The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	1085478	1098661	4767526		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1085478_1086240_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1086233_1086860_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1086999_1088139_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1088201_1089194_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1089287_1090652_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1090740_1091517_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1091521_1092160_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1092156_1093419_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1093415_1094324_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1094519_1095287_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1095337_1095994_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1096099_1098661_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	1711535	1720977	4767526		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1711535_1712462_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1712466_1713198_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1713178_1713286_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1713345_1714077_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1714298_1715984_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1715980_1716700_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1716746_1717217_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1717257_1717719_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|1717843_1719844_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|1719840_1720977_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 3
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	2277616	2300183	4767526	tail,integrase	Escherichia_phage(26.67%)	26	2274828:2274841	2301443:2301456
2274828:2274841	attL	AAACATCTTCATCA	NA	NA	NA	NA
WP_000041556.1|2277616_2280043_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|2280241_2280547_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2280654_2281365_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2281367_2281928_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2281962_2282304_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2282438_2282765_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2282970_2284185_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2284196_2285216_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2285273_2285384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2285403_2286684_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2286718_2286955_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|2287042_2289514_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2289607_2289799_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2289795_2289984_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2290067_2290310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2290290_2291256_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|2291296_2291719_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|2291848_2292793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|2293340_2294690_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2295007_2295610_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2295969_2296950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2297469_2297577_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|2297621_2297834_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|2298049_2298301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2298367_2298646_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_072163404.1|2300057_2300183_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
2301443:2301456	attR	TGATGAAGATGTTT	NA	NA	NA	NA
>prophage 4
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	2700587	2711365	4767526	integrase	Enterobacteria_phage(40.0%)	11	2698560:2698583	2710068:2710091
2698560:2698583	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2700587_2702543_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2704907_2705447_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2705629_2705941_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2705937_2706618_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2706614_2706773_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2706769_2707834_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2707987_2708206_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2708253_2708493_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2708632_2708869_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2708858_2710001_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2710114_2711365_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2710068:2710091	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 5
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	2840172	2881720	4767526	transposase,integrase	Stx2-converting_phage(37.5%)	32	2879145:2879159	2885336:2885350
WP_021513032.1|2840172_2840631_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000976514.1|2841359_2842505_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|2842828_2844091_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000547185.1|2844356_2845685_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179884.1|2846058_2846235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072129716.1|2846478_2847261_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_032180022.1|2848990_2850529_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
WP_000612601.1|2850578_2850926_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_021566758.1|2850922_2851303_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000107485.1|2851757_2852771_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|2852782_2854099_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2854126_2855047_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|2855352_2856135_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|2856136_2856235_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_104976704.1|2856847_2858076_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
WP_154761740.1|2858378_2858516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180018.1|2858678_2859314_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_001335688.1|2859395_2859833_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_000072197.1|2859895_2860720_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001544449.1|2860968_2861307_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000192271.1|2861420_2862992_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_032180015.1|2863003_2864179_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_000757210.1|2864192_2866082_+	enterotoxin	NA	NA	NA	NA	NA
WP_024167628.1|2866250_2866457_-	methyltransferase	NA	NA	NA	NA	NA
WP_000622487.1|2866561_2867998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333439.1|2867994_2872953_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032180014.1|2873627_2874191_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|2875011_2876445_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032141622.1|2876663_2876861_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2877105_2877402_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_100608376.1|2878513_2880331_+	hypothetical protein	NA	NA	NA	NA	NA
2879145:2879159	attL	AAAAAATAATTTCTG	NA	NA	NA	NA
WP_000279872.1|2880517_2881720_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000279872.1|2880517_2881720_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
2885336:2885350	attR	AAAAAATAATTTCTG	NA	NA	NA	NA
>prophage 6
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	3098504	3107274	4767526	integrase	Salmonella_phage(90.0%)	12	3098174:3098187	3107316:3107329
3098174:3098187	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|3098504_3098693_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|3098851_3101245_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|3101241_3102099_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3102095_3102323_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3102322_3102556_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3102623_3102965_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3103082_3103379_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3103386_3103896_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3103928_3104150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|3104295_3105174_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|3105185_3106130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|3106221_3107274_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3107316:3107329	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	3186857	3214061	4767526	lysis,tail,integrase	Enterobacteria_phage(47.06%)	44	3188773:3188787	3214135:3214149
WP_001356070.1|3186857_3188147_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3188205_3188682_+	kinase inhibitor	NA	NA	NA	NA	NA
