The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	0	7923	2993983	protease	Agrobacterium_phage(25.0%)	7	NA	NA
WP_049064218.1|188_869_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_005531783.1|1006_1606_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.4	2.5e-41
WP_049151627.1|1627_2251_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	39.3	3.0e-29
WP_005531781.1|2629_4129_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.6	2.0e-66
WP_049146670.1|4125_4890_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_005531779.1|4949_6308_-	MFS transporter	NA	NA	NA	NA	NA
WP_049151628.1|6627_7923_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.2	2.3e-132
>prophage 2
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	13617	16443	2993983	tRNA	Catovirus(100.0%)	1	NA	NA
WP_100621886.1|13617_16443_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.2	6.6e-132
>prophage 3
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	22630	23041	2993983		Anguillid_herpesvirus(100.0%)	1	NA	NA
WP_034657564.1|22630_23041_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	47.0	1.1e-27
>prophage 4
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	32796	34894	2993983		Streptococcus_phage(50.0%)	2	NA	NA
WP_172953443.1|32796_33954_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.5	5.0e-54
WP_100621894.1|33988_34894_+	hypothetical protein	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	28.1	5.2e-14
>prophage 5
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	39727	42432	2993983		Planktothrix_phage(33.33%)	3	NA	NA
WP_005528314.1|39727_40480_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	2.5e-14
WP_049160776.1|40457_41738_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	43.6	4.1e-81
WP_049160779.1|41814_42432_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	28.8	2.2e-16
>prophage 6
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	51645	55445	2993983		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_049147742.1|51645_52473_-	DNA adenine methylase	NA	A0A2I4R668	Erysipelothrix_phage	42.6	1.2e-49
WP_005528335.1|52580_52844_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_005528336.1|53036_53576_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_005528339.1|53594_55445_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	38.2	4.2e-18
>prophage 7
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	58832	64083	2993983		Vibrio_phage(50.0%)	3	NA	NA
WP_172953444.1|58832_60653_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.3	1.5e-15
WP_005528349.1|60974_62657_-	FUSC family protein	NA	NA	NA	NA	NA
WP_100621900.1|62670_64083_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.0e-16
>prophage 8
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	71899	78501	2993983		Bacillus_phage(50.0%)	4	NA	NA
WP_100621905.1|71899_73789_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.4e-47
WP_100621906.1|74034_74559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049151659.1|74555_75086_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_100621907.1|75741_78501_+	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	23.5	3.8e-07
>prophage 9
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	95678	97520	2993983		Catovirus(100.0%)	1	NA	NA
WP_049062573.1|95678_97520_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	28.8	2.7e-57
>prophage 10
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	104408	107284	2993983		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_005528424.1|104408_105554_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.1	1.7e-22
WP_100621915.1|105553_106276_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_049147715.1|106285_107284_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.8	1.4e-49
>prophage 11
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	115161	116541	2993983	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_005528455.1|115161_116541_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.9	3.1e-50
>prophage 12
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	124669	126610	2993983		Caulobacter_phage(100.0%)	1	NA	NA
WP_100621921.1|124669_126610_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	33.9	2.7e-52
>prophage 13
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	138439	138889	2993983		Salmonella_phage(100.0%)	1	NA	NA
WP_049062888.1|138439_138889_+	SocA family protein	NA	I6R0L8	Salmonella_phage	44.7	1.8e-28
>prophage 14
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	145844	147422	2993983		Streptococcus_phage(100.0%)	1	NA	NA
WP_005528514.1|145844_147422_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	33.8	4.2e-59
>prophage 15
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	163148	164324	2993983		Aureococcus_anophage(100.0%)	1	NA	NA
WP_100621927.1|163148_164324_+	bifunctional RNase H/acid phosphatase	NA	A0A076FI68	Aureococcus_anophage	33.3	7.7e-10
>prophage 16
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	180499	203987	2993983	protease,transposase	Shigella_phage(28.57%)	17	NA	NA
WP_049159007.1|180499_181429_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_049062570.1|181476_182007_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_100621932.1|182201_183836_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.4	1.0e-137
WP_129721063.1|183991_184354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049147642.1|184785_185454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049063053.1|185587_186385_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	36.0	6.2e-27
WP_049063054.1|186514_189118_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_049063055.1|189121_190942_-	site-specific DNA-methyltransferase	NA	B3RH19	Escherichia_phage	32.6	2.3e-45
WP_049063056.1|191055_191616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049192745.1|192028_193426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049063058.1|193669_194581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049063059.1|194577_195093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100618583.1|197088_197388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100621934.1|197384_198023_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.6	1.1e-13
WP_100621935.1|198080_199296_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.8	1.5e-32
WP_100619247.1|199662_200887_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_100619247.1|202761_203987_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
>prophage 17
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	208076	209708	2993983		Rhodococcus_phage(100.0%)	1	NA	NA
WP_080972048.1|208076_209708_-	hypothetical protein	NA	A0A1I9SA50	Rhodococcus_phage	39.2	5.1e-28
>prophage 18
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	220238	223094	2993983		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_049192350.1|220238_223094_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	47.5	5.1e-241
>prophage 19
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	226792	230157	2993983	transposase	Burkholderia_virus(50.0%)	3	NA	NA
WP_100619247.1|226792_228017_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_080548596.1|228080_228500_+	oxidoreductase	NA	NA	NA	NA	NA
WP_005528643.1|228609_230157_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.6	3.6e-39
>prophage 20
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	233872	235795	2993983		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_100621939.1|233872_235795_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	27.9	1.4e-29
>prophage 21
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	244105	245961	2993983		Lactobacillus_phage(50.0%)	2	NA	NA
WP_046645209.1|244105_244735_+	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	50.6	1.7e-11
WP_100622427.1|245013_245961_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	40.0	2.0e-16
>prophage 22
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	250146	253450	2993983		Mycobacterium_phage(50.0%)	3	NA	NA
WP_005528677.1|250146_250656_+	polyadenylate-specific 3'-exoribonuclease AS	NA	A0A076G882	Mycobacterium_phage	43.9	5.1e-27
WP_034656806.1|250700_252089_+	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_049063086.1|252085_253450_-	serine/threonine protein kinase	NA	A0A1V0SDC3	Indivirus	29.7	7.6e-17
>prophage 23
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	280421	283598	2993983	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_049152177.1|280421_283598_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	34.4	2.5e-172
>prophage 24
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	293242	296815	2993983		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_100618714.1|293242_296815_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	55.1	0.0e+00
>prophage 25
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	301374	305939	2993983		Streptococcus_phage(50.0%)	6	NA	NA
WP_049152187.1|301374_302016_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.5	3.8e-27
WP_005528768.1|302037_302274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005528770.1|302293_302680_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_049152188.1|302676_303684_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_100622428.1|303753_304374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100621949.1|304583_305939_-	DNA polymerase III subunit epsilon	NA	A0A0R6PHP9	Moraxella_phage	25.0	3.4e-09
>prophage 26
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	325092	330290	2993983		Iris_mild_mosaic_virus(50.0%)	4	NA	NA
WP_049062407.1|325092_327480_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	54.1	6.6e-16
WP_005528816.1|327567_328770_-	amidohydrolase	NA	NA	NA	NA	NA
WP_005528817.1|328806_329205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049062406.1|329201_330290_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	28.1	9.0e-13
>prophage 27
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	333901	335493	2993983		Dishui_lake_phycodnavirus(50.0%)	2	NA	NA
WP_005528828.1|333901_334672_+	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	33.5	5.4e-20
WP_049152201.1|334671_335493_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	29.2	6.4e-19
>prophage 28
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	340947	342546	2993983		uncultured_phage(100.0%)	1	NA	NA
WP_100621951.1|340947_342546_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	38.5	1.7e-12
>prophage 29
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	349063	350476	2993983		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_049192534.1|349063_350476_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	26.4	1.9e-18
>prophage 30
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	355928	358199	2993983		Gordonia_phage(100.0%)	1	NA	NA
WP_049158758.1|355928_358199_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	27.8	1.3e-48
>prophage 31
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	379321	380221	2993983		Brevibacillus_phage(100.0%)	1	NA	NA
WP_049063490.1|379321_380221_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.6	8.5e-25
>prophage 32
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	394552	400251	2993983		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_005528935.1|394552_395944_-	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	6.3e-43
WP_100621959.1|395999_397004_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049063475.1|397345_398848_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_049063520.1|398931_400251_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.4	8.1e-40
>prophage 33
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	405486	405822	2993983		Rhodococcus_phage(100.0%)	1	NA	NA
WP_100621960.1|405486_405822_-	transglycosylase family protein	NA	A0A1I9SA30	Rhodococcus_phage	61.5	9.8e-27
>prophage 34
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	411157	413983	2993983		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_100621961.1|411157_413983_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.0	4.1e-17
>prophage 35
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	427167	427917	2993983		Mycobacterium_phage(100.0%)	1	NA	NA
WP_049063454.1|427167_427917_+	FAD-dependent thymidylate synthase	NA	A0A220NRW5	Mycobacterium_phage	49.1	6.2e-45
>prophage 36
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	431962	436781	2993983		Mycobacterium_phage(50.0%)	2	NA	NA
WP_100621966.1|431962_435427_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	59.2	1.9e-109
WP_005528996.1|435662_436781_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	32.9	3.0e-35
>prophage 37
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	440571	443596	2993983		Bacillus_virus(50.0%)	4	NA	NA
WP_049145045.1|440571_441264_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	2.1e-15
WP_046645313.1|441269_441860_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_046645314.1|442006_442222_+	DUF3046 domain-containing protein	NA	NA	NA	NA	NA
WP_100621967.1|442462_443596_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	71.7	2.3e-128
>prophage 38
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	446844	447573	2993983		Planktothrix_phage(100.0%)	1	NA	NA
WP_049145056.1|446844_447573_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	1.9e-35
>prophage 39
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	458025	459306	2993983		Enterobacteria_phage(100.0%)	1	NA	NA
WP_034656838.1|458025_459306_+	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	44.6	9.8e-83
>prophage 40
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	463028	471891	2993983		Stenotrophomonas_phage(33.33%)	6	NA	NA
