	NA	A0A2R2ZGK6	Clostridioides_phage	32.8	1.5e-11
>prophage 231
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3007506	3010925	4075361		Clostridioides_phage(100.0%)	2	NA	NA
WP_021373625.1|3007506_3009105_-	cell wall-binding repeat-containing protein	NA	A0A2R2ZGK6	Clostridioides_phage	42.1	5.3e-62
WP_021381532.1|3009323_3010925_-	cell wall-binding protein Cwp11	NA	A0A2R2ZGK6	Clostridioides_phage	40.9	1.1e-59
>prophage 232
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3019725	3029227	4075361	tRNA	Clostridioides_phage(25.0%)	9	NA	NA
WP_009897968.1|3019725_3021129_-	cell wall-binding protein Cwp9	NA	A0A2R2ZGK6	Clostridioides_phage	45.0	2.0e-65
WP_021360907.1|3021590_3023486_-	cell wall-binding protein Cwp8	NA	A0A0A8WJG0	Clostridium_phage	28.4	9.3e-05
WP_009891067.1|3024111_3024255_-	six-cysteine ranthipeptide SCIFF	NA	NA	NA	NA	NA
WP_003422821.1|3024320_3024683_-	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003426573.1|3024740_3025034_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_009897970.1|3025167_3026289_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
WP_003426576.1|3026367_3026853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009897971.1|3026864_3027890_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003426579.1|3028207_3029227_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	32.9	8.8e-10
>prophage 233
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3039122	3043110	4075361		Bacillus_phage(66.67%)	3	NA	NA
WP_003426603.1|3039122_3039431_+	hypothetical protein	NA	A0A0A8WF25	Clostridium_phage	57.3	2.9e-25
WP_003426617.1|3039592_3041383_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.2e-54
WP_009897981.1|3041382_3043110_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	3.2e-36
>prophage 234
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3061312	3065515	4075361		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_021365726.1|3061312_3064087_-	calcium-translocating P-type ATPase, PMCA-type	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	29.3	7.8e-85
WP_003436123.1|3064258_3065515_-	serine hydroxymethyltransferase	NA	G9I092	Helicoverpa_zea_nudivirus	40.9	1.6e-77
>prophage 235
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3072576	3077579	4075361	tRNA	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_009898007.1|3072576_3073848_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	6.3e-90
WP_003436785.1|3074663_3076268_-	amidohydrolase	NA	NA	NA	NA	NA
WP_003436788.1|3076652_3077579_+	carbon-nitrogen hydrolase family protein	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	23.5	1.5e-11
>prophage 236
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3080738	3082266	4075361	transposase	Geobacillus_virus(100.0%)	2	NA	NA
WP_076629471.1|3080738_3081857_-|transposase	transposase	transposase	A0A0H3UZC2	Geobacillus_virus	53.0	2.0e-108
WP_003439244.1|3081858_3082266_-|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	44.5	8.0e-23
>prophage 237
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3088640	3090155	4075361		Tupanvirus(100.0%)	1	NA	NA
WP_021359631.1|3088640_3090155_-	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	31.7	4.1e-56
>prophage 238
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3117747	3118530	4075361		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003439676.1|3117747_3118530_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	2.4e-15
>prophage 239
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3129492	3133441	4075361		Bacillus_virus(50.0%)	3	NA	NA
WP_003439713.1|3129492_3130647_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	26.5	2.7e-07
WP_003439716.1|3130728_3132447_-	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003439719.1|3132451_3133441_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	34.1	3.0e-23
>prophage 240
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3162479	3163226	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_021373658.1|3162479_3163226_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.3	1.6e-16
>prophage 241
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3167461	3176452	4075361		Bacillus_virus(25.0%)	8	NA	NA
WP_021373659.1|3167461_3168340_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	6.2e-20
WP_003439810.1|3168332_3169115_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016728981.1|3169115_3169745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009898085.1|3170139_3170766_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_003439817.1|3170841_3171813_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A218KC18	Bacillus_phage	59.4	8.1e-106
WP_021373660.1|3171825_3173925_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K2FMK0	Brevibacillus_phage	54.0	1.0e-217
WP_011861779.1|3174402_3175128_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004453865.1|3175255_3176452_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	6.7e-17
>prophage 242
