The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025003	Dickeya fangzhongdai strain DSM 101947 chromosome, complete genome	5027163	972803	980723	5027163		Vibrio_phage(16.67%)	7	NA	NA
WP_049853622.1|972803_973091_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	70.8	2.5e-18
WP_038917955.1|973452_974142_+	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	30.5	3.7e-12
WP_049853623.1|974157_975468_+	cytosine permease	NA	NA	NA	NA	NA
WP_038661858.1|975677_976577_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	30.5	2.0e-21
WP_100848989.1|976658_977540_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.3	4.7e-52
WP_100848990.1|977555_979502_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.6	8.5e-38
WP_100848991.1|979505_980723_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	95.6	3.6e-50
>prophage 2
NZ_CP025003	Dickeya fangzhongdai strain DSM 101947 chromosome, complete genome	5027163	1555248	1564323	5027163		Bacillus_phage(33.33%)	7	NA	NA
WP_038918367.1|1555248_1556676_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	4.5e-52
WP_038660632.1|1556689_1558063_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	4.6e-30
WP_038918369.1|1558168_1559176_+	NAD-dependent epimerase	NA	E3SLG9	Synechococcus_phage	29.7	2.5e-09
WP_038920852.1|1559412_1560579_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	56.6	4.7e-116
WP_100850422.1|1560662_1561562_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.8	3.8e-49
WP_167389542.1|1561849_1562731_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_038918370.1|1562916_1564323_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D8KPW3	Synechococcus_phage	29.4	4.7e-30
>prophage 3
NZ_CP025003	Dickeya fangzhongdai strain DSM 101947 chromosome, complete genome	5027163	2451842	2520945	5027163	protease	Bodo_saltans_virus(12.5%)	58	NA	NA
WP_038920965.1|2451842_2452889_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.5	5.8e-17
WP_038919024.1|2453277_2453871_-	YolA family protein	NA	I6NTM5	Burkholderia_phage	60.9	5.2e-47
WP_033568757.1|2454312_2454582_-	YciN family protein	NA	NA	NA	NA	NA
WP_038919025.1|2455023_2457627_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.4	9.2e-88
WP_013317898.1|2457963_2458938_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_100849542.1|2459021_2459657_-	endonuclease III	NA	NA	NA	NA	NA
WP_038919027.1|2459658_2460351_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_038920966.1|2460347_2460977_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_100849543.1|2460989_2462042_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_100849544.1|2462042_2464268_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_038919032.1|2464260_2464851_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_038919033.1|2464850_2465432_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_038658750.1|2465658_2465874_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_049853978.1|2466444_2467956_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_100849545.1|2468010_2469696_-	ribulokinase	NA	NA	NA	NA	NA
WP_038919036.1|2470078_2471062_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038668506.1|2471158_2472682_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	3.9e-14
WP_100849546.1|2472700_2473687_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_038919040.1|2473754_2474705_+	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_100849547.1|2474911_2475961_+	oxidoreductase	NA	NA	NA	NA	NA
WP_049853982.1|2476115_2477114_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_038658728.1|2477291_2477750_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_038919044.1|2477837_2478854_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_049853984.1|2479183_2480746_-	YdgA family protein	NA	NA	NA	NA	NA
WP_100849548.1|2480803_2481988_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_100849549.1|2482165_2483563_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_100849550.1|2483566_2484493_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_100849551.1|2484664_2485915_-	MFS transporter	NA	S4TR35	Salmonella_phage	27.2	1.6e-08
WP_049853989.1|2486053_2486968_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049853990.1|2487084_2488302_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_038658704.1|2488456_2489128_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_100849552.1|2489385_2489673_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_049853992.1|2489750_2490107_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_038919056.1|2490378_2491128_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_100849553.1|2491446_2492217_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038919058.1|2492249_2493476_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_100849554.1|2493493_2494327_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_100849555.1|2494443_2495040_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100849556.1|2495668_2496673_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	28.3	1.6e-11
WP_100849557.1|2497074_2497593_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_087881290.1|2498070_2498760_+	Expansin-YoaJ	NA	NA	NA	NA	NA
WP_038919064.1|2499158_2499824_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_038920968.1|2499968_2500598_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_038919065.1|2500590_2501211_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_100849559.1|2501207_2502872_+	MCE family protein	NA	NA	NA	NA	NA
WP_100849560.1|2502868_2503477_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_100849561.1|2504018_2504645_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100849562.1|2505084_2505645_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100850455.1|2505867_2506968_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_100849563.1|2507234_2509103_+	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	31.7	1.8e-69