WP_005529041.1|463028_464720_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A2D2W2B1	Stenotrophomonas_phage	36.5	7.5e-06
WP_034656840.1|464851_465637_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_049145084.1|465945_466671_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	49.2	2.1e-10
WP_046645330.1|466957_467353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034656841.1|467509_467968_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_100621968.1|467985_471891_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	25.2	2.0e-46
>prophage 41
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	475676	483809	2993983		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_100621970.1|475676_478220_-	DEAD/DEAH box helicase	NA	M1HM79	Paramecium_bursaria_Chlorella_virus	32.7	8.0e-44
WP_100621971.1|478283_479378_-	PAC2 family protein	NA	NA	NA	NA	NA
WP_100621972.1|479717_480836_+	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_046645337.1|480837_481824_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.7	5.4e-49
WP_034656975.1|481824_482505_-	FeoA domain-containing protein	NA	NA	NA	NA	NA
WP_005529064.1|482795_483809_-	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	37.9	3.0e-42
>prophage 42
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	490702	492756	2993983		Mycobacterium_phage(50.0%)	2	NA	NA
WP_005529078.1|490702_490954_+	DUF3039 domain-containing protein	NA	A0A1C9M1E0	Mycobacterium_phage	53.2	4.9e-15
WP_049063036.1|490974_492756_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	43.5	9.4e-84
>prophage 43
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	500133	501030	2993983		Escherichia_phage(100.0%)	1	NA	NA
WP_049063025.1|500133_501030_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	38.0	1.5e-37
>prophage 44
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	504979	506098	2993983		Synechococcus_phage(100.0%)	1	NA	NA
WP_005529092.1|504979_506098_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	31.8	8.3e-38
>prophage 45
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	509568	513376	2993983		Acanthamoeba_polyphaga_moumouvirus(50.0%)	3	NA	NA
WP_100621977.1|509568_510555_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	33.5	9.0e-28
WP_100621978.1|510554_512015_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_049145317.1|512050_513376_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	5.8e-14
>prophage 46
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	523640	528656	2993983		Klosneuvirus(100.0%)	1	NA	NA
WP_100622432.1|523640_528656_-	DEAD/DEAH box helicase	NA	A0A1V0SLK7	Klosneuvirus	26.1	2.4e-36
>prophage 47
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	544516	545431	2993983		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005529156.1|544516_545431_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.9	1.1e-38
>prophage 48
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	548864	553760	2993983		Vibrio_phage(50.0%)	5	NA	NA
WP_049064403.1|548864_550301_-	RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	37.8	3.0e-40
WP_100621993.1|550508_551270_-	ROK family protein	NA	NA	NA	NA	NA
WP_005529162.1|552276_552567_+	DUF4193 domain-containing protein	NA	NA	NA	NA	NA
WP_005529163.1|552678_553209_-	DUF3093 domain-containing protein	NA	NA	NA	NA	NA
WP_046645360.1|553286_553760_+	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	56.6	4.8e-35
>prophage 49
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	568437	570501	2993983	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_049063928.1|568437_570501_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.5	5.2e-110
>prophage 50
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	579538	588963	2993983		Bacillus_phage(25.0%)	7	NA	NA
WP_005529216.1|579538_580642_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.2	1.4e-05
WP_046646632.1|580689_580977_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_080972097.1|581161_583057_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_049063943.1|583059_584253_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	27.1	2.7e-18
WP_049063945.1|584384_586001_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_049063947.1|586054_586609_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	34.7	2.0e-16
WP_049063948.1|586671_588963_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	2.3e-10
>prophage 51
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	603274	604036	2993983		Moraxella_phage(100.0%)	1	NA	NA
WP_100622434.1|603274_604036_+	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	39.7	3.0e-39
>prophage 52
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	607879	608773	2993983		Rhodococcus_phage(100.0%)	1	NA	NA
WP_049063968.1|607879_608773_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	44.9	5.3e-51
>prophage 53
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	612112	616308	2993983	tRNA	Bacillus_virus(50.0%)	2	NA	NA
WP_049063973.1|612112_613474_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	44.7	2.3e-90
WP_049063974.1|613620_616308_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	34.8	1.4e-62
>prophage 54
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	619686	620898	2993983		Pandoravirus(100.0%)	1	NA	NA
WP_005529285.1|619686_620898_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.9	2.6e-45
>prophage 55
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	625540	626293	2993983		Bacillus_virus(100.0%)	1	NA	NA
WP_172453479.1|625540_626293_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.2	1.3e-21
>prophage 56
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	629550	633575	2993983		Bacillus_phage(50.0%)	3	NA	NA
WP_100622002.1|629550_632208_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.1	1.8e-46
WP_172454573.1|632273_632729_-	RDD family protein	NA	NA	NA	NA	NA
WP_049151735.1|632816_633575_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	28.6	9.1e-12
>prophage 57
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	643817	652927	2993983	tRNA	Mycobacterium_phage(25.0%)	9	NA	NA
WP_005529324.1|643817_644420_-	MBL fold metallo-hydrolase	NA	A0A0C5AMT2	Mycobacterium_phage	53.7	3.5e-06
WP_100622005.1|644511_647349_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.2	4.0e-286
WP_100622006.1|647453_648296_+	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_080548604.1|648594_649116_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	1.4e-11
WP_005529328.1|649152_649347_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005323264.1|649402_649786_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_100622007.1|650072_650540_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_005529332.1|650701_651505_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_046646847.1|651880_652927_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.2	1.8e-26
>prophage 58
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	659009	660179	2993983		Klosneuvirus(100.0%)	1	NA	NA
WP_005529349.1|659009_660179_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	1.7e-17
>prophage 59
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	664757	666017	2993983	tRNA	Serratia_phage(100.0%)	1	NA	NA
WP_049064248.1|664757_666017_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	38.7	1.1e-70
>prophage 60
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	680642	684158	2993983		Virus_Rctr41k(33.33%)	4	NA	NA
WP_049062691.1|680642_681539_+	site-specific tyrosine recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	27.8	2.2e-17
WP_034657531.1|681837_682710_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.2	1.5e-21
WP_049062690.1|682721_683519_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_005531429.1|683612_684158_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.4	3.6e-10
>prophage 61
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	689977	695516	2993983		Bacillus_phage(66.67%)	4	NA	NA
WP_049159168.1|689977_691447_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	39.5	6.5e-06
WP_172953411.1|691449_693225_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	1.0e-21
WP_080972391.1|693417_694206_+	feruloyl esterase	NA	NA	NA	NA	NA
WP_172953412.1|694202_695516_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	35.0	2.0e-59
>prophage 62
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	700681	702616	2993983		Liberibacter_phage(100.0%)	1	NA	NA
WP_049192572.1|700681_702616_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.3	1.1e-26
>prophage 63
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	715198	716644	2993983		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_005531471.1|715198_716644_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	27.2	1.1e-34
>prophage 64
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	729773	730667	2993983		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_005531487.1|729773_730667_-	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	37.2	1.7e-25
>prophage 65
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	737663	740492	2993983		Aureococcus_anophage(100.0%)	1	NA	NA
WP_100622021.1|737663_740492_-	DEAD/DEAH box helicase	NA	A0A076FHE1	Aureococcus_anophage	28.0	4.0e-60
>prophage 66
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	747192	751862	2993983	tRNA	Lymphocystis_disease_virus(50.0%)	4	NA	NA
WP_100622023.1|747192_748752_-	proteasome ATPase	NA	Q677Q6	Lymphocystis_disease_virus	37.1	1.6e-34
WP_100622024.1|748854_749691_-|tRNA	tRNA (adenine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
WP_049158954.1|749728_750988_-	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_034657506.1|751034_751862_+	RecB family exonuclease	NA	D5GVY9	Campylobacter_virus	29.6	2.3e-16
>prophage 67
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	759524	760763	2993983		Tupanvirus(100.0%)	1	NA	NA
WP_100622026.1|759524_760763_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	30.7	2.5e-35
>prophage 68
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	770785	772675	2993983		Gordonia_phage(100.0%)	1	NA	NA
WP_100622030.1|770785_772675_-	C40 family peptidase	NA	A0A0K0NL58	Gordonia_phage	42.9	4.4e-23
>prophage 69
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	784821	788678	2993983		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_049145830.1|784821_786453_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	27.8	4.3e-35
WP_005531583.1|786575_786983_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_049062383.1|786983_787433_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	39.9	3.6e-16
WP_049191636.1|787433_788678_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	43.7	6.8e-97
>prophage 70
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	794664	795594	2993983		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_005531595.1|794664_795594_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	4.7e-18
>prophage 71
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	803116	804649	2993983		Synechococcus_phage(100.0%)	1	NA	NA
WP_049062373.1|803116_804649_+	glucose-6-phosphate dehydrogenase	NA	E3SIC8	Synechococcus_phage	37.2	9.0e-75
>prophage 72
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	811628	812594	2993983		Streptococcus_phage(100.0%)	1	NA	NA
WP_100622036.1|811628_812594_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	34.3	1.3e-31
>prophage 73
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	816214	818611	2993983		Staphylococcus_phage(100.0%)	3	NA	NA
WP_005531627.1|816214_816694_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	34.2	7.0e-10
WP_049145853.1|816722_817985_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	43.5	9.6e-91
WP_049062367.1|817996_818611_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.2	6.0e-30
>prophage 74
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	823019	829361	2993983		Synechococcus_phage(25.0%)	6	NA	NA
WP_034657519.1|823019_823529_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	36.7	1.2e-12
WP_100622040.1|823662_825699_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_100622041.1|825710_826943_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	57.0	1.8e-121
WP_100622438.1|827063_828338_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9J5A8	Fowlpox_virus	33.9	1.9e-14
WP_100622042.1|828448_828751_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_005531650.1|828791_829361_-	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	31.5	2.0e-19
>prophage 75
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	834174	837708	2993983		Halovirus(50.0%)	3	NA	NA
WP_049191659.1|834174_835344_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.7	1.1e-43
WP_049145867.1|835388_836738_-	dihydroorotase	NA	NA	NA	NA	NA
WP_049191661.1|836754_837708_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	34.8	4.6e-29
>prophage 76
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	843188	843665	2993983		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_049151714.1|843188_843665_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	34.6	2.4e-18
>prophage 77
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	848020	848632	2993983		Chelonid_alphaherpesvirus(100.0%)	1	NA	NA
WP_172953415.1|848020_848632_-	uracil-DNA glycosylase	NA	V5NWU7	Chelonid_alphaherpesvirus	46.7	5.4e-31
>prophage 78
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	858125	955049	2993983	protease,tRNA,transposase,integrase	Burkholderia_virus(21.05%)	80	915141:915200	917429:917523
WP_049063548.1|858125_858716_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	34.6	5.4e-12