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3188823	3190212	4075361		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_021374096.1|3188823_3190212_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	42.6	1.7e-96
>prophage 243
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3210480	3211080	4075361		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003432026.1|3210480_3211080_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	37.1	3.9e-26
>prophage 244
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3217402	3217720	4075361		Streptomyces_phage(100.0%)	1	NA	NA
WP_021362925.1|3217402_3217720_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.0	2.6e-13
>prophage 245
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3223814	3226358	4075361		Bacillus_phage(100.0%)	2	NA	NA
WP_021373671.1|3223814_3225224_-	VWA domain-containing protein	NA	A0A223LDP1	Bacillus_phage	32.6	5.6e-47
WP_003439899.1|3225227_3226358_-	ATP-binding protein	NA	A0A223LDC9	Bacillus_phage	33.1	1.5e-50
>prophage 246
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3243645	3244398	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_003439918.1|3243645_3244398_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	2.1e-32
>prophage 247
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3266412	3273268	4075361		Leptospira_phage(33.33%)	5	NA	NA
WP_021373682.1|3266412_3269748_-	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.6	6.6e-14
WP_003439943.1|3269797_3270226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003439944.1|3270215_3270596_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_021373683.1|3270628_3271801_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	45.1	3.1e-27
WP_016729011.1|3271804_3273268_-	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	28.7	4.2e-21
>prophage 248
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3284450	3285605	4075361		Streptococcus_phage(100.0%)	1	NA	NA
WP_021373688.1|3284450_3285605_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	3.5e-47
>prophage 249
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3301754	3303188	4075361		Pandoravirus(100.0%)	1	NA	NA
WP_003439996.1|3301754_3303188_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	25.2	3.5e-28
>prophage 250
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3315420	3318288	4075361	transposase	Geobacillus_virus(50.0%)	2	NA	NA
WP_057384086.1|3315420_3316539_-|transposase	transposase	transposase	A0A0H3UZC2	Geobacillus_virus	54.3	2.5e-111
WP_003440006.1|3317646_3318288_+	hypothetical protein	NA	A0A0E3FKM5	Synechococcus_phage	34.6	3.8e-27
>prophage 251
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3330187	3331642	4075361		Pandoravirus(100.0%)	1	NA	NA
WP_021373693.1|3330187_3331642_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	24.6	3.8e-22
>prophage 252
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3335726	3337371	4075361		Cryptophlebia_leucotreta_granulosis_virus(50.0%)	2	NA	NA
WP_016728832.1|3335726_3336914_-	glucosyltransferase	NA	Q7T5G5	Cryptophlebia_leucotreta_granulosis_virus	28.1	6.2e-07
WP_021359798.1|3336945_3337371_-	helix-turn-helix transcriptional regulator	NA	A0A1P8BKS6	Lactococcus_phage	49.1	2.4e-06
>prophage 253
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3346500	3347172	4075361		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_021359805.1|3346500_3347172_-	beta-phosphoglucomutase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	27.7	3.2e-08
>prophage 254
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3361613	3388869	4075361	integrase	Streptococcus_phage(88.89%)	33	3360878:3360894	3406307:3406323
3360878:3360894	attL	ATATTAAATTGAAAAAT	NA	NA	NA	NA
WP_003440089.1|3361613_3362576_-	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	29.0	2.7e-13
WP_021404748.1|3363553_3364744_-|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	66.5	1.5e-154
WP_004613735.1|3364822_3365026_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	82.1	2.5e-25
WP_022617691.1|3365401_3365650_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021404754.1|3365653_3366073_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	36.8	2.9e-20
WP_021404741.1|3366433_3367786_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_021404737.1|3367788_3368448_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	5.3e-24
WP_021404755.1|3368510_3369320_-	NisI/SpaI family lantibiotic immunity lipoprotein	NA	NA	NA	NA	NA
WP_021404734.1|3369312_3370056_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_021404733.1|3370055_3370799_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_032544555.1|3370800_3371505_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.0	2.1e-55
WP_021404760.1|3371769_3372021_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032544556.1|3372256_3372430_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	54.0	4.3e-10
WP_021404742.1|3372457_3373072_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_021404745.1|3374053_3374281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021404757.1|3374300_3374918_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_022617700.1|3374907_3375144_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021404740.1|3375285_3376188_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	52.3	1.7e-81
