The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	451531	484789	5444817	protease,tail,terminase,capsid,head,integrase,tRNA,portal	uncultured_Caudovirales_phage(73.33%)	35	469139:469156	485134:485151
WP_002919147.1|451531_452479_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|452493_453003_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|453131_454256_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|454227_454701_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|454726_455269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|455273_455846_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|455849_456668_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|456664_456922_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|456897_457452_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|463247_463469_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|463762_466873_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|466885_468025_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|468403_469054_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
469139:469156	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|469329_470556_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|470648_471590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|471771_472056_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|472066_472846_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|472969_473164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|473297_473567_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|473559_473748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|473740_474055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|474051_474420_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|474416_474782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|474781_476917_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|477259_477595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|477643_478156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|478419_479586_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|479637_480198_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|480199_481441_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|481437_481773_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|481769_482069_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|482068_482512_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|482638_482830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|482787_483144_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|483127_484789_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
485134:485151	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	1238371	1264426	5444817	integrase,transposase	Salmonella_phage(44.12%)	39	1229467:1229481	1266961:1266975
1229467:1229481	attL	GCCAGCACCCGCGCG	NA	NA	NA	NA
WP_000019473.1|1238371_1239352_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1239397_1240396_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1240398_1241028_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1241150_1241393_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1241425_1241935_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1241942_1242143_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1242106_1242445_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1242512_1242746_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1242745_1242973_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1242969_1243821_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1243817_1246202_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_009483812.1|1246431_1246683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1246682_1248167_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_023339258.1|1248263_1248602_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_032441458.1|1248594_1248798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491799.1|1248797_1249418_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_029602865.1|1249414_1249708_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_072200041.1|1249707_1250175_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_032441401.1|1250468_1251113_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_032441402.1|1251109_1251301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955107.1|1251284_1251695_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_048328152.1|1251887_1252235_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_032418532.1|1252354_1253140_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_004207253.1|1253136_1253904_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|1253903_1254113_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|1254259_1254493_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004144290.1|1254647_1255229_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004164029.1|1255595_1255895_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_062955106.1|1255891_1256713_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_062955105.1|1256709_1257591_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955104.1|1257639_1257888_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_009485475.1|1257997_1258291_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_048264082.1|1258283_1258442_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_062955103.1|1258438_1259101_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_004197356.1|1259097_1259691_+	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_063002073.1|1259687_1259930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062955102.1|1259872_1261123_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_004151979.1|1261314_1262892_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|1262959_1264426_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1266961:1266975	attR	GCCAGCACCCGCGCG	NA	NA	NA	NA
>prophage 3
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	1335776	1444974	5444817	lysis,tail,terminase,transposase,plate,coat,capsid,head,holin,tRNA,portal	Salmonella_phage(60.0%)	114	NA	NA
WP_002914079.1|1335776_1336514_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|1336645_1337977_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|1338022_1338406_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|1338719_1339409_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|1339466_1340552_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|1340755_1341181_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|1341250_1341949_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|1341983_1344635_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|1344755_1346111_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|1346152_1346476_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|1346479_1347778_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|1353743_1356317_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|1356446_1357178_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|1357174_1358155_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|1358286_1359024_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|1359294_1359630_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|1359736_1359784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|1359884_1361045_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|1361041_1361914_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|1361976_1363098_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|1363107_1364178_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|1364520_1365030_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|1365022_1366246_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|1366259_1366742_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|1366750_1368121_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|1368177_1368636_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|1368755_1369103_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|1369142_1369910_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|1369941_1370490_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|1370508_1370757_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|1371016_1372381_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|1372544_1373336_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|1373355_1374642_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|1374761_1375352_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|1375476_1376355_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|1376441_1378103_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|1378250_1378592_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|1378658_1378949_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|1378938_1379415_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|1379525_1380008_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004150980.1|1380611_1380989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|1381016_1381235_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|1381301_1382396_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|1382392_1382878_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|1382874_1385505_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|1385497_1385617_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|1385631_1385931_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|1385983_1386499_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|1386508_1387681_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|1387829_1388903_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|1388954_1390073_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|1390082_1392032_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|1392033_1392705_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|1392697_1393606_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|1393592_1393955_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|1393951_1394524_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|1394618_1395485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|1395507_1395954_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|1395946_1396369_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_085955118.1|1396331_1396535_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