WP_053086289.1|858764_859601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065420841.1|859787_860213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622053.1|860243_860876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622054.1|861224_862685_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_100622055.1|862712_863937_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_049160910.1|864160_864928_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100622056.1|865178_866330_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	NA	NA	NA	NA
WP_100622440.1|866329_866896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049191912.1|867461_868139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049191914.1|868139_869036_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_080972403.1|869048_869789_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_049191918.1|869772_872859_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.5	8.7e-61
WP_080972404.1|872855_873857_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_100622057.1|874075_876535_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	38.0	8.2e-78
WP_100622058.1|878065_879001_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_100619247.1|879028_880254_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_172953416.1|881627_883136_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_080986237.1|883295_885794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053085000.1|885850_886945_+	cell surface protein	NA	NA	NA	NA	NA
WP_080974105.1|886944_888465_+	anchored repeat ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
WP_053085001.1|888582_889443_+	peptidase	NA	NA	NA	NA	NA
WP_049145901.1|889442_890174_+	anchored repeat-type ABC transporter ATP-binding subunit	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	2.6e-16
WP_049151716.1|890170_891136_+	anchored repeat-type ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_100622059.1|891132_891924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622060.1|891908_892535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080986238.1|892582_893182_-	esterase	NA	NA	NA	NA	NA
WP_100622061.1|893401_894505_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_172953417.1|894532_895156_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_172453484.1|895175_895985_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_100622063.1|896111_896756_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_100622064.1|896756_898610_-	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_100622065.1|898631_899648_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_049151720.1|899768_901355_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	31.8	5.5e-35
WP_046645906.1|901420_902383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049062908.1|902324_904118_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_100622066.1|905858_907084_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.0	2.7e-66
WP_100622067.1|907811_909028_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.1	3.0e-33
WP_157800423.1|909069_910008_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100622069.1|909968_910277_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080974115.1|910880_912434_-	hypothetical protein	NA	M9MUE0	Rhodococcus_phage	32.5	3.6e-15
WP_100622070.1|912670_912850_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100619247.1|912896_914121_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_157800448.1|914292_915048_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.7	7.2e-17
915141:915200	attL	GAAGTCACCGCGTGGCAGACCAGGCAACTCGACGAGTTCTATCCAGTCATCTTCCTTGAT	NA	NA	NA	NA
WP_100622073.1|915391_916162_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	K4I413	Acidithiobacillus_phage	33.0	2.0e-22
WP_100622074.1|918351_918978_-	DUF2335 domain-containing protein	NA	A0A0D4DCC1	Staphylococcus_phage	29.8	8.9e-05
917429:917523	attR	GAAGTCACCGCGTGGCAGACCAGGCAACTCGACGAGTTCTATCCAGTCATCTTCCTTGATGCCCTACGTGTAAAAATCCGTGACAACGGACGCGT	NA	NA	NA	NA
WP_049146452.1|919575_920589_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_049063709.1|920678_921194_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_100622075.1|921199_923047_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.4	5.0e-64
WP_049160181.1|923445_924009_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_100622076.1|924074_925928_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_172953418.1|925985_927272_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_049192183.1|927226_927559_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_157800424.1|927551_927914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622078.1|927943_929152_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_005532135.1|929389_930481_+	glutathione S-transferase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_100622079.1|930494_931355_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_049160196.1|931424_932093_+	amino acid transporter	NA	NA	NA	NA	NA
WP_049160198.1|932244_933519_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_046645567.1|933524_934955_-	membrane protein	NA	NA	NA	NA	NA
WP_100622080.1|935108_936161_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	40.2	9.2e-71
WP_005532125.1|936245_937751_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_034657607.1|937895_938927_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_100618628.1|938937_940356_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_049192175.1|940385_940709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622081.1|940853_941663_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_100622082.1|941668_943153_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_005532113.1|943152_943455_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_049160210.1|943653_944313_+	amino acid-binding ACT domain protein	NA	NA	NA	NA	NA
WP_100622083.1|944330_945092_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_049192171.1|945095_947138_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	38.7	1.1e-101
WP_049192170.1|947208_947880_+	3'-5' exonuclease	NA	I4AZL6	Saccharomonospora_phage	43.7	1.7e-38
WP_049146438.1|947918_948440_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168712981.1|948439_949450_+	serine hydrolase	NA	NA	NA	NA	NA
WP_100622084.1|949446_949758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049146434.1|950036_951074_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005532100.1|951074_951986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622085.1|951985_953071_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_049063737.1|953164_953986_+	fused MFS/spermidine synthase	NA	NA	NA	NA	NA
WP_053084992.1|953966_955049_-	glycoside hydrolase family 25 protein	NA	A0A141HSE6	Bacillus_phage	34.4	3.3e-15
>prophage 79
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	959997	961107	2993983		unidentified_phage(100.0%)	1	NA	NA
WP_005532092.1|959997_961107_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	32.9	3.6e-25
>prophage 80
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	964878	965694	2993983		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005532084.1|964878_965694_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	4.5e-09
>prophage 81
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	986134	988829	2993983		Pandoravirus(50.0%)	3	NA	NA
WP_049062702.1|986134_986803_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	33.3	1.3e-17
WP_100622090.1|986859_987750_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005532046.1|987752_988829_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	43.7	5.3e-05
>prophage 82
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1002243	1003839	2993983		Escherichia_phage(100.0%)	1	NA	NA
WP_100622095.1|1002243_1003839_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	45.0	2.5e-19
>prophage 83
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1024712	1025120	2993983		Bacillus_phage(100.0%)	1	NA	NA
WP_080986247.1|1024712_1025120_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	56.0	1.6e-23
>prophage 84
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1031019	1034061	2993983		Choristoneura_rosaceana_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_100622101.1|1031019_1034061_-	DEAD/DEAH box helicase	NA	S5NA49	Choristoneura_rosaceana_nucleopolyhedrovirus	28.8	3.0e-45
>prophage 85
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1037247	1039296	2993983		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_100622102.1|1037247_1039296_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	1.4e-59
>prophage 86
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1043652	1045206	2993983		Catovirus(100.0%)	1	NA	NA
WP_049146338.1|1043652_1045206_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	35.7	1.1e-75
>prophage 87
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1049064	1051040	2993983		Agrobacterium_phage(50.0%)	2	NA	NA
WP_049160265.1|1049064_1049472_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	A0A223W0V1	Agrobacterium_phage	33.3	3.4e-05
WP_034657589.1|1050002_1051040_+	DNA cytosine methyltransferase	NA	A0A0F7L3U1	uncultured_marine_virus	36.9	3.0e-21
>prophage 88
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1061954	1063649	2993983		Helicoverpa_zea_nudivirus(100.0%)	1	NA	NA
WP_049151775.1|1061954_1063649_-	carboxylesterase/lipase family protein	NA	G9I033	Helicoverpa_zea_nudivirus	38.8	1.7e-10
>prophage 89
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1073632	1074850	2993983		Sphingomonas_phage(100.0%)	1	NA	NA
WP_049160586.1|1073632_1074850_-	glucose-1-phosphate adenylyltransferase	NA	H9NC64	Sphingomonas_phage	26.7	9.8e-08
>prophage 90
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1080732	1081497	2993983		Synechococcus_phage(100.0%)	1	NA	NA
WP_005531895.1|1080732_1081497_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	35.8	1.4e-20
>prophage 91
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1102395	1104180	2993983		Tupanvirus(100.0%)	1	NA	NA
WP_049062645.1|1102395_1104180_-	selenocysteine-specific translation elongation factor	NA	A0A2K9L516	Tupanvirus	27.7	2.2e-16
>prophage 92
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1131542	1132784	2993983		Gordonia_phage(100.0%)	1	NA	NA
WP_034657173.1|1131542_1132784_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	42.0	3.8e-76
>prophage 93
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1139889	1142638	2993983		Yellowstone_lake_phycodnavirus(50.0%)	3	NA	NA
WP_005529947.1|1139889_1140423_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	7.5e-13
WP_049063205.1|1140588_1141158_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_049063204.1|1141279_1142638_-	PhoH family protein	NA	E5EQR8	Micromonas_sp._RCC1109_virus	32.7	3.2e-23
>prophage 94
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1145731	1151189	2993983		Pandoravirus(33.33%)	4	NA	NA
WP_100622118.1|1145731_1147669_-	chorismate-binding protein	NA	A0A0B5J984	Pandoravirus	34.6	1.6e-89
WP_049063199.1|1147706_1149008_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	50.8	1.1e-89
WP_049063198.1|1149155_1150082_+	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_049192394.1|1150418_1151189_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.9	2.3e-18
>prophage 95
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1160930	1162208	2993983		Streptococcus_phage(100.0%)	1	NA	NA
WP_005529983.1|1160930_1162208_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.7	2.0e-136
>prophage 96
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1169316	1170342	2993983		Tupanvirus(100.0%)	1	NA	NA
WP_005530002.1|1169316_1170342_-	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.4	3.4e-30
>prophage 97
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1180361	1182797	2993983		Tupanvirus(100.0%)	2	NA	NA
WP_049159668.1|1180361_1181807_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	38.7	7.2e-34
WP_049062750.1|1181822_1182797_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.5	5.0e-47
>prophage 98
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1191003	1192647	2993983		Tupanvirus(100.0%)	1	NA	NA
WP_049147572.1|1191003_1192647_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	39.3	9.1e-17
>prophage 99
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1200195	1201293	2993983		Tupanvirus(100.0%)	1	NA	NA
WP_050765427.1|1200195_1201293_+	acetoin utilization protein AcuC	NA	A0A2K9L4C2	Tupanvirus	33.2	8.5e-19
>prophage 100
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1206080	1207826	2993983		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005530065.1|1206080_1207826_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.2	2.0e-54
>prophage 101
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1224051	1230855	2993983		Gordonia_phage(50.0%)	5	NA	NA
WP_100622447.1|1224051_1226961_+	acyltransferase family protein	NA	A0A166XZF2	Gordonia_phage	30.6	4.5e-35
WP_157800428.1|1227084_1227786_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_034657186.1|1227869_1228196_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005530100.1|1228317_1228869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070508540.1|1228995_1230855_-	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	28.5	6.7e-40
>prophage 102
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1234249	1235398	2993983		Rhodococcus_phage(100.0%)	1	NA	NA
WP_049159282.1|1234249_1235398_-	resuscitation-promoting factor	NA	A0A2D0ZMX2	Rhodococcus_phage	59.4	3.0e-22
>prophage 103