WP_021404752.1|3376204_3377212_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	67.3	1.9e-129
WP_021404743.1|3377208_3379419_-	MFS transporter	NA	A0A1S5SF30	Streptococcus_phage	60.1	1.5e-187
WP_021404750.1|3379418_3381869_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.8	0.0e+00
WP_032544558.1|3381846_3382245_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.0	3.2e-48
WP_021404756.1|3382362_3382866_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	60.8	5.8e-55
WP_074104911.1|3382883_3383387_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_032544559.1|3383305_3383602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032544560.1|3383690_3384332_-	hydrolase	NA	NA	NA	NA	NA
WP_003060793.1|3384366_3384588_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	86.3	2.6e-28
WP_021404739.1|3384589_3384724_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_021404744.1|3384737_3385934_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	63.5	6.6e-150
WP_021404759.1|3386116_3387511_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	65.3	1.3e-173
WP_021404736.1|3387604_3388042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032544563.1|3388143_3388527_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	56.2	2.6e-31
WP_021373079.1|3388542_3388869_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	52.4	1.8e-25
3406307:3406323	attR	ATTTTTCAATTTAATAT	NA	NA	NA	NA
>prophage 255
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3397771	3398434	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_009903509.1|3397771_3398434_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.3e-25
>prophage 256
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3406985	3420911	4075361	integrase	Bacillus_phage(40.0%)	12	3404350:3404369	3423591:3423610
3404350:3404369	attL	TGGTGGAGACGAGGGGAGTC	NA	NA	NA	NA
WP_077701630.1|3406985_3408374_-	DNA (cytosine-5-)-methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	39.6	2.1e-86
WP_021373710.1|3408628_3409345_+	mjaII restriction endonuclease	NA	NA	NA	NA	NA
WP_021373711.1|3409589_3409868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021373712.1|3410115_3411450_-	AAA family ATPase	NA	A0A1B0VG30	Salmonella_phage	27.4	2.2e-37
WP_021373713.1|3411462_3412206_-	hypothetical protein	NA	A0A0A0RQ10	Bacillus_phage	51.2	5.6e-30
WP_021373714.1|3412226_3412541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021362987.1|3412544_3412739_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077701673.1|3413022_3413739_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021374111.1|3413835_3414588_+	Fic family protein	NA	NA	NA	NA	NA
WP_021373719.1|3414577_3415744_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	31.6	2.0e-34
WP_021373720.1|3415860_3416091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021373721.1|3416339_3420911_-	SIR2 family protein	NA	A0A2H4PQT3	Staphylococcus_phage	28.0	4.3e-64
3423591:3423610	attR	TGGTGGAGACGAGGGGAGTC	NA	NA	NA	NA
>prophage 257
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3424097	3424553	4075361		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003421925.1|3424097_3424553_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.5	2.6e-38
>prophage 258
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3429636	3434759	4075361		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_003433732.1|3429636_3430509_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.5	6.3e-25
WP_011861863.1|3431038_3431530_-	YfbM family protein	NA	NA	NA	NA	NA
WP_003434984.1|3432623_3434759_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.4	7.3e-83
>prophage 259
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3440125	3441418	4075361		Streptococcus_phage(100.0%)	1	NA	NA
WP_009898301.1|3440125_3441418_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	67.7	6.9e-161
>prophage 260
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3450108	3456991	4075361		Acinetobacter_phage(50.0%)	4	NA	NA
WP_021381558.1|3450108_3452670_-	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	30.8	4.4e-10
WP_009891590.1|3452663_3454055_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_009891591.1|3454337_3455447_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003434158.1|3455638_3456991_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.6	5.5e-36
>prophage 261
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3472923	3473673	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_016728523.1|3472923_3473673_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	1.6e-32
>prophage 262
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3478220	3494354	4075361		Clostridium_phage(14.29%)	14	NA	NA
WP_003434288.1|3478220_3479147_-	conserved phage C-terminal domain-containing protein	NA	Q8SBM0	Clostridium_phage	43.9	8.5e-12
WP_003434289.1|3479776_3480697_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021381562.1|3480782_3483203_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.5	2.4e-143