WP_004150998.1|1396464_1396893_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|1396889_1397273_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|1397277_1397787_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|1397767_1397983_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|1397986_1398190_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|1398189_1398654_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|1398749_1399403_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|1399406_1400459_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|1400475_1401309_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|1401449_1403213_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|1403212_1404256_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|1404312_1404582_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|1405103_1406105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1406104_1407184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|1407170_1407854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|1407949_1408183_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|1408194_1408383_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004152765.1|1408490_1409975_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1409974_1410226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418540.1|1410378_1410636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1410713_1411298_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1411294_1412770_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1412813_1413185_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_072354015.1|1413234_1413477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|1413938_1414145_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1414159_1415842_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
WP_004152446.1|1415838_1416135_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1416137_1416818_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1416832_1417819_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1417872_1418310_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1418320_1418662_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1418712_1419036_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1419035_1419641_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1419640_1422118_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1422117_1422582_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1422581_1423121_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1423131_1425666_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1425665_1427576_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1427575_1430332_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955134.1|1430328_1430523_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
WP_071787028.1|1430557_1430710_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
WP_062955133.1|1430808_1431105_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|1433932_1434196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062956176.1|1434236_1435370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032188295.1|1435358_1435445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|1435483_1436464_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000608644.1|1437332_1438595_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_072354001.1|1439485_1439626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077265603.1|1439703_1441020_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1441106_1441511_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1441497_1441803_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1441792_1442422_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1442418_1442919_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1443105_1444974_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	1777325	1784230	5444817	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1777325_1778189_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_004180550.1|1778199_1778973_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1779213_1780107_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1780352_1781714_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1782032_1782755_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1782751_1784230_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	1827575	1839250	5444817	transposase	Escherichia_phage(33.33%)	10	NA	NA
WP_000043543.1|1827575_1828982_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1829208_1830624_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1830645_1832016_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1832170_1833235_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1833248_1834118_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1834149_1835040_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1835054_1835609_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1835788_1836955_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_072353990.1|1837317_1838229_+	acyltransferase	NA	NA	NA	NA	NA
WP_000019473.1|1838269_1839250_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 6
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	2831555	2842442	5444817		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2831555_2834663_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2834717_2835983_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2836013_2837102_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2837188_2837449_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2837746_2838607_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2838627_2839389_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2839649_2840552_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2840563_2841829_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2841821_2842442_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	3060073	3098539	5444817	integrase,terminase	uncultured_Caudovirales_phage(34.04%)	56	3089652:3089666	3095661:3095675
WP_004152576.1|3060073_3060940_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3060939_3061713_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3061709_3062906_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3062905_3063259_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3063260_3063914_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3063967_3064534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3064570_3064756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3064808_3065150_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3065149_3066172_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3066174_3066477_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3066477_3067077_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3067076_3069080_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3069069_3069222_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3069257_3069683_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3069686_3070127_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3070137_3071283_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3071286_3071727_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3071821_3072208_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3072207_3072714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3072710_3073130_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3073098_3073380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3073419_3074361_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3074372_3074867_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3074870_3076073_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3076124_3076673_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3076728_3078180_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3078417_3079818_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3079768_3080521_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3080622_3080943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3081177_3081567_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3081563_3082094_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3082096_3082345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3082750_3083533_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3083529_3084006_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3084002_3084965_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3084966_3086625_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|3086933_3087227_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|3087201_3087423_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3087520_3088189_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3088359_3088674_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3088666_3088855_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3089024_3089390_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3089382_3089637_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3089652:3089666	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3089823_3090249_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3090245_3090440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3090436_3091264_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3091368_3091887_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3091892_3092603_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3092592_3092817_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3092813_3093026_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3093022_3093502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3093680_3093923_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3093903_3095085_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3095281_3095830_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3095661:3095675	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3096028_3097561_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3097777_3098539_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	3131472	3185565	5444817	holin,integrase,transposase,protease	Enterobacteria_phage(33.33%)	64	3131254:3131269	3160923:3160938