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1238640	1242453	2993983	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_049166672.1|1238640_1240473_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	28.6	6.1e-62
WP_034657232.1|1240632_1242453_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	4.4e-20
>prophage 104
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1250909	1251836	2993983		Bacillus_phage(100.0%)	1	NA	NA
WP_046646361.1|1250909_1251836_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.2	1.4e-46
>prophage 105
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1255042	1258942	2993983		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_046646356.1|1255042_1256560_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.0	2.5e-21
WP_049166678.1|1258243_1258942_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.7	1.4e-35
>prophage 106
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1264565	1265906	2993983		Pandoravirus(100.0%)	1	NA	NA
WP_157800429.1|1264565_1265906_-	protein kinase	NA	A0A0B5J6A8	Pandoravirus	30.6	2.0e-06
>prophage 107
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1269336	1276197	2993983		Prochlorococcus_phage(50.0%)	6	NA	NA
WP_046646339.1|1269336_1270875_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	42.8	7.2e-56
WP_005530186.1|1270902_1271532_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	33.2	3.5e-17
WP_070508890.1|1271542_1273285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034657240.1|1273754_1274525_+	M23 family metallopeptidase	NA	G8I8L5	Mycobacterium_phage	54.2	2.8e-24
WP_049152318.1|1274935_1275490_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049147539.1|1275492_1276197_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.9e-32
>prophage 108
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1279228	1282621	2993983		Corynebacterium_phage(50.0%)	2	NA	NA
WP_005530200.1|1279228_1279993_+	M23 family metallopeptidase	NA	A0A1W6JQH9	Corynebacterium_phage	54.9	2.7e-27
WP_005530201.1|1280011_1282621_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	38.5	4.7e-124
>prophage 109
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1305336	1310491	2993983		Gordonia_phage(33.33%)	6	NA	NA
WP_049062782.1|1305336_1306134_+	thymidylate synthase	NA	A0A1B3AY68	Gordonia_phage	68.7	2.7e-107
WP_049062781.1|1306133_1306676_+	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	35.9	2.1e-18
WP_005530251.1|1306676_1306964_+	glutaredoxin	NA	NA	NA	NA	NA
WP_049062779.1|1306999_1307284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049152343.1|1307838_1308045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034657208.1|1309510_1310491_+	DUF1906 domain-containing protein	NA	A0A2P1JXS5	Rhodococcus_phage	37.7	5.1e-31
>prophage 110
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1321269	1330625	2993983		Moraxella_phage(25.0%)	9	NA	NA
WP_049166682.1|1321269_1322673_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	26.8	3.6e-30
WP_049159480.1|1322767_1323376_-	DUF3027 domain-containing protein	NA	NA	NA	NA	NA
WP_053085482.1|1323456_1324326_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_005530279.1|1324337_1324955_+	DUF2771 domain-containing protein	NA	NA	NA	NA	NA
WP_005530281.1|1325078_1325459_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	41.3	3.4e-07
WP_049159477.1|1325834_1326458_+	DUF3235 domain-containing protein	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	53.4	4.8e-27
WP_005530285.1|1326581_1326767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049159474.1|1326833_1328933_+	helicase-associated domain-containing protein	NA	NA	NA	NA	NA
WP_049147500.1|1328993_1330625_+	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	25.6	1.8e-17
>prophage 111
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1335421	1336638	2993983	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_100622151.1|1335421_1336638_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.1	5.2e-33
>prophage 112
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1342842	1345632	2993983		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_049062485.1|1342842_1343598_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	6.1e-16
WP_049062486.1|1343594_1344638_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_049062487.1|1344627_1345632_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	35.2	1.7e-58
>prophage 113
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1355375	1357493	2993983		Staphylococcus_phage(50.0%)	3	NA	NA
WP_100622154.1|1355375_1355876_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	50.0	1.0e-35
WP_049062494.1|1355900_1356803_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005528255.1|1356803_1357493_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.7	3.0e-30
>prophage 114
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1364809	1371895	2993983	transposase,integrase	Bacillus_phage(50.0%)	6	1366053:1366068	1368070:1368085
WP_100622156.1|1364809_1365739_+	hypothetical protein	NA	Q6NE04	Leptospira_phage	32.4	2.0e-24
WP_005528239.1|1365764_1366229_-	hypothetical protein	NA	NA	NA	NA	NA
1366053:1366068	attL	TCCCGTTTCGATTCCG	NA	NA	NA	NA
WP_080548592.1|1366591_1366960_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	43.0	2.8e-19
WP_005528233.1|1367283_1367496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005528232.1|1367546_1369283_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.2	2.6e-22
1368070:1368085	attR	TCCCGTTTCGATTCCG	NA	NA	NA	NA
WP_100622157.1|1369282_1371895_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.4	1.9e-32
>prophage 115
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1382201	1389426	2993983		Clostridium_botulinum_C_phage(50.0%)	4	NA	NA
WP_049062976.1|1382201_1384256_-	ATP-dependent DNA helicase UvrD2	NA	Q331U3	Clostridium_botulinum_C_phage	25.7	1.1e-40
WP_049192722.1|1384248_1384968_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_100622449.1|1384967_1386029_-	NAD-binding protein	NA	NA	NA	NA	NA
WP_049192719.1|1386216_1389426_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	24.7	4.4e-15
>prophage 116
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1394822	1399877	2993983		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	6	NA	NA
WP_049151885.1|1394822_1396151_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.2e-46
WP_049151886.1|1396147_1397386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005528183.1|1397400_1397877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005528182.1|1398449_1398710_+	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	45.7	3.4e-11
WP_005528181.1|1398993_1399266_-	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_005528180.1|1399265_1399877_-	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.8	5.4e-07
>prophage 117
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1411642	1414104	2993983		Bacillus_phage(100.0%)	2	NA	NA
WP_005528166.1|1411642_1413316_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.0	4.8e-21
WP_005528165.1|1413408_1414104_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	3.8e-41
>prophage 118
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1428939	1430789	2993983		Mycobacterium_phage(50.0%)	2	NA	NA
WP_005528147.1|1428939_1429188_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	74.3	5.6e-27
WP_005528146.1|1429694_1430789_-	NDP-sugar synthase	NA	I7I009	Enterobacteria_phage	27.5	2.9e-19
>prophage 119
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1455084	1456164	2993983		Bacillus_virus(100.0%)	1	NA	NA
WP_049158651.1|1455084_1456164_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	33.9	2.5e-23
>prophage 120
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1460875	1461904	2993983		Klosneuvirus(100.0%)	1	NA	NA
WP_005528121.1|1460875_1461904_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	46.0	5.6e-81
>prophage 121
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1482832	1487602	2993983		Lactococcus_phage(50.0%)	2	NA	NA
WP_049192335.1|1482832_1484104_-	Fic family protein	NA	Q9AZ49	Lactococcus_phage	31.7	1.5e-38
WP_049192333.1|1484245_1487602_-	exonuclease	NA	A0A0A7RWA3	Clostridium_phage	29.2	3.4e-10
>prophage 122
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1536390	1536891	2993983		Tetraselmis_virus(100.0%)	1	NA	NA
WP_049064124.1|1536390_1536891_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.1	8.3e-22
>prophage 123
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1541132	1542125	2993983		Planktothrix_phage(100.0%)	1	NA	NA
WP_049064132.1|1541132_1542125_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.3	3.0e-23
>prophage 124
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1565396	1566083	2993983		Planktothrix_phage(100.0%)	1	NA	NA
WP_049151958.1|1565396_1566083_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	1.3e-28
>prophage 125
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1573867	1574695	2993983		Leuconostoc_phage(100.0%)	1	NA	NA
WP_100622181.1|1573867_1574695_+	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	66.7	3.1e-13
>prophage 126
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1579039	1579948	2993983		Streptomyces_phage(100.0%)	1	NA	NA
WP_049064159.1|1579039_1579948_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	48.4	2.3e-17
>prophage 127
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1594122	1594923	2993983		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_046646557.1|1594122_1594923_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.8	5.6e-12
>prophage 128
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1599189	1599804	2993983		Planktothrix_phage(100.0%)	1	NA	NA
WP_049192264.1|1599189_1599804_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.0	6.0e-22
>prophage 129
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1619561	1620890	2993983		Orpheovirus(100.0%)	1	NA	NA
WP_005527941.1|1619561_1620890_+	O-acetylhomoserine/O-acetylserine sulfhydrylase	NA	A0A2I2L687	Orpheovirus	26.9	2.6e-06
>prophage 130
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1630169	1635462	2993983		Streptomyces_phage(50.0%)	3	NA	NA
WP_100622192.1|1630169_1633316_-	error-prone DNA polymerase	NA	R4TMT6	Streptomyces_phage	29.1	8.5e-96
WP_049062855.1|1633449_1634334_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172454606.1|1634394_1635462_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.1	3.1e-34
>prophage 131
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1644984	1645656	2993983		Planktothrix_phage(100.0%)	1	NA	NA
WP_049151988.1|1644984_1645656_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.6	9.8e-34
>prophage 132
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1655017	1665898	2993983	tRNA,transposase,integrase	uncultured_virus(40.0%)	10	NA	NA
WP_005527889.1|1655017_1656538_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	1.1e-88
WP_034656536.1|1656699_1657071_+	DUF5319 domain-containing protein	NA	NA	NA	NA	NA
WP_049192356.1|1657129_1657921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005527881.1|1657969_1658533_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_034656535.1|1658901_1659201_+	WhiB family transcriptional regulator	NA	A0A0F6WF99	Mycobacterium_phage	35.1	1.0e-06
WP_005527873.1|1660315_1661932_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	50.1	1.7e-140
WP_034656533.1|1661954_1662251_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	55.9	3.0e-19
WP_005527869.1|1662506_1662935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046646292.1|1663195_1664695_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_046646768.1|1664842_1665898_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	5.6e-52
>prophage 133
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1670887	1672759	2993983		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_100622197.1|1670887_1672759_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	34.9	3.4e-92
>prophage 134
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1681046	1731792	2993983	tRNA,transposase,integrase	Bacillus_phage(33.33%)	49	1721654:1721675	1734436:1734457
WP_100622457.1|1681046_1684760_-	type VII secretion protein EccCa	NA	A0A0A0RUH6	Bacillus_phage	31.6	1.3e-18
WP_065422275.1|1685065_1686457_+	type VII secretion integral membrane protein EccD	NA	NA	NA	NA	NA
WP_083287716.1|1686465_1687689_+	S8 family serine peptidase	NA	V5UPA7	Mycobacterium_phage	29.4	9.8e-24
WP_005527825.1|1687660_1688107_-	TIGR02611 family protein	NA	NA	NA	NA	NA
WP_100622199.1|1688163_1689438_-	type VII secretion protein EccB	NA	NA	NA	NA	NA
WP_100622200.1|1689573_1690431_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_070508862.1|1690446_1691280_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_005527818.1|1691382_1691904_-	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_005527816.1|1691979_1692990_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_005527812.1|1693104_1693710_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_034656521.1|1693731_1694136_-	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_034656519.1|1694139_1694508_-	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_004566852.1|1694690_1694909_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_046646784.1|1695163_1695967_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_034656515.1|1696091_1696886_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_005527795.1|1696891_1697437_-	adenylate kinase	NA	A0A2K9L833	Tupanvirus	33.9	2.2e-15
