The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025018	Streptomyces sp. M56	11742376	22830	81241	11742376	transposase,integrase	Staphylococcus_phage(16.67%)	49	30486:30510	74489:74513
WP_100804460.1|22830_23532_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_100804461.1|23570_23870_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100804462.1|24795_26115_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_173963118.1|26273_26900_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804463.1|26951_27752_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100804464.1|27928_28228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173963389.1|29150_29946_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_100809005.1|30248_30722_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
30486:30510	attL	CAGGCCGCGCTTCTCCAGCCGGTCG	NA	NA	NA	NA
WP_100809006.1|32644_33811_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.5	2.5e-32
WP_100804466.1|33872_34628_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_100804467.1|34745_35732_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_100804468.1|35931_36726_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_100804469.1|36811_37663_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100804470.1|39618_40080_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_100804471.1|40072_40780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804472.1|41228_42482_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	71.3	9.0e-166
WP_100804473.1|42541_43219_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_161371047.1|43215_43599_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_100804474.1|43648_44407_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_100804475.1|44489_45134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159398785.1|45808_45949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804477.1|45964_46405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159398786.1|46741_47515_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_100804479.1|47616_48888_-	MFS transporter	NA	NA	NA	NA	NA
WP_159398787.1|48896_49181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159398788.1|49238_50432_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	25.7	2.3e-17
WP_100804482.1|52083_53925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804483.1|54166_54505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100804484.1|54754_55573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159398789.1|57600_57876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804486.1|58118_58958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804487.1|59042_59588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804488.1|59811_61013_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.1	1.9e-32
WP_100804489.1|61320_62190_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_100804490.1|62186_64781_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_100804491.1|64777_65446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159398790.1|65602_65746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804493.1|66392_67559_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_100804494.1|67624_68122_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_100804495.1|68118_69021_-	FAD binding domain-containing protein	NA	NA	NA	NA	NA
WP_100804496.1|69017_71327_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_100804497.1|72285_73263_-	amidohydrolase	NA	NA	NA	NA	NA
WP_100804498.1|73408_73873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100809008.1|73800_74064_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804500.1|77256_78073_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
74489:74513	attR	CGACCGGCTGGAGAAGCGCGGCCTG	NA	NA	NA	NA
WP_159398791.1|78746_79454_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_100804502.1|79482_80403_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	39.6	3.2e-43
WP_014043695.1|80399_80708_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.9	2.6e-18
WP_100809009.1|80965_81241_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025018	Streptomyces sp. M56	11742376	138678	204727	11742376	bacteriocin,transposase	Mycobacterium_phage(16.67%)	59	NA	NA
WP_100804534.1|138678_139956_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_100804535.1|140129_140753_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.2	4.8e-27
WP_100809016.1|140847_141900_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_100804536.1|141871_142273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100804537.1|142296_144288_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_100804538.1|144338_144923_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_100804539.1|144919_146254_-	MFS transporter	NA	NA	NA	NA	NA
WP_100804540.1|146284_147205_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_100804541.1|147245_148217_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_100804542.1|148322_149381_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_100804543.1|149782_150805_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_159398796.1|151185_152223_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_100804545.1|152360_153851_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.6	5.0e-38
WP_100804546.1|154170_154716_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_100804547.1|154797_155166_+	VOC family protein	NA	NA	NA	NA	NA
WP_161371006.1|156769_157258_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804549.1|157348_157957_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804550.1|158089_159016_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_100804551.1|160020_160917_+	cyclase family protein	NA	NA	NA	NA	NA
WP_107503168.1|161163_161493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804552.1|161504_161945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100804553.1|161880_162957_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_173963120.1|163027_164092_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100804555.1|164436_164787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173963109.1|165605_166802_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_173963121.1|166770_167643_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_173963122.1|167537_169022_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_100804557.1|169027_169372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159398797.1|169796_170228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804559.1|170237_171395_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_100804560.1|172710_173583_-	dioxygenase	NA	NA	NA	NA	NA