WP_082170937.1|2509385_2510819_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_038919074.1|2511244_2512684_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_049854005.1|2512834_2514280_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_100849564.1|2514492_2515881_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038919077.1|2515893_2517240_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_100849565.1|2517253_2518981_-	type I secretion system permease/ATPase	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.0	2.6e-14
WP_038919079.1|2518997_2519309_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_038919080.1|2519511_2520945_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP025003	Dickeya fangzhongdai strain DSM 101947 chromosome, complete genome	5027163	2677805	2687393	5027163	tRNA	Tupanvirus(33.33%)	11	NA	NA
WP_100849611.1|2677805_2678630_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	1.4e-69
WP_167389573.1|2678746_2679631_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_049853735.1|2679704_2680112_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_035341598.1|2680150_2680450_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_100849612.1|2680453_2682841_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	1.4e-05
WP_033570774.1|2682854_2683838_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.0	7.6e-35
WP_106120997.1|2684017_2684062_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_012769671.1|2684224_2684581_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_012769670.1|2684624_2684822_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071605205.1|2684918_2685461_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	7.4e-16
WP_100849613.1|2685464_2687393_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.4e-128
>prophage 5
NZ_CP025003	Dickeya fangzhongdai strain DSM 101947 chromosome, complete genome	5027163	2839886	2909370	5027163	tail,tRNA,protease,plate	Escherichia_phage(23.33%)	63	NA	NA
WP_038919306.1|2839886_2840729_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	55.7	2.1e-86
WP_145958423.1|2840853_2841318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049842492.1|2841320_2841851_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	47.2	1.4e-35
WP_038919308.1|2841971_2842187_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_038919309.1|2842186_2842411_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	53.5	2.4e-13
WP_100849672.1|2842511_2844638_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	47.1	4.1e-179
WP_038658013.1|2844701_2844923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038919311.1|2845476_2845680_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	65.7	5.4e-20
WP_038919313.1|2845755_2846217_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	45.1	3.0e-26
WP_100849673.1|2846924_2847590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033111903.1|2847739_2848381_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	62.4	8.1e-70
WP_038919316.1|2848377_2848728_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	62.9	1.6e-35
WP_038919318.1|2848732_2849641_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	74.8	3.2e-120
WP_038919319.1|2849633_2850245_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	67.2	3.9e-74
WP_100849674.1|2850614_2851775_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	47.4	4.2e-109
WP_100849675.1|2851975_2853331_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_038919321.1|2853493_2854840_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_038921001.1|2854890_2855457_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_038919322.1|2856264_2856834_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	78.5	3.9e-76
WP_038919323.1|2857008_2857584_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	47.6	6.9e-28
WP_038919324.1|2857586_2858198_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	37.8	3.3e-28
WP_038668429.1|2858422_2859592_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	3.0e-187
WP_012769535.1|2859606_2860125_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	78.5	4.2e-77
WP_038919327.1|2860185_2860476_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	59.6	1.7e-22
WP_100849676.1|2860472_2860628_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.5	4.4e-14
WP_100849677.1|2860638_2861754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038919328.1|2861765_2862260_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	58.7	3.6e-41
WP_038919329.1|2862256_2863435_+	late control D family protein	NA	Q6K1G4	Salmonella_virus	43.0	8.7e-78
WP_012769529.1|2863531_2863723_+	transcriptional activator Ogr/delta	NA	A0A2I8TV89	Erwinia_phage	66.7	6.8e-17
WP_100849678.1|2864110_2865427_+	guanine deaminase	NA	NA	NA	NA	NA
WP_100849679.1|2865720_2867535_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_100849680.1|2867786_2869475_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_038919334.1|2871476_2873021_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	48.8	5.4e-35
WP_082170971.1|2873084_2873384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038919336.1|2873682_2874369_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	57.0	1.7e-73
WP_038919337.1|2874470_2875745_+	chloride channel protein	NA	NA	NA	NA	NA
WP_038919339.1|2875798_2877400_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_049842425.1|2877493_2878177_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.4	2.5e-21
WP_038919341.1|2878169_2879018_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.1	9.2e-05