WP_100622201.1|1697436_1698762_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_005527791.1|1699038_1699488_-	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_005527789.1|1699491_1699677_-	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_100622202.1|1699680_1700307_-	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_005527786.1|1700347_1700749_-	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_005527784.1|1700752_1701289_-	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_005527782.1|1701303_1701687_-	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_005527780.1|1702122_1702368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049064359.1|1702367_1703201_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_100619568.1|1704421_1705132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622203.1|1705344_1708755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172953427.1|1708925_1710467_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_100622205.1|1710601_1710994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005527721.1|1710990_1711776_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_049062236.1|1712394_1713021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005527723.1|1713129_1713681_-	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_005527724.1|1713683_1713998_-	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_005527725.1|1714002_1714371_-	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_049062235.1|1714902_1715793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622206.1|1716056_1718051_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_049152222.1|1718212_1719538_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_100622458.1|1719559_1720468_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_100622207.1|1720468_1720888_+	multidrug transporter	NA	NA	NA	NA	NA
WP_129721161.1|1720967_1721525_-	hypothetical protein	NA	NA	NA	NA	NA
1721654:1721675	attL	AACCCGCATTCGAACCATCGAA	NA	NA	NA	NA
WP_172953428.1|1721933_1722251_+|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	44.4	8.4e-12
WP_100619317.1|1722247_1723168_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	45.7	3.4e-61
WP_049064008.1|1723218_1723503_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049064011.1|1723885_1724506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100619316.1|1724938_1725214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129721195.1|1727806_1727965_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100622210.1|1730663_1730882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622211.1|1730894_1731470_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	31.8	3.1e-12
WP_157800430.1|1731414_1731792_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1734436:1734457	attR	TTCGATGGTTCGAATGCGGGTT	NA	NA	NA	NA
>prophage 135
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1744268	1755052	2993983		Hokovirus(25.0%)	9	NA	NA
WP_005527719.1|1744268_1745459_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.6	4.3e-32
WP_034656509.1|1745857_1747987_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.1	4.6e-61
WP_042529270.1|1748260_1748728_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_046646811.1|1748734_1749106_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_100622215.1|1749777_1751571_+	ribonucleoside triphosphate reductase	NA	D9ZNH0	Clostridium_phage	44.3	3.7e-144
WP_049063300.1|1751584_1752268_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_049063295.1|1752248_1752800_-	aminodeoxychorismate synthase	NA	NA	NA	NA	NA
WP_049063302.1|1752819_1753542_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_162837381.1|1753627_1755052_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.3	1.3e-19
>prophage 136
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1765718	1776877	2993983		Vibrio_phage(33.33%)	6	NA	NA
WP_049064198.1|1765718_1769711_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.7	6.0e-54
WP_046646310.1|1769840_1773335_-	DNA-directed RNA polymerase subunit beta	NA	Q5YFJ2	Singapore_grouper_iridovirus	21.7	1.5e-37
WP_049064200.1|1773567_1774521_-	DUF3068 domain-containing protein	NA	NA	NA	NA	NA
WP_034656606.1|1774655_1775042_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005527697.1|1775118_1775640_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_053088623.1|1775935_1776877_+	deoxyribodipyrimidine photo-lyase	NA	A0A141ZMJ4	Faustovirus	27.0	3.4e-08
>prophage 137
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1781484	1782075	2993983		Mycobacterium_phage(100.0%)	1	NA	NA
WP_100619564.1|1781484_1782075_+	ParA family protein	NA	A0A0F6SJH0	Mycobacterium_phage	37.1	8.6e-26
>prophage 138
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1810810	1813237	2993983		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_049151529.1|1810810_1813237_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.1	1.9e-132
>prophage 139
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1818930	1819617	2993983		Planktothrix_phage(100.0%)	1	NA	NA
WP_049151533.1|1818930_1819617_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	4.2e-16
>prophage 140
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1850954	1865270	2993983		Staphylococcus_phage(50.0%)	11	NA	NA
WP_005527600.1|1850954_1851746_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.0	2.5e-28
WP_100622225.1|1851887_1852787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083287695.1|1852796_1853726_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_100622226.1|1853759_1854659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622227.1|1854655_1855354_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	1.1e-40
WP_070508657.1|1855350_1856613_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.9	3.8e-31
WP_100622459.1|1856700_1857447_-	phosphoglyceromutase	NA	NA	NA	NA	NA
WP_070508655.1|1857592_1858858_-	D-inositol-3-phosphate glycosyltransferase	NA	NA	NA	NA	NA
WP_070508650.1|1858938_1860657_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.8	4.7e-32
WP_100622228.1|1861482_1863216_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.3	8.4e-29
WP_100622229.1|1863455_1865270_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	1.5e-31
>prophage 141
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1880490	1884452	2993983	transposase	Bacillus_phage(33.33%)	3	NA	NA
WP_100622234.1|1880490_1881683_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.0	1.7e-25
WP_165482947.1|1881876_1883154_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.4	5.6e-14
WP_100622235.1|1883291_1884452_-	RtcB family protein	NA	A0A2P1JZ46	Mycobacterium_phage	66.1	1.3e-134
>prophage 142
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1887921	1891176	2993983		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_172953429.1|1887921_1891176_+	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	33.3	2.8e-49
>prophage 143
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1908096	1909509	2993983		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_005531189.1|1908096_1909509_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	5.6e-47
>prophage 144
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1914437	1922194	2993983		Enterobacteria_phage(25.0%)	7	NA	NA
WP_049062452.1|1914437_1915445_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.1	6.3e-69
WP_049062453.1|1915454_1916798_+	sugar nucleotide-binding protein	NA	A0A1D8EQE2	Escherichia_phage	37.3	4.7e-27
WP_005531200.1|1916808_1917675_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	H9NC64	Sphingomonas_phage	60.6	1.2e-92
WP_049062454.1|1917675_1918296_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005531205.1|1918327_1919443_-	S-(hydroxymethyl)mycothiol dehydrogenase	NA	NA	NA	NA	NA
WP_049062455.1|1919502_1920315_-	hydrolase	NA	NA	NA	NA	NA
WP_049160335.1|1920550_1922194_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	20.8	2.4e-17
>prophage 145
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	1927070	2023985	2993983	protease,integrase,transposase,holin	Burkholderia_virus(15.62%)	91	1961672:1961731	1987287:1988591
WP_157800432.1|1927070_1927331_-|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	44.1	3.4e-11
WP_080974852.1|1927610_1927994_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080974853.1|1928112_1928307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080969933.1|1928638_1929877_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	24.5	1.4e-06
WP_049062458.1|1929875_1931408_+	HAMP domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.8	1.1e-19
WP_049159029.1|1931501_1932737_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_100619268.1|1932684_1933344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622241.1|1933346_1936289_-	type I DNA topoisomerase	NA	A0A0G2Y4W4	Acanthamoeba_polyphaga_mimivirus	33.9	4.7e-96
WP_046645834.1|1936568_1937198_+	DedA family protein	NA	NA	NA	NA	NA
WP_005531231.1|1937233_1937437_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.5	4.7e-16
WP_172953430.1|1937593_1939990_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	26.9	9.6e-07
WP_005531234.1|1939986_1940310_-	flp pilus-assembly TadE/G-like family protein	NA	NA	NA	NA	NA
WP_005531236.1|1940306_1940624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005531238.1|1940627_1940819_-	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_049062462.1|1940885_1941416_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_100622243.1|1941412_1942186_-	type II secretion protein F	NA	NA	NA	NA	NA
WP_049062464.1|1942182_1943328_-	TadA family conjugal transfer-associated ATPase	NA	NA	NA	NA	NA
WP_049062465.1|1943324_1944350_-	septum formation initiator	NA	NA	NA	NA	NA
WP_049062466.1|1944781_1945669_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_049062467.1|1945665_1946379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005531246.1|1946488_1946983_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_049062468.1|1947126_1948062_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_100622244.1|1948297_1949896_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_049151271.1|1950152_1951727_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005531255.1|1952122_1953049_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005531257.1|1953041_1954001_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_049063215.1|1954000_1955701_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.3e-18
WP_157800433.1|1955902_1956181_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	41.9	1.1e-07
WP_049062347.1|1956241_1957009_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_100622245.1|1957015_1958638_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_100619261.1|1958735_1959065_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N7C1X7	Escherichia_phage	59.7	2.3e-12
WP_049147778.1|1959520_1959832_-|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	43.0	2.0e-10
WP_005391230.1|1960303_1960582_+	hypothetical protein	NA	NA	NA	NA	NA
1961672:1961731	attL	GGACCTGACCCCTGTTTGGTAGACACCTGATATCCAGCCCGGTTGGGTTGGGAAGAAAGG	NA	NA	NA	NA
WP_100622246.1|1961743_1962935_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.7	8.6e-25
WP_157800435.1|1964757_1966806_-	GcrY protein	NA	Q6NE04	Leptospira_phage	39.2	1.4e-128
WP_172953431.1|1966799_1968033_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	47.4	1.2e-58
WP_049151672.1|1968500_1970282_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_049147775.1|1970395_1971226_-	serine hydrolase	NA	NA	NA	NA	NA
WP_012360809.1|1971222_1972083_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172953431.1|1972173_1973407_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	47.4	1.2e-58
WP_046095295.1|1974436_1974700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011116976.1|1974840_1975434_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	56.6	1.7e-29
WP_168713080.1|1975433_1975691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622248.1|1975844_1976774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622246.1|1976680_1977873_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.7	8.6e-25
WP_100619247.1|1978442_1979668_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_034964029.1|1980287_1981205_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	6.4e-28
WP_100619287.1|1981201_1981831_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_046646292.1|1982363_1983863_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157800436.1|1984042_1985233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034964032.1|1985229_1985901_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_100622246.1|1986081_1987274_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.7	8.6e-25
WP_157800437.1|1987820_1988006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011116986.1|1988028_1988532_+	GcrE	NA	NA	NA	NA	NA
WP_011116985.1|1988609_1988867_+	hypothetical protein	NA	NA	NA	NA	NA
1987287:1988591	attR	CCTTTCTTCCCAACCCAACCGGGCTGGATATCAGGTGTCTACCAAACAGGGGTCAGGTCCCAACTCCCGTGGAAAACAACCCCCAACACCACCGTGAAAGACCAGCCACACAGCCACACGCCGCAACCAGTGTCCGTTTCGGCAGATACGCTTTCATCTCCGCCTTCGGCAGCTTAACCCGCCTGTGGCTACGGTCAAGAACTTTCGCGGCATAAACCGCTCCCGCGCGCCCCGAATCCGGGGCGCTTTTCGCTATTTATTCCACGCTTTCTTGACCTCCACCACAGGCGGGCGCAGGCACTACGTGCCGGAGATGAAAGCAAGAAAAATGCACGCCCACACCCCAGACCGACACCACCGGCACCAGTAAAACTACAGGTGGCGGCCACAAACCCCGAACATATACTAAAGCATATGGCCTAACATATGTCTTGCCATATGTTAAAACATATGTTAAACTAGAGGCATACCGTGACGGAAGGCAACACTCGACCAGAAAGGAGCAGACATGCTCACCATCTACACCAAACCCGGATGCCACCCCTGCCGACTGACCATCAAAACCGCCAACAAACTCGGCCTCAACTACCAAGAAAACCCGCCAAAGAACACACCGGCTACCTCGCCACCCTCGGCCACGCCAGCGCCCCCGTCATCGTCGACGAAGCCGGCAACAGCTTCTCCGGCTTCCGCCCCGACAAACTACGCCAAGCCGCATAACCCACAAAGCAAGGAGCGCCCCATGGCCCAGGACACTGCCGAGACCATCAGCGCCACCATCACCGTCACCAACTCCGAAGCCTGCCTCATCTCCGCCATGCTCACCAGCGGCGACAAAGACACCATCGCCACCATCACCGACAAACTCGACCCCGCAGACTTCGCCAACACCCTACTGGCGAGAATCTTTGCCACCCTACAAGAACTCGTCAACGACAGCCGCCCCACCGACGCCTCCACCGTCCTCAACACCCTCCAAGCCAAAGGCAACCGCGACGGACTCGCCGACGACCAACACCACATCATGACAGAACTGGTCACCCTCAAAATCGTCGACCTCCACCTCGCCGACTACGCCCGCCAAGTAGCCAGCACCAGCTACCGCCGCCAATACCTCCACATGACCGAACAACTCCGCCACGCCGCCGAACACGCCCCCGAAGCCGAACTACTCGACATCATGATCAACCACGGCATAGGCCAACGCAAAGCCTGGCAACGCTACCAAGACATCACCACACTCTAAGCCCAGCAGGGTGTGCACACCCCGCCGATACGATCAAAAGCGTCCTCGAAGTTTCAACC	NA	NA	NA	NA