WP_173963123.1|174052_174928_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_100804561.1|175226_176216_-	amidohydrolase	NA	NA	NA	NA	NA
WP_100804562.1|176215_176782_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100804563.1|176887_177376_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804564.1|179036_180176_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_159398798.1|180285_181044_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_100804566.1|181691_182291_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804567.1|182393_183557_+	epoxide hydrolase	NA	NA	NA	NA	NA
WP_100804569.1|184022_184988_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_100804570.1|185304_185871_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804571.1|185924_186155_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_100804572.1|187387_187975_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804573.1|190269_191202_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_100809019.1|191243_192107_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100804574.1|192103_193078_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	30.3	3.3e-22
WP_159398799.1|193310_193820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100804576.1|193989_194706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100804577.1|194774_195233_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100804578.1|195361_196105_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_100804579.1|196101_196983_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_100804580.1|199055_199619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100804502.1|199742_200663_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	39.6	3.2e-43
WP_014043695.1|200659_200968_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.9	2.6e-18
WP_159398800.1|201058_201406_+	recombinase family protein	NA	NA	NA	NA	NA
WP_159398801.1|201483_202311_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_100804582.1|202326_202770_+	ester cyclase	NA	NA	NA	NA	NA
WP_100804583.1|203101_203917_-	ATP-binding domain-containing protein	NA	A0A218KCE8	Bacillus_phage	31.4	6.8e-21
WP_100804584.1|203959_204727_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP025018	Streptomyces sp. M56	11742376	1556102	1567897	11742376	tail,plate	uncultured_phage(50.0%)	11	NA	NA
WP_100805193.1|1556102_1558130_-|tail	phage tail protein I	tail	NA	NA	NA	NA
WP_100805194.1|1558126_1560214_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_100805195.1|1560210_1562160_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_069860743.1|1562156_1562570_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_079260195.1|1562566_1563268_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_069860741.1|1563264_1564446_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_069860740.1|1564456_1565128_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_093701969.1|1565240_1565435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069860738.1|1565431_1565950_-|tail	phage tail protein	tail	T2KT02	uncultured_phage	37.8	1.4e-08
WP_100805196.1|1565946_1567440_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	H6WFT7	Cyanophage	31.8	5.4e-16
WP_069860736.1|1567441_1567897_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP025018	Streptomyces sp. M56	11742376	1729335	1752327	11742376	integrase,tail,plate	Bacillus_phage(33.33%)	21	1740812:1740827	1753857:1753872
WP_100805259.1|1729335_1730898_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.4	6.8e-70
WP_069860626.1|1730933_1731377_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_100805260.1|1731376_1731808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087684351.1|1731804_1731948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100805261.1|1731954_1733649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069860622.1|1733674_1734106_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069860621.1|1734109_1734913_+	peptidase M23	NA	NA	NA	NA	NA
WP_069860620.1|1734916_1736836_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_069860619.1|1736946_1737222_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_020866084.1|1737224_1737632_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_100805262.1|1737628_1739617_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_069860617.1|1739618_1740179_+|tail	phage tail protein I	tail	NA	NA	NA	NA
1740812:1740827	attL	TGGCCGCGGCCCCGGC	NA	NA	NA	NA
WP_069860821.1|1740838_1741363_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_100805263.1|1741479_1742238_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099015963.1|1742345_1743563_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	27.5	1.3e-44
WP_100805264.1|1743559_1744993_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.0	2.9e-35
WP_079260091.1|1745026_1746412_+	MFS transporter	NA	NA	NA	NA	NA
WP_100805265.1|1746450_1747458_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_100809075.1|1747575_1747998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100805266.1|1748157_1751664_+	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_100809076.1|1751760_1752327_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1753857:1753872	attR	GCCGGGGCCGCGGCCA	NA	NA	NA	NA
>prophage 5
NZ_CP025018	Streptomyces sp. M56	11742376	4505252	4512965	11742376		Planktothrix_phage(33.33%)	9	NA	NA
WP_100806275.1|4505252_4506374_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	1.1e-13
WP_100806276.1|4506366_4507404_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	5.8e-17
WP_100806277.1|4507950_4508661_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_141729878.1|4508700_4508994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069864385.1|4509009_4509210_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_079153000.1|4509220_4510105_-	helix-turn-helix transcriptional regulator	NA	I4AZQ1	Saccharomonospora_phage	27.0	1.6e-12
WP_100806278.1|4510237_4510675_+	ATP-binding protein	NA	A0A1V0E640	Streptomyces_phage	34.1	5.6e-06
WP_100806279.1|4510756_4511914_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	7.9e-15
WP_093707539.1|4511906_4512965_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	2.9e-16
>prophage 6