WP_100849681.1|2879004_2879874_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049842424.1|2879870_2880911_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_038919344.1|2881052_2881730_-	transporter	NA	NA	NA	NA	NA
WP_038919345.1|2882289_2883390_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_100850464.1|2883766_2885482_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.9	1.6e-32
WP_038919346.1|2885535_2885976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038668381.1|2886216_2886960_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_049854509.1|2886956_2888312_+	two-component system sensor histidine kinase RstB	NA	NA	NA	NA	NA
WP_100849682.1|2888387_2889035_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_039694909.1|2889396_2890215_+|protease	serine protease	protease	NA	NA	NA	NA
WP_100849683.1|2890485_2894373_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.4	2.0e-54
WP_038668371.1|2894691_2895297_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_100849684.1|2895377_2895635_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_100849685.1|2895699_2898303_-	YdbH family protein	NA	NA	NA	NA	NA
WP_038919353.1|2898609_2900163_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	55.1	4.3e-40
WP_100849686.1|2900368_2901361_+	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	42.2	1.2e-67
WP_038919355.1|2901407_2901686_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_100849687.1|2902016_2903981_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_038919357.1|2904090_2904588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145958424.1|2904584_2904959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145958425.1|2904993_2907228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100849691.1|2907365_2907815_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_100849692.1|2907872_2908310_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_038919363.1|2908428_2909370_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	92.2	6.4e-140
>prophage 6
NZ_CP025003	Dickeya fangzhongdai strain DSM 101947 chromosome, complete genome	5027163	3531334	3575447	5027163	head,protease,holin,integrase,tRNA,terminase	Pectobacterium_phage(29.41%)	57	3528120:3528179	3574456:3574516
3528120:3528179	attL	TGGCGGAGGAGTAGAGATTCGAACTCTAGAACGCTTTCGCGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_100849875.1|3531334_3534076_-	kinase	NA	A0A286S259	Klebsiella_phage	54.7	0.0e+00
WP_100849876.1|3534072_3534453_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	1.3e-59
WP_100849877.1|3534462_3534945_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	78.1	9.1e-66
WP_100849878.1|3534941_3535412_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	57.4	2.9e-53
WP_100849879.1|3535411_3539068_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	44.5	7.9e-186
WP_145958426.1|3539130_3539727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100849880.1|3540034_3540787_+	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	67.2	6.2e-37
WP_100849881.1|3540829_3541363_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	60.3	1.9e-56
WP_100849882.1|3541565_3542246_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	61.6	6.8e-75
WP_100849883.1|3542306_3543050_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	82.4	5.3e-73
WP_100849884.1|3543112_3543664_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	42.6	6.6e-36
WP_100849885.1|3543762_3544146_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	60.6	8.9e-40
WP_100849886.1|3544142_3544511_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	73.8	1.1e-44
WP_100849887.1|3544513_3544864_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	9.6e-41
WP_038667799.1|3545033_3545417_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	51.6	7.3e-26
WP_100849889.1|3545419_3545716_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	67.4	8.7e-11
WP_100849890.1|3545755_3546787_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	52.3	1.8e-95
WP_100849891.1|3546798_3547233_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	47.8	1.6e-24
WP_100849892.1|3547232_3548627_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	51.7	1.6e-123
WP_167389578.1|3548836_3549739_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	72.2	1.4e-120
WP_100849895.1|3549770_3551222_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	51.0	2.7e-121
WP_100849896.1|3551233_3552802_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	88.3	9.2e-293
WP_100849897.1|3552798_3553287_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	81.9	2.6e-52
WP_100850484.1|3553318_3553939_-	hypothetical protein	NA	H9C189	Pectobacterium_phage	75.1	1.4e-90
WP_100849898.1|3554121_3554346_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	56.3	3.2e-13
WP_100849899.1|3554381_3554921_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	76.6	1.7e-65
WP_100849900.1|3554917_3556216_-	site-specific DNA-methyltransferase	NA	A0A2K9VGT2	Pontimonas_phage	46.8	2.3e-92
WP_100849901.1|3556212_3556653_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.1	3.1e-52
WP_100850485.1|3556636_3556981_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	67.9	3.7e-37
WP_100849902.1|3557548_3557860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100849904.1|3558144_3558375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100849905.1|3558450_3558993_-	antiterminator	NA	A0A077KC63	Edwardsiella_phage	35.8	2.9e-20
WP_145958427.1|3558989_3559130_-	YlcG family protein	NA	NA	NA	NA	NA
WP_100849906.1|3559126_3559483_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	75.2	1.5e-46
WP_100849907.1|3559479_3559764_-	DUF1364 family protein	NA	G8C7V5	Escherichia_phage	80.6	1.9e-39