WP_021373739.1|3483202_3484225_+	serine hydrolase	NA	NA	NA	NA	NA
WP_009891631.1|3484339_3485086_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003434293.1|3485171_3486422_+	multidrug efflux MFS transporter Cme	NA	D0R099	Streptococcus_phage	30.4	2.7e-37
WP_021373740.1|3486938_3487952_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021373741.1|3487954_3488983_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009891642.1|3488982_3489828_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	1.4e-16
WP_009903643.1|3490247_3491378_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.0e-06
WP_009898333.1|3491374_3492046_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.8	1.2e-42
WP_003428030.1|3492259_3492910_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_009891651.1|3492966_3493197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003434301.1|3493760_3494354_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	28.7	1.6e-08
>prophage 263
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3501824	3506791	4075361		Bacillus_virus(50.0%)	3	NA	NA
WP_003438780.1|3501824_3502586_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.3	3.7e-29
WP_021374123.1|3502601_3504137_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_021373744.1|3504550_3506791_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.0	3.7e-138
>prophage 264
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3523882	3524422	4075361		uncultured_virus(100.0%)	1	NA	NA
WP_004454045.1|3523882_3524422_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	30.5	3.0e-09
>prophage 265
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3529221	3529857	4075361		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003422086.1|3529221_3529857_-	single-stranded DNA-binding protein	NA	A0A2H4J8K3	uncultured_Caudovirales_phage	52.9	1.6e-54
>prophage 266
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3544924	3546183	4075361		Tupanvirus(50.0%)	2	NA	NA
WP_009898387.1|3544924_3545689_-	polysaccharide deacetylase family protein	NA	A0A2K9LAZ4	Tupanvirus	28.3	5.2e-07
WP_003422115.1|3545979_3546183_+	alpha/beta-type small acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	48.4	6.0e-11
>prophage 267
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3551794	3555596	4075361	tRNA	Clostridioides_phage(50.0%)	2	NA	NA
WP_003432343.1|3551794_3552505_-	two-component system response regulator RgaR	NA	A0A2R2ZGH8	Clostridioides_phage	36.9	1.5e-37
WP_004454011.1|3552929_3555596_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	1.0e-174
>prophage 268
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3560335	3561100	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_003432349.1|3560335_3561100_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.5	1.5e-14
>prophage 269
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3564206	3567701	4075361		Bacillus_phage(100.0%)	3	NA	NA
WP_021363031.1|3564206_3564887_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	27.7	2.4e-16
WP_021374131.1|3564936_3566952_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003417201.1|3567023_3567701_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.3	7.6e-26
>prophage 270
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3571540	3572206	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_004453991.1|3571540_3572206_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.2	8.5e-22
>prophage 271
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3582801	3588636	4075361		Streptococcus_phage(33.33%)	4	NA	NA
WP_021373756.1|3582801_3583605_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.7	3.1e-34
WP_021363977.1|3583929_3586299_-	glycyl radical protein	NA	A0A2K8HKE5	Bacteriophage	45.3	2.8e-06
WP_003432388.1|3586303_3587212_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_003435637.1|3587556_3588636_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	25.7	3.3e-15
>prophage 272
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3605840	3611335	4075361	protease	Moraxella_phage(33.33%)	5	NA	NA
WP_021364834.1|3605840_3608204_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.5	1.4e-175
WP_003417110.1|3608383_3608896_+	chromate transporter	NA	NA	NA	NA	NA
WP_003427941.1|3608883_3609411_+	chromate transporter	NA	NA	NA	NA	NA
WP_003417105.1|3609481_3610732_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.1	6.1e-146
WP_003417102.1|3610750_3611335_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	58.8	9.3e-57
>prophage 273
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3614943	3616968	4075361		Ralstonia_phage(100.0%)	1	NA	NA
WP_009891779.1|3614943_3616968_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	37.6	3.8e-113
>prophage 274
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3627419	3643297	4075361		Clostridium_phage(25.0%)	16	NA	NA
WP_003437316.1|3627419_3628079_-	two-component system response regulator CprR	NA	W8CYM9	Bacillus_phage	33.6	4.2e-29
WP_003437313.1|3628388_3629018_+	DUF3786 domain-containing protein	NA	NA	NA	NA	NA
