The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	0	42759	4917635	tRNA,terminase,portal,capsid,head,tail,transposase,holin,integrase	Escherichia_phage(56.52%)	52	28069:28084	43111:43126
WP_000847402.1|581_911_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_063079327.1|907_3469_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.8	0.0e+00
WP_021544911.1|3461_3896_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.0e-63
WP_063079325.1|3877_4300_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	81.4	1.0e-57
WP_063079328.1|4315_5056_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_063079324.1|5063_5459_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_033549010.1|5455_6034_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_021531813.1|6045_6399_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	98.3	9.9e-62
WP_000158862.1|6410_6809_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
WP_033549012.1|6850_7876_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	3.3e-190
WP_001299443.1|7931_8264_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_103758520.1|8273_9593_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.6	1.1e-233
WP_001345555.1|9573_11175_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|11171_11378_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_033549014.1|11374_13300_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_016230698.1|13274_13820_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	3.6e-79
WP_001329960.1|14214_14400_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|14532_14673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071587457.1|15085_15271_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_001280932.1|15493_15625_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001151823.1|15639_15822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|15978_16512_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_074150484.1|16617_16890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|16855_17200_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000839572.1|17204_17420_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000640107.1|18218_18761_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_021552286.1|18757_19048_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940314.1|19047_19647_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_021539078.1|21220_22201_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
WP_074150500.1|22817_23975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063104638.1|24074_24479_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	4.6e-63
WP_000450662.1|24494_25256_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.2e-117
WP_000788970.1|25278_26025_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899746.1|26031_26889_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_085949006.1|27203_28417_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	4.9e-169
28069:28084	attL	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_074150452.1|28442_28637_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	96.4	2.6e-24
WP_000712069.1|28659_28956_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|29079_29556_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|30009_30165_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_010377803.1|30161_30650_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|31091_31313_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|31312_31483_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|31557_31833_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_048230494.1|31934_34535_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.0e-248
WP_000166319.1|34527_35337_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_050491434.1|35393_35588_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	7.6e-32
WP_000079604.1|35869_36085_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|36086_37322_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157407.1|37373_38309_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_016244573.1|38437_39811_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	8.6e-53
WP_000387388.1|40288_41272_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|41526_42759_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
43111:43126	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	48307	48823	4917635		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|48307_48823_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 3
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	67005	68088	4917635		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|67005_68088_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 4
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	82090	83356	4917635		Klosneuvirus(100.0%)	1	NA	NA
WP_063079814.1|82090_83356_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	4.6e-24
>prophage 5
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	96271	101923	4917635		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|96271_97078_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_074150609.1|97145_97493_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|97860_98649_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001356195.1|98793_99921_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_016244555.1|99988_101923_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	6.9e-32
>prophage 6
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	109739	110330	4917635		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|109739_110330_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 7
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	116030	231469	4917635	terminase,portal,capsid,head,protease,lysis,tail,plate,holin,integrase	Enterobacteria_phage(30.85%)	137	113846:113905	237178:237945
113846:113905	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_001297122.1|116030_118628_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|119007_119259_+	YciN family protein	NA	NA	NA	NA	NA
WP_016244552.1|119294_120344_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	6.0e-22
WP_000559289.1|120563_121322_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.0e-06
WP_001278904.1|121318_121909_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|121948_122821_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|122921_123542_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|123538_124420_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|124557_124602_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_063104707.1|124693_126256_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_063079850.1|126255_127851_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_063079851.1|127854_129213_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	1.7e-37
WP_000209521.1|129224_130418_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443055.1|130417_131224_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807646.1|131604_131751_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|131869_132370_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|132415_132922_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001143132.1|133569_134130_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	3.2e-54
WP_063079849.1|135777_136317_-|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	40.9	1.8e-30
WP_000723926.1|136329_137121_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	50.0	4.9e-16
WP_158649907.1|137167_141580_-	leucine-rich repeat protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	32.5	7.9e-15
WP_063079846.1|141588_142743_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	32.2	6.4e-33
WP_049595185.1|142744_143182_-	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	41.6	4.3e-22
WP_049595184.1|143183_143765_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	33.3	1.6e-16