3188773:3188787	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3189427_3190759_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3190832_3191009_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_153274581.1|3190988_3191129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|3191158_3191827_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|3192717_3193278_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3193666_3193900_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3193956_3194367_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3194718_3194871_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3194899_3195106_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|3195322_3195820_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3195819_3196035_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|3197304_3198264_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3198456_3198981_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3199136_3199514_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3199599_3199740_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3199736_3200099_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3200095_3200386_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3200378_3200549_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3200548_3201004_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3201000_3201102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3201194_3201647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3201643_3202204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3202688_3202982_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3202978_3203680_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|3203676_3204606_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182899.1|3204692_3205232_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3205301_3205532_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3205636_3206326_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|3206448_3207198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3207194_3208022_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3208530_3208737_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3208812_3209109_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3209114_3209900_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3209896_3210577_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3210573_3210756_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3210728_3210920_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3210930_3211212_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3211310_3211532_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3211742_3212345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3212587_3212755_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3212794_3213013_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3212990_3214061_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3214135:3214149	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	3701552	3717240	4767526	tail,integrase	Shigella_phage(33.33%)	17	3698656:3698715	3713325:3713384
3698656:3698715	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000355482.1|3701552_3702326_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_072195243.1|3702395_3702524_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_086711726.1|3702578_3705722_-	GntR family transcriptional regulator	NA	K7PGT9	Enterobacteria_phage	57.4	9.3e-260
WP_001250269.1|3705711_3705891_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515846.1|3706066_3706624_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.5e-96
WP_000205494.1|3706661_3706862_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3706959_3707586_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_001312635.1|3707816_3708314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|3708807_3709170_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081269.1|3709235_3710060_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_001371719.1|3710187_3710724_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_024176184.1|3710714_3711593_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.4	5.3e-165
WP_000206058.1|3711589_3711934_+	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_000051887.1|3712160_3713324_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893260.1|3713528_3714782_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3713325:3713384	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3714793_3715897_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3716184_3717240_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 9
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	4103119	4109678	4767526	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4103119_4104076_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4104076_4104844_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4105401_4105659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4106710_4107862_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4107781_4108132_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4108232_4108805_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4108853_4109678_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 10
NZ_CP024801	Escherichia coli strain AMA1167 chromosome, complete genome	4767526	4526381	4544900	4767526	lysis,tail,integrase	Escherichia_virus(26.32%)	21	4526224:4526270	4542112:4542158
4526224:4526270	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4526381_4526600_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000014361.1|4527847_4528747_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
WP_000972099.1|4528962_4529490_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_060621264.1|4529491_4530493_-	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	91.7	1.2e-176
WP_060621266.1|4531016_4531802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695629.1|4531873_4532326_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917174.1|4532318_4532786_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_000040662.1|4532893_4533319_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_060621267.1|4533306_4533732_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.4e-56
WP_000368931.1|4535021_4536095_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000570053.1|4536087_4537125_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_001143634.1|4537121_4538060_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000554771.1|4538302_4538509_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001600138.1|4538508_4538961_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
WP_000217670.1|4539557_4540058_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000453534.1|4540227_4540500_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4540652_4540946_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023386.1|4541015_4541996_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|4542181_4542682_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4542112:4542158	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4542831_4543530_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4543526_4544900_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP024805	Escherichia coli strain AMA1167 plasmid pAMA1167-NDM-5, complete sequence	111310	8609	60034	111310	integrase,transposase	Escherichia_phage(47.83%)	50	NA	NA
WP_100608384.1|8609_9314_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	7.6e-138
WP_000376616.1|9888_10092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|10219_11059_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|11052_11400_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|11605_12394_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|12524_12998_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|13155_14169_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|14570_15275_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023408309.1|15833_16646_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201167.1|16649_17015_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|17019_17658_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|17668_18700_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|19012_20554_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|20958_21798_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|21791_22139_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|22302_23094_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|23099_23390_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|23501_23999_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_060591625.1|24143_25031_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
WP_001067855.1|25064_25769_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001347546.1|25780_26206_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|26355_27216_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|27653_28358_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_072199528.1|28391_29258_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	1.3e-163
WP_000557454.1|30472_31333_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|31345_31888_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|32369_32561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|32566_32812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837927.1|32862_33990_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|34026_34731_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|34852_35758_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|35754_36993_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|36992_37577_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|38069_38834_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|38973_39678_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|39738_40575_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|40574_41378_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|41438_42254_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|42561_43413_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|44168_44873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000134999.1|45832_46474_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000147567.1|47046_47607_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000027057.1|50227_51088_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|51672_52377_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000239590.1|52758_53634_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|53680_54013_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|56334_57039_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|57670_58501_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|58631_59186_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_100608385.1|59329_60034_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
>prophage 2
NZ_CP024805	Escherichia coli strain AMA1167 plasmid pAMA1167-NDM-5, complete sequence	111310	102748	110178	111310		Escherichia_phage(57.14%)	7	NA	NA
WP_031311986.1|102748_105865_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_001617890.1|105986_107270_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001553856.1|107266_108823_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|109005_109227_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|109226_109607_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|109611_109791_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|109818_110178_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