WP_021373765.1|3629085_3629919_+	prenyltransferase	NA	NA	NA	NA	NA
WP_021373766.1|3630014_3630803_-	ABC-2 transporter family protein	NA	NA	NA	NA	NA
WP_021373767.1|3630803_3631676_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.0e-27
WP_021411571.1|3631690_3633400_-	membrane protein	NA	NA	NA	NA	NA
WP_021365890.1|3633546_3634128_-	accessory gene regulator B family protein	NA	X5JB40	Clostridium_phage	30.4	2.9e-18
WP_003437290.1|3634186_3634327_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_021365891.1|3634338_3635655_-	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	33.2	3.4e-54
WP_003437285.1|3635648_3636359_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	36.2	2.2e-28
WP_009898497.1|3636797_3637373_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_003437274.1|3637665_3637944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003437271.1|3638252_3639014_-	epoxyqueuosine reductase	NA	NA	NA	NA	NA
WP_074081833.1|3639182_3641258_-	collagen-like exosporium glycoprotein BclA3	NA	A0A285PXU9	Cedratvirus	67.3	7.2e-51
WP_100882499.1|3641324_3642401_-	glycosyltransferase family 2 protein	NA	A0A1V0SAJ8	Catovirus	25.5	4.6e-17
WP_003436212.1|3642712_3643297_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	51.3	3.6e-48
>prophage 275
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3649316	3651840	4075361		Klosneuvirus(50.0%)	2	NA	NA
WP_016729354.1|3649316_3650855_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.2	1.0e-49
WP_003436222.1|3651126_3651840_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	2.8e-31
>prophage 276
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3655583	3656579	4075361		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021373771.1|3655583_3656579_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	4.0e-15
>prophage 277
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3663930	3666400	4075361		Clostridioides_phage(50.0%)	2	NA	NA
WP_003436248.1|3663930_3664569_+	hypothetical protein	NA	A0A1V0DZZ4	Clostridioides_phage	78.0	2.8e-14
WP_003436249.1|3665041_3666400_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	44.8	1.9e-105
>prophage 278
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3669554	3675845	4075361		Streptococcus_phage(66.67%)	4	NA	NA
WP_003436251.1|3669554_3673124_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	39.7	2.9e-217
WP_003436252.1|3673280_3674228_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	32.1	1.2e-34
WP_003416968.1|3674244_3674670_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_009891913.1|3674738_3675845_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	35.8	1.6e-44
>prophage 279
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3685879	3687676	4075361		Phaeocystis_pouchetii_virus(100.0%)	1	NA	NA
WP_021373775.1|3685879_3687676_-	mutS domain V family protein	NA	F2QAF8	Phaeocystis_pouchetii_virus	29.2	5.1e-13
>prophage 280
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3690892	3693718	4075361		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003436266.1|3690892_3693718_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.6	0.0e+00
>prophage 281
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3700310	3701381	4075361		Bacillus_virus(100.0%)	1	NA	NA
WP_003436292.1|3700310_3701381_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.8	1.0e-29
>prophage 282
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3746298	3747456	4075361		Moraxella_phage(100.0%)	1	NA	NA
WP_003437815.1|3746298_3747456_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.5	8.4e-17
>prophage 283
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3752451	3754281	4075361		Lactobacillus_phage(50.0%)	3	NA	NA
WP_003421356.1|3752451_3752835_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9V5D0	Lactobacillus_phage	41.9	2.6e-15
WP_003421359.1|3752803_3753091_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_009903781.1|3753123_3754281_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.8	1.9e-29
>prophage 284
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3763320	3767734	4075361		Bacillus_phage(33.33%)	6	NA	NA
WP_003421374.1|3763320_3763758_-	dCMP deaminase	NA	A7KUY9	Bacillus_phage	43.4	3.2e-25
WP_003437839.1|3763983_3764799_-	EF2563 family selenium-dependent molybdenum hydroxylase system protein	NA	NA	NA	NA	NA
WP_003437840.1|3765093_3765723_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003437841.1|3765758_3766211_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_003437844.1|3766227_3766677_-	low molecular weight protein arginine phosphatase	NA	A0A2H4PQT9	Staphylococcus_phage	37.6	6.2e-08
WP_009892045.1|3766693_3767734_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	38.4	5.9e-54
>prophage 285
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3774040	3775006	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_009892053.1|3774040_3775006_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.0	3.1e-81
>prophage 286