NZ_CP025018	Streptomyces sp. M56	11742376	8652115	8722022	11742376	protease,integrase,transposase	Bacillus_phage(20.0%)	49	8714385:8714420	8737986:8738021
WP_069869032.1|8652115_8653366_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_173963323.1|8654586_8655186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069869034.1|8655218_8655542_-	ferredoxin	NA	NA	NA	NA	NA
WP_069869120.1|8655766_8657533_+	proteasome ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	40.8	3.6e-35
WP_069869035.1|8657792_8659304_+	proteasome accessory factor PafA2	NA	NA	NA	NA	NA
WP_069869121.1|8659439_8659658_+	ubiquitin-like protein Pup	NA	NA	NA	NA	NA
WP_069869036.1|8659767_8660613_+	proteasome subunit beta	NA	NA	NA	NA	NA
WP_100807738.1|8660666_8661449_+	proteasome subunit alpha	NA	NA	NA	NA	NA
WP_079257017.1|8662065_8663046_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_100807739.1|8663755_8665039_+	MFS transporter	NA	NA	NA	NA	NA
WP_014059506.1|8665048_8666410_+	Pup--protein ligase	NA	NA	NA	NA	NA
WP_079257015.1|8666523_8667519_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_069869041.1|8667558_8667933_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_100807740.1|8668093_8669059_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_100807741.1|8669079_8670051_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_087684183.1|8670064_8670307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069869045.1|8670317_8670521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069869122.1|8670844_8671132_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_100807742.1|8671194_8672157_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_069869047.1|8672354_8675177_+	DEAD/DEAH box helicase	NA	M1HM79	Paramecium_bursaria_Chlorella_virus	33.2	6.5e-63
WP_100807743.1|8675200_8676961_-	IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_069869050.1|8677119_8677902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100807744.1|8678417_8679299_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_079257010.1|8679346_8680258_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	35.4	2.8e-15
WP_069869053.1|8680492_8681641_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	3.5e-31
WP_069869054.1|8681633_8684255_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_100807745.1|8684694_8686290_+	TROVE domain-containing protein	NA	A0A1J0GW83	Streptomyces_phage	42.4	1.3e-95
WP_100807746.1|8686514_8687252_+	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_100807747.1|8687294_8687954_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100807748.1|8688118_8689939_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_100807749.1|8690025_8690703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100807750.1|8691031_8694418_-	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_100807751.1|8694750_8695704_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_100807752.1|8695866_8696790_-	transketolase	NA	A0A0P0YNE1	Yellowstone_lake_phycodnavirus	31.8	3.7e-15
WP_100807753.1|8696820_8697522_-	transketolase	NA	NA	NA	NA	NA
WP_100809443.1|8697785_8699036_-|integrase	site-specific integrase	integrase	Q859H7	Micromonospora_phage	28.7	3.4e-24
WP_100807754.1|8699552_8700095_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_100804502.1|8702409_8703330_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	39.6	3.2e-43
WP_014043695.1|8703326_8703635_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.9	2.6e-18
WP_100807755.1|8705003_8707388_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_100807756.1|8707380_8708067_-	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_100807757.1|8708165_8709194_-	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_100807758.1|8709196_8710585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100807759.1|8710584_8711343_-	CRISPR-associated protein Cas6	NA	NA	NA	NA	NA
WP_100804488.1|8711850_8713052_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.1	1.9e-32
8714385:8714420	attL	TCCTCGGGTCCTCATCAGCCCTGGAGGGCTGGCAAC	NA	NA	NA	NA
WP_159398965.1|8714715_8715126_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_100809444.1|8715285_8715609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100807762.1|8720100_8720622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100807763.1|8721059_8722022_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
8737986:8738021	attR	TCCTCGGGTCCTCATCAGCCCTGGAGGGCTGGCAAC	NA	NA	NA	NA
>prophage 7
NZ_CP025018	Streptomyces sp. M56	11742376	11570610	11639723	11742376	transposase	Saccharomonospora_phage(25.0%)	55	NA	NA
WP_173963494.1|11570610_11571525_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100808908.1|11571710_11572274_+	CbrC family protein	NA	NA	NA	NA	NA
WP_100809578.1|11572929_11573697_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100808657.1|11573738_11574614_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_100808909.1|11575018_11575534_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100808910.1|11575523_11576171_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_159399058.1|11576411_11577725_+	DUF3500 domain-containing protein	NA	NA	NA	NA	NA
WP_159399059.1|11578023_11578656_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_159399060.1|11578717_11578987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100809609.1|11580019_11580754_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_100808914.1|11581091_11581487_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100808915.1|11581526_11582180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173963495.1|11583261_11584032_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_100809610.1|11584067_11586077_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_100808917.1|11586190_11586865_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_100808918.1|11586891_11587587_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_100809611.1|11587583_11588438_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_100808919.1|11589019_11589868_-	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	46.8	7.0e-53
WP_100808920.1|11590000_11590513_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_100808921.1|11590541_11591141_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100808922.1|11591237_11592260_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_100808923.1|11592259_11592862_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_100808924.1|11592927_11594043_+	alkene reductase	NA	NA	NA	NA	NA