WP_063079845.1|143761_144850_-	hypothetical protein	NA	Q8SBG7	Shigella_phage	31.4	3.6e-38
WP_063079844.1|144846_146253_-	multidrug DMT transporter permease	NA	J7FAD8	Agrobacterium_phage	33.0	4.0e-05
WP_063079843.1|146263_148222_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	37.7	8.6e-22
WP_049595180.1|148357_148636_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_049595179.1|148638_149004_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_049595178.1|149043_150546_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.1	6.9e-104
WP_000497760.1|150542_150779_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_001090179.1|150792_151353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918573.1|151352_151685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146203.1|151668_151854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063079842.1|151855_152911_-|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	31.2	1.1e-34
WP_063079841.1|152966_153368_-|head	head decoration protein	head	NA	NA	NA	NA
WP_063079840.1|153364_153943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063079839.1|153935_154796_-	S49 family peptidase	NA	A0A2H4PRE9	Proteus_phage	46.4	1.4e-48
WP_063079838.1|154792_156433_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	37.5	9.2e-94
WP_000981815.1|156441_156693_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_063079837.1|156689_158669_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.1	1.3e-134
WP_063079836.1|158622_159240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063079835.1|159671_160001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063079834.1|160000_160666_-	hypothetical protein	NA	G8EY51	Synechococcus_phage	30.2	4.5e-07
WP_063079833.1|160725_161022_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	96.9	1.1e-50
WP_063079832.1|161393_161771_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	3.0e-64
WP_000950574.1|161773_162049_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	2.8e-43
WP_001362368.1|162038_162431_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.2	8.2e-49
WP_063079831.1|163931_164978_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.9	1.6e-187
WP_000917767.1|165128_165326_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_063079829.1|165608_166142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001641576.1|166141_167422_-	hypothetical protein	NA	A0A0P0IKU8	Acinetobacter_phage	34.6	2.5e-54
WP_001297843.1|167421_167967_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.8	2.0e-61
WP_063079828.1|167985_168336_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.3e-34
WP_088550688.1|168348_169398_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_088550689.1|169399_169672_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.9	1.4e-10
WP_001112736.1|169618_169798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013632.1|169839_170052_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000373318.1|170405_171200_+	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000789359.1|171183_171900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074150507.1|172422_172821_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	4.4e-58
WP_032265155.1|172756_173476_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	93.1	4.7e-119
WP_032265156.1|173462_173957_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	3.8e-67
WP_063079251.1|173953_174376_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	1.5e-64
WP_097423515.1|174416_175487_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	3.6e-62
WP_000693852.1|175558_175984_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|175980_176235_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|176314_176734_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_074150466.1|177028_177184_+	DUF1391 family protein	NA	NA	NA	NA	NA
WP_001051723.1|177328_177613_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000636901.1|177973_178195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353256.1|178135_178399_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_063079280.1|178619_179471_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	68.6	7.4e-71
WP_000560207.1|179517_179739_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	79.5	8.1e-30
WP_097423485.1|179859_182295_+	exonuclease	NA	V5UQJ3	Shigella_phage	60.8	5.6e-172
WP_000113184.1|182358_182607_+	excisionase	NA	NA	NA	NA	NA
WP_097423486.1|182584_183715_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.3	4.9e-102
WP_000937498.1|184474_184744_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|184800_185469_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_103758523.1|185706_189480_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	80.8	0.0e+00
WP_103758524.1|189544_190144_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.5	2.4e-108
WP_103758525.1|190212_193692_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_095516730.1|193751_194399_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	8.1e-110
WP_103758526.1|194296_195040_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.4e-150
WP_001152639.1|195045_195744_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847402.1|195743_196073_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_063079327.1|196069_198631_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.8	0.0e+00
WP_063079326.1|198623_199058_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	3.8e-63
WP_063079325.1|199039_199462_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	81.4	1.0e-57
WP_063079328.1|199477_200218_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_063079324.1|200225_200621_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_033549010.1|200617_201196_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000753007.1|201207_201561_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158862.1|201572_201971_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
WP_033549012.1|202012_203038_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	3.3e-190
WP_021561095.1|203093_203426_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_001591724.1|203435_204755_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
WP_001345555.1|204735_206337_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|206333_206540_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_033549014.1|206536_208462_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_016230698.1|208436_208982_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	3.6e-79
WP_000077907.1|209393_210461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654792.1|210402_211023_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.2	1.9e-52
WP_001347308.1|211439_211877_-|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	95.2	1.0e-68
WP_000992100.1|211873_212407_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193264.1|212470_212821_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000839596.1|212825_213041_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_063079173.1|213108_214161_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	96.9	1.7e-202
WP_000917749.1|214312_214510_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_032248024.1|214736_215558_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.3	5.1e-77
WP_032248023.1|215554_215929_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	4.2e-34
WP_001737090.1|215941_216988_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	2.9e-109
WP_001410105.1|216989_217268_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000401168.1|217658_218762_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004956.1|218742_219393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|219558_219771_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000206826.1|220005_220350_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|220346_220514_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224233.1|220524_220788_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000209148.1|220789_221008_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000072553.1|221040_221253_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