3131254:3131269	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3131472_3132144_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3132330_3133158_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3133233_3134499_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3134500_3134920_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3134999_3136484_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3136483_3136735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152776.1|3137381_3137804_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3138396_3139101_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3139716_3140064_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3140227_3141019_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3142000_3142705_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3142741_3143029_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3143025_3143565_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004218567.1|3143561_3143873_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
WP_022644626.1|3144339_3145386_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3145611_3146301_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3146300_3146441_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3146437_3147076_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3147068_3147737_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3147733_3147901_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3147881_3148349_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3148869_3149898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3150105_3150351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3150406_3150709_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3150705_3151554_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3151550_3152411_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3152496_3152718_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3152758_3152986_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3153097_3153796_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3153818_3153938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3154083_3155160_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3155241_3155445_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3155873_3156068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3156156_3156441_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3156456_3157302_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201102.1|3157587_3158268_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3158264_3158693_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3158689_3159352_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|3159348_3159663_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004153574.1|3159559_3160747_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3160923_3161814_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3160923:3160938	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3161813_3162806_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3162807_3163617_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004176464.1|3163661_3165092_-	cytosine permease	NA	NA	NA	NA	NA
WP_004152967.1|3165288_3165831_+	HutD family protein	NA	NA	NA	NA	NA
WP_004140277.1|3166029_3166818_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004151905.1|3167008_3168166_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002901787.1|3168247_3170182_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_002901786.1|3170340_3170520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901785.1|3170591_3171341_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004151906.1|3171613_3171835_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901782.1|3171966_3172293_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151907.1|3172292_3173030_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901781.1|3173221_3174391_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_002901780.1|3174397_3174706_-	LapA family protein	NA	NA	NA	NA	NA
WP_002901779.1|3174841_3175609_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901778.1|3175772_3176375_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901777.1|3176421_3179094_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_071526626.1|3179104_3179311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901776.1|3179482_3179650_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901772.1|3179895_3180870_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901763.1|3181215_3183813_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|3184219_3184471_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|3184518_3185565_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 9
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	3291289	3379168	5444817	lysis,tail,terminase,capsid,head,integrase,tRNA,portal	Klebsiella_phage(45.45%)	96	3318092:3318106	3376979:3376993
WP_002901088.1|3291289_3291790_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3291906_3292353_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3292336_3293128_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3293229_3294414_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3294445_3295138_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3295283_3295793_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3295779_3296136_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3296125_3296365_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3296665_3297679_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3297736_3297838_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3297837_3297912_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3298029_3298155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3298214_3298478_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3298608_3299247_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3299336_3300251_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_020956815.1|3300466_3300658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150784.1|3300912_3301956_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3302258_3303467_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3303540_3305325_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3305331_3306222_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3306342_3307851_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3308161_3308848_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3309245_3309425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3309464_3310097_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3310663_3310861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3310976_3311987_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3311983_3313390_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3313445_3314333_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3314349_3314856_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3314882_3315377_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3315467_3315653_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3316274_3317468_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3317580_3317808_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3318092:3318106	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3318244_3318568_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3318560_3318953_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3318949_3319663_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3319935_3320088_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3320242_3321739_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3321807_3334512_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3334574_3335168_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3335194_3335617_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3335658_3336369_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3336370_3337126_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3337122_3337461_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3337460_3340796_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_071836352.1|3340795_3341014_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3341028_3341394_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3341451_3341913_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3341944_3342346_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3342342_3342732_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3342712_3343051_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3343047_3343365_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3343345_3343606_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3343664_3344951_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3345028_3345949_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3345985_3347245_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3347244_3347424_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3347417_3349139_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3349138_3349573_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3349821_3350253_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3350249_3350573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3350524_3350887_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3351213_3351438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3351476_3351914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3352863_3353214_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3353210_3353708_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3353707_3353923_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_025861432.1|3356174_3356777_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3356793_3357825_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_017898980.1|3357824_3358028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861428.1|3358024_3358417_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3358457_3358748_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3358759_3358993_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3359071_3360556_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3360555_3360807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|3361396_3362758_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3362931_3363645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3363996_3364866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3364954_3366346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3366694_3367135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3367148_3367613_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_094681708.1|3367605_3368610_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.4e-31