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3782311	3782590	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_003421415.1|3782311_3782590_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	55.6	4.8e-19
>prophage 287
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3785966	3791042	4075361		Paenibacillus_phage(50.0%)	3	NA	NA
WP_009892063.1|3785966_3786506_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	69.2	3.5e-10
WP_009892066.1|3786629_3787625_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003425912.1|3787655_3791042_-	transcription-repair coupling factor	NA	A0A068EU29	Bacillus_phage	26.6	8.8e-06
>prophage 288
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3804326	3806751	4075361		Hokovirus(50.0%)	2	NA	NA
WP_003421448.1|3804326_3805277_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	37.2	8.9e-49
WP_009898727.1|3805371_3806751_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A1V0SB89	Catovirus	35.7	4.8e-27
>prophage 289
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3820822	3825449	4075361		Mycoplasma_phage(33.33%)	5	NA	NA
WP_003435855.1|3820822_3821818_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	39.0	1.1e-25
WP_009894043.1|3821818_3822655_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_003435857.1|3822658_3823828_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_021364863.1|3823828_3824542_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.6e-13
WP_021373792.1|3824582_3825449_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	5.7e-10
>prophage 290
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3829577	3842035	4075361	tRNA	Bacillus_virus(40.0%)	13	NA	NA
WP_009894056.1|3829577_3831515_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	34.0	2.2e-102
WP_009898747.1|3831910_3832432_-	spore maturation protein B	NA	NA	NA	NA	NA
WP_003427659.1|3832447_3833032_-	spore maturation protein A	NA	NA	NA	NA	NA
WP_003427657.1|3833163_3834594_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	54.5	9.1e-138
WP_003421494.1|3834630_3835059_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003435869.1|3835246_3835951_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_021373795.1|3835973_3836807_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.6	2.1e-54
WP_003435875.1|3836807_3837554_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003427637.1|3837631_3838525_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_003435878.1|3838521_3839457_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_009892113.1|3839459_3840149_-	thymidylate kinase	NA	G3MB74	Bacillus_virus	38.1	2.0e-29
WP_003435882.1|3840279_3841689_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003427633.1|3841843_3842035_-	DUF378 domain-containing protein	NA	A0A2L2DKC6	Acanthamoeba_polyphaga_mimivirus	52.8	5.4e-06
>prophage 291
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3847869	3849399	4075361	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003434963.1|3847869_3849399_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.3	2.6e-90
>prophage 292
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3854921	3856892	4075361	protease	Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_021373798.1|3854921_3856892_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	48.1	7.4e-106
>prophage 293
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3859949	3860435	4075361		Bacillus_phage(100.0%)	1	NA	NA
WP_009892129.1|3859949_3860435_-	cell wall hydrolase	NA	A0A172JHR8	Bacillus_phage	37.5	1.0e-16
>prophage 294
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3874010	3874580	4075361		Clostridium_phage(100.0%)	1	NA	NA
WP_003426023.1|3874010_3874580_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	61.6	2.2e-58
>prophage 295
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3881256	3883688	4075361		Planktothrix_phage(33.33%)	3	NA	NA
WP_003426034.1|3881256_3881943_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	3.6e-31
WP_003434897.1|3882025_3883015_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	21.8	3.2e-09
WP_003434895.1|3883001_3883688_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	3.9e-30
>prophage 296
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3887586	3888636	4075361		Halovirus(100.0%)	1	NA	NA
WP_003429883.1|3887586_3888636_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.8	1.1e-58
>prophage 297
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3892151	3893195	4075361		Halovirus(100.0%)	1	NA	NA
WP_003435820.1|3892151_3893195_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.4	8.0e-51
>prophage 298
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3901725	3905298	4075361	tRNA	Bacillus_phage(66.67%)	4	NA	NA
WP_022618638.1|3901725_3902907_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	29.5	5.0e-25
WP_003435805.1|3902896_3903589_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	1.5e-40
WP_003435804.1|3903722_3904439_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_003435803.1|3904563_3905298_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	35.4	2.4e-33
>prophage 299