WP_100850486.1|3559760_3560531_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_100849908.1|3560530_3561124_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	58.9	8.0e-64
WP_100849910.1|3561592_3561904_-	ASCH domain-containing protein	NA	A0A2H4IB20	Erwinia_phage	52.6	2.2e-20
WP_100850487.1|3561900_3562137_-	hypothetical protein	NA	R9VX58	Serratia_phage	59.1	3.2e-16
WP_100849911.1|3562151_3563378_-	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	42.0	5.8e-08
WP_100849912.1|3563374_3563626_-	hypothetical protein	NA	H9C167	Pectobacterium_phage	59.5	2.8e-18
WP_100849913.1|3563622_3564105_-	hypothetical protein	NA	H9C166	Pectobacterium_phage	36.1	3.9e-08
WP_100849914.1|3564153_3565566_-	helicase DnaB	NA	H9C165	Pectobacterium_phage	63.0	6.4e-168
WP_100849915.1|3565558_3566164_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	43.2	1.8e-42
WP_100849916.1|3566160_3567069_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	46.0	1.7e-60
WP_100849917.1|3567070_3567283_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	58.2	1.2e-14
WP_100849918.1|3567543_3567990_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	61.9	1.9e-38
WP_100849919.1|3568036_3568234_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	45.8	2.6e-11
WP_100849920.1|3568315_3568705_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	56.6	7.6e-31
WP_100849921.1|3569741_3570044_+	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.6	1.1e-13
WP_100849922.1|3570068_3572201_+	exodeoxyribonuclease VIII-like protein	NA	H9C157	Pectobacterium_phage	49.5	4.2e-171
WP_100849923.1|3572197_3572698_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	75.9	2.2e-62
WP_167389553.1|3572722_3572899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100849924.1|3572943_3573162_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.6	1.1e-13
WP_100849925.1|3573103_3573331_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	56.5	1.4e-13
WP_100849926.1|3573336_3574353_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.2	1.2e-96
WP_100849927.1|3574790_3575447_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.5	1.7e-46
3574456:3574516	attR	TGGCGGAGGAGTAGAGATTCGAACTCTAGAACGCTTTCGCGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
>prophage 7
NZ_CP025003	Dickeya fangzhongdai strain DSM 101947 chromosome, complete genome	5027163	4723419	4763345	5027163	tail,tRNA,protease	Erwinia_phage(33.33%)	39	NA	NA
WP_038917490.1|4723419_4724523_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_038917489.1|4724535_4724907_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_038664569.1|4724921_4725560_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_087881307.1|4725766_4727167_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_033569035.1|4727204_4728122_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_038664565.1|4728284_4729016_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	58.5	1.4e-46
WP_038664563.1|4729190_4730087_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_038917488.1|4730441_4732877_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_038917487.1|4732879_4734040_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_013315901.1|4734228_4734546_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_013315900.1|4734679_4734895_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_100850512.1|4735170_4737369_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_038917486.1|4737804_4738875_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_071605138.1|4738926_4739859_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_012767897.1|4739944_4740475_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_038664546.1|4740484_4741816_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	28.8	1.3e-45
WP_038669173.1|4741955_4742873_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_012767894.1|4743031_4743517_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_013315893.1|4743580_4743823_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_038664541.1|4744373_4745219_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.7	2.4e-13
WP_038917484.1|4745246_4746758_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_038664536.1|4746890_4747901_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_100850290.1|4748010_4748757_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_038664530.1|4748770_4749196_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_167389560.1|4749341_4749938_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_038909994.1|4750079_4750850_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_100850291.1|4751003_4752458_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_100850292.1|4752555_4753656_-	agmatine deiminase	NA	M1I5R4	Acanthocystis_turfacea_Chlorella_virus	49.4	9.2e-98
WP_038917478.1|4753659_4754544_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	50.9	7.0e-80
WP_049842589.1|4754567_4754822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038664512.1|4754881_4755844_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_038917476.1|4756101_4757004_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_038917475.1|4757133_4757604_-	Pr2TM family membrane protein	NA	NA	NA	NA	NA
WP_038917473.1|4757806_4758271_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_100850293.1|4758267_4758888_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_038917470.1|4758887_4760024_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	42.2	7.3e-98
WP_038917469.1|4760381_4761500_-|tail	tail protein	tail	A0A2I8TVA9	Erwinia_phage	50.9	7.0e-93
WP_100850294.1|4761732_4762110_-|tail	phage tail protein	tail	M1FJ98	Enterobacteria_phage	33.6	3.6e-09
WP_100850295.1|4762118_4763345_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	43.1	5.7e-72