WP_070624365.1|1989057_1989408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070624364.1|1989431_1989683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172953432.1|1989963_1990290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622251.1|1990354_1991570_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.5	1.8e-33
WP_011113070.1|1991732_1991786_+	chloramphenicol resistance leader peptide	NA	NA	NA	NA	NA
WP_011113071.1|1991807_1992983_+	chloramphenicol efflux MFS transporter Cmx	NA	NA	NA	NA	NA
WP_100622252.1|1993186_1994023_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_001082319.1|1994022_1994826_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001067855.1|1995265_1995970_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|1996126_1996942_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|1997092_1997797_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011116984.1|1998275_2001161_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	3.2e-190
WP_005396288.1|2002087_2002933_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005390935.1|2002985_2004056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005390938.1|2004067_2005147_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_005390939.1|2005143_2005500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005390941.1|2005510_2006044_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_005390943.1|2006065_2007871_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.3	5.2e-05
WP_034989673.1|2007871_2009413_-	tetracycline efflux ABC transporter TetAB subunit A	NA	W8CYL7	Bacillus_phage	20.2	7.3e-08
WP_071569110.1|2009510_2009576_+	erythromycin resistance leader peptide	NA	NA	NA	NA	NA
WP_005390949.1|2009675_2010530_+	23S ribosomal RNA methyltransferase Erm	NA	E4ZFQ0	Streptococcus_phage	27.6	9.3e-13
WP_046095284.1|2011329_2011776_+	aminoglycoside N-acetyltransferase AAC(3)-XI	NA	NA	NA	NA	NA
WP_070508610.1|2011772_2012804_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_049147420.1|2012800_2013475_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_049147422.1|2013552_2014392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100619253.1|2014372_2015224_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_157800449.1|2015386_2016460_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011116990.1|2016761_2017388_+	ParA family protein	NA	NA	NA	NA	NA
WP_011116989.1|2017411_2017840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049159966.1|2017865_2018396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011116987.1|2018949_2019162_+	glutaredoxin family protein	NA	A0A088FRI1	Mycobacterium_phage	43.2	1.9e-07
WP_100619247.1|2019212_2020437_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_129721175.1|2020493_2021414_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	45.0	2.2e-60
WP_049151677.1|2021410_2021728_-|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	45.4	4.9e-12
WP_162837385.1|2022076_2022226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049160409.1|2022788_2023985_-|protease	MarP family serine protease	protease	NA	NA	NA	NA
>prophage 146
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2030376	2033865	2993983		Rhodococcus_phage(33.33%)	4	NA	NA
WP_049063698.1|2030376_2030757_-	hypothetical protein	NA	M9MU92	Rhodococcus_phage	33.6	2.4e-05
WP_049063700.1|2030756_2030966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049146471.1|2031146_2031767_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	58.3	1.6e-30
WP_049192566.1|2032305_2033865_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	50.5	3.8e-113
>prophage 147
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2046374	2049903	2993983		Tsukamurella_phage(50.0%)	3	NA	NA
WP_034657256.1|2046374_2046698_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	48.5	3.6e-10
WP_049064485.1|2046924_2049366_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_049159634.1|2049438_2049903_-	GatB/YqeY domain-containing protein	NA	A0A218KC79	Bacillus_phage	30.2	2.7e-06
>prophage 148
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2053186	2054734	2993983		Tupanvirus(100.0%)	1	NA	NA
WP_049064490.1|2053186_2054734_-	catalase	NA	A0A2K9L572	Tupanvirus	40.3	2.5e-85
>prophage 149
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2071962	2077962	2993983		Bacteriophage(50.0%)	4	NA	NA
WP_100622256.1|2071962_2074581_-	DNA polymerase III subunit gamma and tau	NA	A0A1L2BWV7	Bacteriophage	35.6	3.3e-45
WP_049145438.1|2074637_2075129_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_049151578.1|2075183_2076455_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_100622257.1|2077437_2077962_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	45.3	6.9e-11
>prophage 150
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2083087	2085079	2993983		Salmonella_virus(100.0%)	1	NA	NA
WP_100622258.1|2083087_2085079_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.1	3.8e-33
>prophage 151
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2107206	2111832	2993983	tRNA	uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_046645743.1|2107206_2108499_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	33.6	1.3e-58
WP_049063173.1|2108504_2110907_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_005530396.1|2111156_2111357_-	CsbD family protein	NA	NA	NA	NA	NA
WP_034657328.1|2111400_2111832_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	31.7	3.2e-06
>prophage 152
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2128083	2129130	2993983		Pacmanvirus(100.0%)	1	NA	NA
WP_049063180.1|2128083_2129130_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.0	6.0e-14
>prophage 153
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2136301	2137108	2993983		Staphylococcus_phage(100.0%)	1	NA	NA
WP_046645756.1|2136301_2137108_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.4e-09
>prophage 154
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2151917	2153858	2993983		Klosneuvirus(100.0%)	1	NA	NA
WP_049159428.1|2151917_2153858_-	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	32.4	1.6e-65
>prophage 156
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2222036	2225837	2993983	transposase	Acidithiobacillus_phage(50.0%)	3	NA	NA
WP_080969950.1|2222036_2222804_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	33.3	2.7e-27
WP_100622277.1|2222800_2224444_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_100622278.1|2224621_2225837_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.1	4.0e-33
>prophage 157
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2230064	2234665	2993983		Bacillus_phage(50.0%)	3	NA	NA
WP_049062950.1|2230064_2230787_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	9.8e-40
WP_049062949.1|2232052_2232379_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_049062947.1|2232430_2234665_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.1	6.3e-53
>prophage 158
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2245594	2248996	2993983		Moumouvirus(50.0%)	2	NA	NA
WP_049062936.1|2245594_2247037_+	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	27.4	1.6e-12
WP_049062935.1|2247040_2248996_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	M1HZT4	Acanthocystis_turfacea_Chlorella_virus	34.4	1.2e-18
>prophage 159
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2255165	2255696	2993983		Catovirus(100.0%)	1	NA	NA
WP_005530645.1|2255165_2255696_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.7	1.0e-22
>prophage 160
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2270668	2279694	2993983		Bacillus_phage(33.33%)	9	NA	NA
WP_049152009.1|2270668_2273239_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	28.4	6.5e-86
WP_005530675.1|2273316_2273529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005530678.1|2273525_2273795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005530680.1|2273864_2274305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005530682.1|2274325_2274532_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_005530684.1|2274630_2276685_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	42.4	6.3e-132
WP_049064461.1|2276820_2277342_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_100622281.1|2277334_2278513_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_005530690.1|2278512_2279694_-	DNA polymerase III subunit beta	NA	A0A286N319	Arthrobacter_phage	30.6	3.1e-43
>prophage 161
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2284927	2293174	2993983		Natrialba_phage(20.0%)	8	NA	NA
WP_049064451.1|2284927_2285776_+	ParA family protein	NA	Q8JL10	Natrialba_phage	34.5	1.5e-18
WP_100622283.1|2285782_2286796_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0YZX8	Pseudomonas_phage	26.1	1.4e-07
WP_005530708.1|2286795_2287371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005530710.1|2287400_2288582_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_049064447.1|2288643_2288973_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	36.5	5.9e-16
WP_005530714.1|2288979_2289906_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	47.7	1.7e-68
WP_005530716.1|2290048_2290603_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_100622284.1|2290684_2293174_-	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	33.0	3.4e-47
>prophage 162
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2299816	2301220	2993983	tRNA	Mycobacterium_phage(100.0%)	1	NA	NA
WP_049064439.1|2299816_2301220_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	36.7	1.5e-60
>prophage 163
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2313110	2314133	2993983		Acinetobacter_phage(100.0%)	1	NA	NA
WP_049063672.1|2313110_2314133_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.2	3.5e-43
>prophage 164
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2332968	2338003	2993983		Streptomyces_phage(50.0%)	4	NA	NA
WP_100622286.1|2332968_2334480_+	recombinase family protein	NA	A0A0K1Y9M7	Streptomyces_phage	29.9	1.9e-37
WP_046646499.1|2334985_2335270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049063650.1|2335275_2337282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049063648.1|2337268_2338003_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.0	1.8e-09
>prophage 165
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2342167	2420576	2993983	capsid,tRNA,portal,terminase,tail,protease,head,holin	Erysipelothrix_phage(45.45%)	69	NA	NA
WP_005325331.1|2342167_2343286_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.4	2.0e-15
WP_005325330.1|2343285_2344380_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005291888.1|2344376_2345213_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.7	6.9e-13
WP_005291889.1|2345223_2345844_-	DedA family protein	NA	NA	NA	NA	NA
WP_005291893.1|2346035_2347052_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005325328.1|2347117_2348062_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_005325324.1|2348121_2349126_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_100622288.1|2349128_2359985_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.4	1.6e-45
WP_011274124.1|2360085_2361504_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_005291901.1|2361583_2363332_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011274126.1|2363303_2365121_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011274127.1|2365121_2365349_-	MbtH family protein	NA	NA	NA	NA	NA
WP_100622289.1|2366097_2367990_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.5	4.6e-97
WP_005530797.1|2367986_2368346_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100622290.1|2368928_2369237_+	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	36.7	4.5e-10
WP_100622291.1|2369291_2369735_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_168712929.1|2369766_2370357_-	putative glycolipid-binding domain-containing protein	NA	NA	NA	NA	NA
WP_049063686.1|2371426_2372986_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_070508629.1|2372960_2373611_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_100622293.1|2373640_2376181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157800441.1|2376284_2377001_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049152051.1|2377004_2377574_+	Fic family protein	NA	NA	NA	NA	NA
WP_129721127.1|2377721_2377964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005530825.1|2378013_2378622_-	CueP family metal-binding protein	NA	NA	NA	NA	NA
WP_100622294.1|2379450_2381142_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_100622295.1|2381165_2382752_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	48.5	1.6e-127
WP_100622296.1|2382752_2384189_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	37.1	3.7e-54
WP_005295626.1|2384208_2384424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157800442.1|2384420_2384831_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_100622298.1|2385043_2385232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622299.1|2385315_2386158_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	63.2	4.0e-61
WP_100622300.1|2386157_2386625_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	56.3	2.0e-33
WP_100622301.1|2386717_2386915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013888243.1|2386907_2387369_-	DUF1617 family protein	NA	NA	NA	NA	NA