WP_046622349.1|3368669_3369224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3369226_3369451_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3369539_3369977_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3370298_3370613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099143961.1|3370775_3370994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3371003_3371198_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3371240_3371585_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3371726_3373865_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3373917_3374163_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3374143_3375271_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|3375388_3376639_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3376879_3377530_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3376979:3376993	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3377546_3378005_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3378061_3379168_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	3595147	3688097	5444817	protease,lysis,tail,terminase,plate,capsid,head,integrase,tRNA,portal	Salmonella_phage(57.89%)	96	3633740:3633755	3690530:3690545
WP_002898139.1|3595147_3596440_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3596530_3597874_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3597882_3598494_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3598616_3602870_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3603005_3603500_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3604032_3605001_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3605115_3606882_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3606882_3608604_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3608648_3609350_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3609703_3609922_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3610042_3612322_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3612352_3612670_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3612995_3613217_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071528213.1|3613171_3613354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150848.1|3613293_3615234_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3615230_3616346_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3616492_3618151_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3618570_3619266_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3619381_3620281_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3620424_3622077_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3622087_3623056_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_085666582.1|3623006_3623210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896408.1|3623267_3623702_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3623853_3625572_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3625610_3626612_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3626622_3628065_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3628152_3629166_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3629162_3629993_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3630024_3631164_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004147767.1|3631216_3631396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896394.1|3632041_3632557_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3632783_3633512_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3633532_3634264_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
3633740:3633755	attL	GACAGCCTGATCCCGG	NA	NA	NA	NA
WP_002896386.1|3634270_3634987_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3634986_3635655_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3635838_3636570_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3636612_3638085_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3638081_3638798_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3638876_3640004_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3640045_3640534_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3640591_3641437_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3641433_3642387_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3642397_3643531_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3643694_3644807_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3645155_3645635_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3645723_3646626_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3647447_3647735_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3647937_3648201_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3648207_3648591_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3648857_3650543_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3650762_3650981_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3651072_3652173_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3652169_3652655_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3652651_3655279_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3655271_3655391_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3655405_3655705_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3655757_3656273_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3656282_3657455_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896188.1|3658698_3658902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3658898_3659630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3659633_3662585_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3662586_3663186_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3663178_3664087_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3664073_3664436_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3664432_3665005_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3665099_3665792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3665788_3666235_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3666227_3666659_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3666754_3667183_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3667179_3667563_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3667567_3668077_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3668057_3668273_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3668276_3668480_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3668479_3668944_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3669039_3669690_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3669693_3670752_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3670768_3671602_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3671744_3673511_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3673510_3674536_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3674597_3676340_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3676615_3677293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316229.1|3677407_3677713_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3677651_3677840_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3677993_3680408_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3680404_3681262_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3681258_3681486_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3681485_3681719_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3681786_3682128_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3682091_3682292_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3682299_3682809_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3682841_3683063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3683208_3684087_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3684098_3685043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3685141_3686626_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3686625_3686877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3687044_3688097_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3690530:3690545	attR	GACAGCCTGATCCCGG	NA	NA	NA	NA
>prophage 11
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	4331795	4343448	5444817	integrase	Enterobacteria_phage(70.0%)	13	4332245:4332259	4355301:4355315
WP_004144574.1|4331795_4332899_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4332245:4332259	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4332909_4334163_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4334515_4335706_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4335693_4336644_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4336643_4337069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4337636_4338203_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4338220_4338466_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4338462_4339200_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4339741_4340008_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4340004_4340562_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4340558_4340786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4340782_4341103_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4341114_4343448_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4355301:4355315	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	4812991	4822516	5444817	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