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3910859	3911588	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_003429190.1|3910859_3911588_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.1	6.9e-17
>prophage 300
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3923817	3924435	4075361		Planktothrix_phage(100.0%)	1	NA	NA
WP_021367430.1|3923817_3924435_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	6.7e-21
>prophage 301
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3931575	3932175	4075361		Acinetobacter_phage(100.0%)	1	NA	NA
WP_021373863.1|3931575_3932175_-	SIS domain-containing protein	NA	E5EYK6	Acinetobacter_phage	27.6	9.4e-12
>prophage 302
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3955762	3964574	4075361		Paenibacillus_phage(20.0%)	7	NA	NA
WP_003435698.1|3955762_3956560_-	MBL fold metallo-hydrolase	NA	A0A0C5AFC1	Paenibacillus_phage	37.9	7.8e-38
WP_009892302.1|3956661_3958125_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_021364093.1|3958249_3959308_+	DnaD domain protein	NA	Q24LE6	Clostridium_phage	48.6	2.6e-09
WP_003435695.1|3959316_3960309_+	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	32.0	1.6e-11
WP_003434259.1|3961361_3962651_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.5	3.6e-77
WP_003429265.1|3962732_3963041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003420541.1|3963245_3964574_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	47.6	3.7e-109
>prophage 303
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3968720	3969155	4075361		Clostridium_phage(100.0%)	1	NA	NA
WP_003420524.1|3968720_3969155_-	single-stranded DNA-binding protein	NA	A0A0A8WIG9	Clostridium_phage	75.0	3.4e-56
>prophage 304
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3976526	3978220	4075361		Natrialba_phage(50.0%)	2	NA	NA
WP_003420496.1|3976526_3977300_-	ParA family protein	NA	Q8JL10	Natrialba_phage	30.2	2.8e-24
WP_003429292.1|3977434_3978220_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	33.8	4.8e-16
>prophage 305
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	3983912	3996043	4075361		Bacillus_virus(33.33%)	14	NA	NA
WP_003434233.1|3983912_3984164_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	68.1	4.2e-14
WP_003429302.1|3984195_3984540_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003420485.1|3984617_3984755_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_162835941.1|3985410_3986733_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003420481.1|3986974_3988081_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	30.4	4.7e-09
WP_003420479.1|3988217_3988424_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003429303.1|3988441_3989557_+	DNA replication/repair protein RecF	NA	D7RWF8	Brochothrix_phage	29.1	1.1e-05
WP_003434229.1|3989557_3991459_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.8	2.6e-156
WP_003429305.1|3991478_3993905_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.3	4.7e-110
WP_003420471.1|3993973_3994270_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_003420469.1|3994269_3994530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003429306.1|3994541_3994859_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003429308.1|3994883_3995270_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003420464.1|3995269_3996043_+	SigB/SigF/SigG family RNA polymerase sigma factor	NA	A0A0A0RV91	Bacillus_phage	30.8	2.9e-21
>prophage 306
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	4008591	4012747	4075361	tRNA	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_003435562.1|4008591_4009863_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	5.0e-87
WP_003421624.1|4010183_4010639_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003421622.1|4011109_4012747_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	8.4e-55
>prophage 307
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	4033532	4037533	4075361	protease	Escherichia_phage(50.0%)	2	NA	NA
WP_021373168.1|4033532_4035980_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.6	2.2e-131
WP_021364956.1|4036159_4037533_+	DNA repair protein RadA	NA	A0A1V0SI16	Klosneuvirus	33.9	1.4e-05
>prophage 308
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	4052281	4054012	4075361		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_021362098.1|4052281_4054012_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.2	3.4e-38
>prophage 309
NZ_CP025047	Clostridioides difficile strain W0003a chromosome, complete genome	4075361	4065769	4072314	4075361	tRNA	Tupanvirus(33.33%)	6	NA	NA
WP_009895182.1|4065769_4067215_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	41.0	1.4e-109
WP_003435581.1|4067652_4069134_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003421202.1|4069354_4069510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009895184.1|4069654_4071052_+|tRNA	cysteine--tRNA ligase	tRNA	A0A161HRB7	Powai_lake_megavirus	28.4	5.2e-53
WP_016729256.1|4071036_4071450_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003421197.1|4071555_4072314_+	FAD-dependent thymidylate synthase	NA	K9MCR9	Sulfolobus_virus	46.1	3.4e-43