WP_100622302.1|2387384_2390300_-|tail	phage tail protein	tail	A0A2H4JFY7	uncultured_Caudovirales_phage	39.3	5.1e-71
WP_014320297.1|2390381_2391068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622303.1|2391067_2393755_-	tape measure protein	NA	A0A2K9V3J7	Faecalibacterium_phage	39.6	2.5e-40
WP_007000817.1|2393781_2393958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622304.1|2393975_2394386_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	55.1	3.1e-30
WP_005295596.1|2394398_2394995_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	70.1	1.9e-73
WP_007000815.1|2395013_2395358_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	39.8	2.0e-19
WP_100622305.1|2395354_2395792_-	hypothetical protein	NA	A0A2K5B292	Erysipelothrix_phage	44.3	4.1e-25
WP_100622306.1|2395760_2396123_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_100622307.1|2396126_2396441_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	60.0	5.8e-29
WP_100622308.1|2396473_2397694_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.2	7.8e-130
WP_100622309.1|2397715_2398543_-|protease	Clp protease ClpP	protease	E4ZFM4	Streptococcus_phage	60.2	4.1e-58
WP_014320306.1|2398539_2399844_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	70.5	5.3e-169
WP_041631002.1|2399873_2401472_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	75.3	4.6e-239
WP_100622310.1|2401581_2401872_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_014320308.1|2401905_2402193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622311.1|2402406_2403057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622312.1|2403053_2403239_-	cell division protein	NA	NA	NA	NA	NA
WP_100622313.1|2403386_2404637_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	56.9	3.1e-134
WP_100622314.1|2404608_2405790_-	methionine adenosyltransferase	NA	A0A2K5B278	Erysipelothrix_phage	57.4	1.1e-112
WP_100622315.1|2406660_2407890_+	MFS transporter	NA	NA	NA	NA	NA
WP_042406079.1|2407890_2408448_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	53.8	2.8e-50
WP_014320314.1|2408694_2409072_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	37.8	2.4e-13
WP_005295537.1|2409227_2409692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622316.1|2409688_2411050_-	DEAD/DEAH box helicase	NA	A0A1W6JQF1	Corynebacterium_phage	61.7	7.5e-158
WP_100622317.1|2411030_2411309_-	VRR-NUC domain-containing protein	NA	A0A1S7FZ22	Listeria_phage	47.8	1.4e-15
WP_100622318.1|2411445_2413710_-	primase C-terminal domain-containing protein	NA	A0A1B0RXC5	Streptococcus_phage	45.8	1.6e-184
WP_100622319.1|2413706_2414150_-	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	46.8	6.7e-31
WP_100622320.1|2414146_2414914_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JAT4	uncultured_Caudovirales_phage	43.3	1.7e-42
WP_038604199.1|2415156_2416092_+	Abi family protein	NA	NA	NA	NA	NA
WP_172953454.1|2416088_2418050_-	DNA polymerase	NA	A0A1W6JQ98	Corynebacterium_phage	56.0	6.9e-213
WP_038604201.1|2418049_2418577_-	HNH endonuclease	NA	B5U5I0	Mycobacterium_virus	52.2	2.1e-23
WP_051866687.1|2418656_2418842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038604205.1|2418862_2419417_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	63.3	1.0e-57
WP_100622322.1|2419442_2420576_-	DUF2800 domain-containing protein	NA	A0A1W6JQ97	Corynebacterium_phage	59.6	1.0e-120
>prophage 166
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2425416	2427452	2993983		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_083306656.1|2425416_2425674_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	47.1	2.3e-12
WP_100622323.1|2425670_2427452_+	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	22.3	2.2e-08
>prophage 167
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2435267	2440228	2993983		Acidithiobacillus_phage(50.0%)	3	NA	NA
WP_049146285.1|2435267_2435795_+	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	49.0	4.2e-16
WP_049146162.1|2435754_2436360_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_100622470.1|2436589_2440228_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.6	1.2e-16
>prophage 168
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2443601	2446457	2993983	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_100622326.1|2443601_2446457_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.7	4.2e-219
>prophage 169
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2464964	2473429	2993983		Burkholderia_virus(33.33%)	9	NA	NA
WP_100622333.1|2464964_2466290_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	9.2e-44
WP_157800444.1|2466371_2466983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049062552.1|2467261_2468230_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_049062537.1|2468327_2468927_+	VanZ family protein	NA	NA	NA	NA	NA
WP_049062538.1|2468934_2469933_-	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	42.0	7.4e-46
WP_005530896.1|2469933_2470551_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_049191832.1|2470543_2471668_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_034657317.1|2471819_2472815_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_049062539.1|2472814_2473429_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	5.6e-28
>prophage 170
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2486597	2519654	2993983	transposase	Shigella_phage(22.22%)	22	NA	NA
WP_005530931.1|2486597_2487173_+	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	51.6	1.1e-44
WP_005530934.1|2487220_2487673_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005530937.1|2488354_2489791_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	41.4	7.6e-84
WP_080970067.1|2489804_2490776_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_100622335.1|2491386_2492145_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_100622336.1|2492165_2493773_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	31.5	2.4e-54
WP_049152153.1|2495250_2495814_-	VanZ family protein	NA	NA	NA	NA	NA
WP_005532196.1|2495814_2497152_-	MFS transporter	NA	NA	NA	NA	NA
WP_049160155.1|2497194_2499429_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.5	1.3e-93
WP_049064039.1|2499480_2499684_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_049160143.1|2499815_2500190_+	thioredoxin	NA	F2WLG3	Lausannevirus	35.6	4.6e-09
WP_049160140.1|2500296_2501040_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_049064041.1|2501160_2502420_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_046646754.1|2502634_2503009_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100622475.1|2503094_2503907_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	1.5e-07
WP_100622337.1|2503903_2504905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100621937.1|2511748_2513371_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_100621936.1|2513377_2514034_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100619247.1|2514064_2515289_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_100621935.1|2517445_2518662_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.8	1.5e-32
WP_100621934.1|2518719_2519358_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.6	1.1e-13
WP_100618583.1|2519354_2519654_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 171
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2534063	2534666	2993983		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_100622340.1|2534063_2534666_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	48.3	7.9e-43
>prophage 172
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2547597	2548854	2993983	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_049151331.1|2547597_2548854_+|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	33.0	7.9e-61
>prophage 173
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2552870	2553611	2993983		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_005529455.1|2552870_2553611_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.3	6.1e-13
>prophage 174
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2558599	2559796	2993983		Streptococcus_phage(100.0%)	1	NA	NA
WP_049191700.1|2558599_2559796_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.7	4.7e-87
>prophage 175
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2565109	2574095	2993983		Oenococcus_phage(33.33%)	3	NA	NA
WP_049063249.1|2565109_2566441_-	ATP-binding protein	NA	V9QJ85	Oenococcus_phage	27.3	3.3e-09
WP_049063246.1|2568047_2571242_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.4	2.4e-53
WP_049063245.1|2572463_2574095_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	28.4	3.5e-45
>prophage 176
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2583005	2586224	2993983		Macacine_betaherpesvirus(100.0%)	2	NA	NA
WP_049151316.1|2583005_2584028_+	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	37.1	7.4e-41
WP_005529485.1|2584256_2586224_+	hypothetical protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	39.9	2.4e-40
>prophage 177
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2599610	2600836	2993983	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_100619247.1|2599610_2600836_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
>prophage 178
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2624249	2626031	2993983		Bacillus_phage(100.0%)	1	NA	NA
WP_100622352.1|2624249_2626031_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	8.9e-34
>prophage 179
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2632946	2637926	2993983		Bacillus_phage(50.0%)	5	NA	NA
WP_049062272.1|2632946_2633234_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.4	4.1e-05
WP_053087986.1|2633457_2633889_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100622354.1|2633966_2635754_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	2.2e-40
WP_005529683.1|2635976_2636540_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	73.1	9.2e-78
WP_080969936.1|2636582_2637926_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.0	2.0e-70
>prophage 180
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2648443	2649739	2993983		Hokovirus(100.0%)	1	NA	NA
WP_005529706.1|2648443_2649739_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	25.9	1.0e-26
>prophage 181
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2660159	2665215	2993983		Amsacta_moorei_entomopoxvirus(33.33%)	4	NA	NA
WP_034657089.1|2660159_2660957_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.3	8.4e-08
WP_049147158.1|2661185_2663030_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.0	8.4e-136
WP_005529727.1|2663029_2663788_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_049151382.1|2663985_2665215_+	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.4	5.4e-22
>prophage 182
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2668965	2681576	2993983		Paramecium_bursaria_Chlorella_virus(25.0%)	11	NA	NA
WP_049191972.1|2668965_2669775_+	carbon-nitrogen hydrolase family protein	NA	M1HHT1	Paramecium_bursaria_Chlorella_virus	29.4	4.8e-11
WP_049191970.1|2669790_2671038_-	2-polyprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_049191967.1|2671049_2672099_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100622356.1|2672312_2673131_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.7	6.6e-24
WP_049191962.1|2673127_2673772_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_100619047.1|2673768_2674446_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080972401.1|2674615_2675593_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_100622357.1|2676131_2678690_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.2	1.3e-126
WP_049151391.1|2678868_2679717_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_172953456.1|2680110_2680959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005529758.1|2681030_2681576_+	orotate phosphoribosyltransferase	NA	E3SNS3	Prochlorococcus_phage	39.4	1.1e-19
>prophage 183
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2688815	2690108	2993983		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_049147133.1|2688815_2690108_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	34.7	1.3e-66
>prophage 184
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2701504	2704009	2993983		Moloney_murine_sarcoma_virus(100.0%)	1	NA	NA
WP_100622365.1|2701504_2704009_-	serine/threonine protein kinase	NA	O36611	Moloney_murine_sarcoma_virus	28.3	8.2e-09
>prophage 185
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2707183	2710082	2993983		Staphylococcus_phage(50.0%)	3	NA	NA
WP_100622367.1|2707183_2708149_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	4.1e-33
WP_005529801.1|2708148_2708919_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_100622368.1|2708915_2710082_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	23.5	7.9e-23
>prophage 186
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2713607	2714508	2993983		Vibrio_phage(50.0%)	2	NA	NA
WP_005529811.1|2713607_2714228_-	peptide deformylase	NA	A0A2I7R224	Vibrio_phage	34.3	4.1e-10
WP_172453817.1|2714226_2714508_+	DUF3263 domain-containing protein	NA	A0A2D1GGE2	Gordonia_phage	44.1	2.5e-07
>prophage 187
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2728605	2730252	2993983		uncultured_virus(100.0%)	1	NA	NA
WP_049063843.1|2728605_2730252_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	1.7e-151
>prophage 188
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2733372	2749976	2993983	tRNA	Tupanvirus(28.57%)	15	NA	NA
WP_100622481.1|2733372_2737245_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	24.4	2.4e-39