WP_100808925.1|11595787_11596078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100809612.1|11596918_11597431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100808926.1|11597493_11597928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100808927.1|11599650_11601456_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_100808928.1|11601674_11602469_+	acetoin reductase	NA	W8CYX9	Bacillus_phage	44.2	2.7e-06
WP_093702966.1|11602525_11603524_+	amidohydrolase	NA	NA	NA	NA	NA
WP_100808929.1|11603525_11604281_+	iron-sulfur cluster assembly protein	NA	NA	NA	NA	NA
WP_100808930.1|11604277_11605303_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_100808931.1|11605719_11606862_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_100808932.1|11606952_11607675_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	36.0	3.7e-31
WP_093707487.1|11612228_11612495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100808933.1|11612885_11614130_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	I4AZM3	Saccharomonospora_phage	57.7	8.0e-98
WP_079153440.1|11614158_11614575_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	62.3	1.6e-42
WP_100808934.1|11615374_11615992_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_159399061.1|11615988_11617428_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_093704629.1|11617533_11618490_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100808936.1|11618586_11619783_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	34.7	1.1e-19
WP_093704633.1|11619782_11620682_-	FAD binding domain-containing protein	NA	NA	NA	NA	NA
WP_093704635.1|11620691_11621471_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_100808937.1|11621503_11623912_-	xanthine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_093704639.1|11623908_11625465_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.0	2.0e-29
WP_093704641.1|11625543_11626107_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100808938.1|11626256_11627396_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_100808939.1|11627485_11628913_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_100808940.1|11628909_11630556_+	acetolactate synthase	NA	E5EQ70	Micromonas_sp._RCC1109_virus	27.9	3.5e-40
WP_100808941.1|11630552_11631848_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_093705278.1|11631858_11633259_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_159399062.1|11633788_11634076_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100808942.1|11635020_11635872_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_100808943.1|11636243_11636876_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100808944.1|11637638_11637998_-	glyoxalase	NA	NA	NA	NA	NA
WP_100808945.1|11638766_11639723_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP025018	Streptomyces sp. M56	11742376	11663605	11704808	11742376	integrase,transposase	Bacillus_phage(33.33%)	42	11690439:11690455	11710476:11710492
WP_173963116.1|11663605_11664001_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_141729761.1|11664257_11664638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159399069.1|11664776_11665154_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_100808956.1|11665263_11666205_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_100808957.1|11666256_11666727_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100808958.1|11667602_11668820_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_100804488.1|11668797_11669999_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.1	1.9e-32
WP_100808657.1|11670316_11671192_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_100809578.1|11671233_11672001_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100808960.1|11672103_11672958_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	34.9	7.8e-28
WP_159399091.1|11674454_11675021_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100808962.1|11676614_11677196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173963497.1|11677391_11678930_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100808964.1|11679490_11680051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100808965.1|11681571_11681865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100808966.1|11682855_11683332_-	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100808967.1|11683328_11684108_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_100808968.1|11684253_11684874_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100808969.1|11685383_11686175_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_100808970.1|11686445_11686946_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159399070.1|11687159_11688095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100808972.1|11688201_11689428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100808973.1|11690035_11690263_-	hypothetical protein	NA	NA	NA	NA	NA
11690439:11690455	attL	TCGGCCGCCGCGGGAGC	NA	NA	NA	NA
WP_159399071.1|11691423_11691654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100808975.1|11691654_11692170_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	42.1	8.9e-27
WP_100809615.1|11692185_11692563_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100809616.1|11693084_11693561_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100808976.1|11693618_11694647_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_159399072.1|11694835_11695021_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100808978.1|11695189_11695300_-	Atu4866 domain-containing protein	NA	NA	NA	NA	NA
WP_100808979.1|11695327_11695927_-	MFS transporter	NA	NA	NA	NA	NA
WP_093700317.1|11696275_11697124_+	oxidoreductase	NA	NA	NA	NA	NA
WP_093700316.1|11697123_11697738_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107503163.1|11697654_11698185_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_159399073.1|11698227_11698434_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_159399074.1|11698922_11699525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100809617.1|11700047_11700356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093700313.1|11701130_11701565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100808980.1|11701643_11702168_+	VOC family protein	NA	NA	NA	NA	NA
WP_173963498.1|11702402_11702747_+	DsbA family protein	NA	NA	NA	NA	NA
WP_100808982.1|11702850_11703492_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107503165.1|11703416_11704808_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
11710476:11710492	attR	GCTCCCGCGGCGGCCGA	NA	NA	NA	NA