WP_004152207.1|4812991_4815325_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4815339_4815660_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4815656_4815884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4815880_4816429_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4817252_4817990_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4817986_4818232_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4818249_4818816_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4819556_4820636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4820636_4821173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4821535_4822516_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP028582	Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence	149258	1796	36848	149258	protease,transposase,integrase	Escherichia_phage(41.67%)	43	9236:9295	36091:36912
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012602143.1|2669_3134_+	Plasmid stable inheritance protein	NA	NA	NA	NA	NA
WP_012602142.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_012579081.1|6614_7538_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
9236:9295	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|9288_9993_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023145375.1|10285_10600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|10538_11552_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|11843_12398_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001749986.1|12494_12947_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_001749985.1|13079_13553_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749984.1|13733_14579_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_000679427.1|14695_15043_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|15036_15876_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|15805_15985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|16003_16504_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|16809_16923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|17010_17775_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024139167.1|17816_18029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749969.1|18041_19250_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|19283_20717_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|21098_21305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749966.1|21309_21951_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|22006_22318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|22353_22668_-	KikA protein	NA	NA	NA	NA	NA
WP_001749964.1|22664_23009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|23024_23375_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749963.1|23438_24173_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000440698.1|24181_24463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|24472_24766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|24815_25133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749961.1|25132_27733_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_001749960.1|27750_28464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749959.1|28471_28699_+	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749958.1|28714_29755_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001257173.1|29837_29984_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000646594.1|29973_30672_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_019706045.1|30745_31567_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101710.1|31566_32727_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000128596.1|32768_33764_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000792636.1|33763_34297_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_001067855.1|36143_36848_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
36091:36912	attR	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 2
NZ_CP028582	Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence	149258	43201	101017	149258	transposase	Escherichia_phage(36.0%)	67	NA	NA
WP_032072906.1|43201_43462_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
WP_015493073.1|43648_43840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|43882_44389_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493075.1|44793_45573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|45626_46046_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493077.1|46056_46278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|46277_46955_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493079.1|47313_47985_+	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_015493080.1|48164_48587_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493081.1|48586_49858_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_016479949.1|49993_50965_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493083.1|50961_52167_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_022652286.1|52529_53162_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_040219232.1|53215_53416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493085.1|53562_54513_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_015493086.1|54509_55121_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493087.1|55117_55513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|56026_57007_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_042934582.1|57658_58216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|58684_59389_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|59521_60163_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|60312_60813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|60892_61597_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550559.1|61630_62122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|62228_62966_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|62962_63187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954592.1|63308_63485_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|63666_64671_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|64749_65184_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|65255_65606_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|65619_65895_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|65930_66353_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|66404_68099_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|68116_68479_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|68475_68712_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|68708_69416_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|70727_71432_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343468.1|71471_71945_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_108083619.1|73007_74075_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_014343509.1|74146_74305_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_040245921.1|74997_75270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040245917.1|75266_75617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343505.1|75631_75949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343501.1|76789_77146_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	7.5e-25
WP_014343500.1|77206_77419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|77429_77654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343498.1|77734_78055_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	1.5e-08
WP_004152721.1|78044_78323_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_071717300.1|78768_79029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153804.1|78943_79162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152492.1|79259_80081_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_013214015.1|80113_80443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343495.1|80475_80961_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_013214017.1|81384_81768_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_032414397.1|82027_82705_+	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
WP_004144426.1|82855_83026_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_004194426.1|83087_83456_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_004144424.1|83469_83775_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001067855.1|84214_84919_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|86029_86734_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015059018.1|87810_90627_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000632668.1|90659_91181_+	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_015059019.1|91202_91937_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_077249363.1|92073_92877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059274178.1|92927_95144_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_071177725.1|95143_100279_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_001067855.1|100312_101017_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP028582	Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence	149258	117933	129092	149258		Escherichia_phage(50.0%)	11	NA	NA
WP_001568041.1|117933_118635_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|119071_119302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|119364_120036_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|120038_121010_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152765.1|121258_122743_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|122742_122994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568036.1|123152_123584_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|123583_124855_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_086523286.1|124936_125914_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|125910_127116_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|128225_129092_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