WP_005529842.1|2737323_2737776_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_100622370.1|2737841_2738144_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_046646076.1|2738262_2738919_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080969944.1|2738928_2739633_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_049063850.1|2739743_2740445_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	7.6e-29
WP_049063851.1|2740441_2741851_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_049063853.1|2741817_2742666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034657157.1|2742845_2743319_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	46.1	7.1e-31
WP_049063856.1|2743402_2744677_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_049063858.1|2744666_2745632_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005529848.1|2745644_2746232_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.1	7.0e-12
WP_049063859.1|2746238_2748491_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G9E4U6	Ostreococcus_lucimarinus_virus	47.0	7.9e-112
WP_049063860.1|2748480_2749071_+	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	53.3	2.2e-45
WP_049063861.1|2749073_2749976_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.6	2.4e-19
>prophage 189
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2757237	2758815	2993983	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_034657100.1|2757237_2758815_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	32.0	1.5e-69
>prophage 190
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2762693	2765408	2993983	protease	Cronobacter_phage(100.0%)	1	NA	NA
WP_049151424.1|2762693_2765408_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.3	1.2e-133
>prophage 191
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2777278	2777980	2993983		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_005531291.1|2777278_2777980_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	7.9e-10
>prophage 192
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2787758	2793353	2993983		Bacillus_phage(66.67%)	4	NA	NA
WP_049063049.1|2787758_2789495_+	pyruvate dehydrogenase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	22.4	3.4e-14
WP_080969942.1|2789575_2790925_-	MFS transporter	NA	NA	NA	NA	NA
WP_049062732.1|2791132_2791837_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.0	5.8e-37
WP_100622482.1|2791994_2793353_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.9	1.1e-26
>prophage 193
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2796638	2797508	2993983		Mollivirus(100.0%)	1	NA	NA
WP_049192116.1|2796638_2797508_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	38.5	1.2e-44
>prophage 194
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2803734	2810727	2993983		Microbacterium_phage(50.0%)	3	NA	NA
WP_049192109.1|2803734_2807409_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.8	3.8e-31
WP_049160437.1|2807881_2808619_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_049192108.1|2808639_2810727_-	acyl-CoA dehydrogenase family protein	NA	A0A2K9L6M4	Tupanvirus	37.3	9.7e-56
>prophage 195
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2816002	2818575	2993983		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_049151445.1|2816002_2817502_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	28.7	4.7e-44
WP_005531349.1|2817522_2818575_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	38.7	4.1e-55
>prophage 196
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2828323	2829097	2993983		Bacillus_phage(100.0%)	1	NA	NA
WP_005531374.1|2828323_2829097_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.4	3.2e-12
>prophage 197
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2842461	2843397	2993983		Streptococcus_phage(100.0%)	1	NA	NA
WP_049064319.1|2842461_2843397_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	53.4	1.9e-83
>prophage 198
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2851932	2852670	2993983		Planktothrix_phage(100.0%)	1	NA	NA
WP_046645826.1|2851932_2852670_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	3.5e-32
>prophage 199
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2861715	2869878	2993983		Bacillus_virus(20.0%)	8	NA	NA
WP_100622389.1|2861715_2862561_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	49.8	1.0e-67
WP_100622390.1|2862559_2863939_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003847162.1|2864064_2864187_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005531104.1|2864696_2864936_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	57.1	5.9e-18
WP_005531103.1|2864962_2865394_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	34.1	5.7e-11
WP_100622391.1|2865525_2867688_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.5	2.5e-208
WP_100622392.1|2867793_2868510_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005531098.1|2868888_2869878_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	78.5	6.1e-141
>prophage 200
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2874235	2948439	2993983	protease,tRNA,transposase,integrase	Planktothrix_phage(15.38%)	65	2867257:2867274	2927048:2927065
2867257:2867274	attL	GACGTCGCCAAGCATGGC	NA	NA	NA	NA
WP_049063342.1|2874235_2876215_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.3	7.8e-63
WP_049152146.1|2876295_2877633_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	33.0	1.6e-51
WP_166683491.1|2877714_2878296_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_049192585.1|2878466_2878754_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_005531083.1|2878771_2879308_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_080972444.1|2879365_2880298_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_100619515.1|2880392_2881004_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_049152116.1|2881003_2881780_+	glutamate racemase	NA	NA	NA	NA	NA
WP_049063347.1|2881921_2882689_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_049192603.1|2882711_2883440_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_049152120.1|2883433_2884045_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.0	1.2e-06
WP_049063349.1|2884192_2884543_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_046645809.1|2884554_2885004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049192588.1|2885557_2886148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005531072.1|2886517_2888608_+	formate acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	6.1e-151
WP_005531071.1|2888667_2888919_+	autonomous glycyl radical cofactor GrcA	NA	A0A060AHY5	Cronobacter_phage	70.9	1.7e-15
WP_005531070.1|2888922_2889792_+	pyruvate formate lyase-activating protein	NA	A0A0A8WJI9	Clostridium_phage	33.1	1.4e-08
WP_005531068.1|2889861_2891106_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_049192590.1|2891279_2892401_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_049145138.1|2892486_2894160_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_100622393.1|2894238_2896143_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.3	5.8e-15
WP_049145133.1|2896139_2897246_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_100622483.1|2897246_2898206_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046646292.1|2898337_2899837_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_049063366.1|2900374_2901151_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_129721038.1|2901188_2901392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172953458.1|2901572_2910668_+	DUF1729 domain-containing protein	NA	NA	NA	NA	NA
WP_005531059.1|2910900_2911902_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_100622395.1|2911898_2912933_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_100622396.1|2912942_2913713_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.6	1.1e-12
WP_100622397.1|2913724_2914153_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_005531050.1|2914149_2914782_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034657419.1|2914817_2915288_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_005531048.1|2915459_2915738_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_100622484.1|2915765_2916320_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_049145973.1|2916355_2917633_+	glutaminase	NA	NA	NA	NA	NA
WP_034657386.1|2918112_2919336_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_049145971.1|2920245_2921838_-	phytoene desaturase	NA	NA	NA	NA	NA
WP_049192596.1|2921837_2922734_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_049145969.1|2922987_2923620_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.5e-28
WP_100622398.1|2923951_2925463_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_049159195.1|2925503_2926316_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_034657383.1|2926457_2926643_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_049063389.1|2926681_2927341_-	hypothetical protein	NA	NA	NA	NA	NA
2927048:2927065	attR	GCCATGCTTGGCGACGTC	NA	NA	NA	NA
WP_100622399.1|2927626_2928574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100622400.1|2928649_2930770_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_100622401.1|2930982_2931621_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_100622402.1|2931759_2933430_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	29.0	3.3e-46
WP_100622403.1|2933518_2933947_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_005531009.1|2934004_2934649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100622404.1|2934672_2935863_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_100622405.1|2936111_2936501_-	globin	NA	NA	NA	NA	NA
WP_100622406.1|2936506_2937553_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_049152151.1|2937734_2938886_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	30.1	2.2e-25
WP_157800446.1|2940358_2940508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131771746.1|2940512_2940716_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_141741072.1|2941573_2941825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080972435.1|2941929_2942235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100622407.1|2942349_2943600_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.2	7.1e-78
WP_100622408.1|2943839_2944295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005530995.1|2944403_2944577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080548648.1|2944821_2944989_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100087309.1|2944997_2945177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005530982.1|2946048_2946996_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_049145008.1|2947005_2948439_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	33.1	3.8e-43
>prophage 201
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2954209	2964176	2993983		Planktothrix_phage(33.33%)	9	NA	NA
WP_049063329.1|2954209_2955850_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	3.2e-22
WP_046645605.1|2955874_2957101_+	alkylhydroperoxidase domain protein	NA	NA	NA	NA	NA
WP_049063327.1|2957129_2957813_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005530963.1|2957892_2958669_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100622411.1|2958685_2961217_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	33.1	2.0e-47
WP_100622412.1|2961324_2961948_+	DsbA family protein	NA	NA	NA	NA	NA
WP_100622413.1|2961944_2962664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622414.1|2962784_2963258_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_100622485.1|2963342_2964176_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.7	1.8e-61
>prophage 202
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2969407	2986295	2993983	transposase,integrase	Burkholderia_virus(33.33%)	16	2969366:2969390	2982782:2982806
2969366:2969390	attL	GGAACTAAACCCAGGACGCTTCAGA	NA	NA	NA	NA
WP_100622416.1|2969407_2970082_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	34.9	2.0e-26
WP_100622417.1|2970180_2970537_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100622418.1|2970536_2970767_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100622419.1|2971546_2972762_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.1	5.2e-33
WP_100622420.1|2972759_2973008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100622421.1|2973014_2974625_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_157800447.1|2974722_2974863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046646865.1|2974991_2976764_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	8.1e-27
WP_049152016.1|2976756_2978505_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	2.7e-35
WP_049147404.1|2978512_2979982_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.0e-11
WP_049147405.1|2979978_2980704_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_049147407.1|2980700_2981336_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_080970030.1|2981611_2981920_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	36.0	4.7e-07
WP_100622422.1|2982110_2982845_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	34.9	3.7e-26
2982782:2982806	attR	TCTGAAGCGTCCTGGGTTTAGTTCC	NA	NA	NA	NA
WP_100619247.1|2982813_2984039_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	2.9e-68
WP_172953431.1|2985061_2986295_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	47.4	1.2e-58
>prophage 203
NZ_CP024931	Corynebacterium striatum strain 215 chromosome, complete genome	2993983	2990284	2993511	2993983		Mycobacterium_phage(50.0%)	2	NA	NA
WP_080970012.1|2990284_2991310_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	66.1	1.2e-118
WP_100619509.1|2991363_2993511_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.5	2.5e-192