WP_063079301.1|221364_221787_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	1.1e-62
WP_000450998.1|221802_222573_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|222594_223341_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095673.1|223347_224310_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_000693888.1|224332_224758_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|224741_225023_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|225123_225543_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001725971.1|225808_225961_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_001435739.1|225972_226293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351093.1|226270_226708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|227108_227297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|227293_227485_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_103758527.1|227577_230049_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	5.0e-59
WP_000113184.1|230112_230361_+	excisionase	NA	NA	NA	NA	NA
WP_103758528.1|230338_230527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077879638.1|230536_231469_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.8	1.3e-89
237178:237945	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAAAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAGTGACGTAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCTGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 8
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	240181	242196	4917635		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|240181_241186_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|241182_242196_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 9
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	250606	260617	4917635		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|250606_251224_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|251828_252242_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|252385_253294_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_063079772.1|253495_254509_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_005024994.1|254600_255506_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|255618_256077_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|256126_256969_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_016244547.1|257694_258372_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|258371_259082_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|259078_260617_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 10
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	274668	402835	4917635	tRNA,terminase,portal,capsid,head,protease,lysis,tail,transposase,holin,integrase	Escherichia_phage(30.99%)	137	281827:281844	399550:399567
WP_000811065.1|274668_275523_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|275558_276368_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|276371_276764_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|276760_277594_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|277593_278676_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000173200.1|278717_279974_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|280187_280811_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_016244544.1|280810_281662_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|281812_282760_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
281827:281844	attL	GCTTTTTGCTGGTAACGC	NA	NA	NA	NA
WP_001033352.1|282884_284564_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|284618_284897_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_063079673.1|285174_285759_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|285875_286967_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001299309.1|290701_292621_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733750.1|292848_293919_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059411.1|293929_294562_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001343883.1|294572_295991_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000841714.1|296310_298008_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000615067.1|298086_298527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511313.1|298704_298959_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020161.1|299159_299894_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|299895_300507_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_063079672.1|300606_301521_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|301615_303352_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_016244540.1|303738_304809_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|304818_306117_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|306446_307979_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|308030_308750_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|308971_310513_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943462.1|310658_311189_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_063079316.1|311234_312503_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	2.1e-207
WP_000897378.1|312502_312922_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_085947917.1|313118_314392_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001306826.1|314630_315542_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|315748_316210_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|316286_316946_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|317017_317311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016244532.1|317552_317954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056831.1|318073_318442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|318961_319657_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|319680_320493_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|320496_320763_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|321241_321361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444487.1|322290_323541_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248698.1|323712_324366_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|324375_324837_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_063079450.1|324890_325997_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|326032_326674_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|326677_328048_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|328216_328888_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|328887_330348_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|330423_331545_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_063079451.1|331593_332820_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|333069_334206_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799406.1|334189_335053_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_103758529.1|335465_339245_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	83.4	0.0e+00
WP_069903543.1|339309_339909_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.0	3.5e-107
WP_103758530.1|339977_343457_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_137564774.1|343517_344126_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.0	2.8e-104
WP_063079544.1|344062_344806_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.4e-150
WP_063104733.1|344811_345510_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.1e-131
WP_001330090.1|345509_345866_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_063079545.1|345843_349071_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.5	0.0e+00
WP_074185540.1|349117_349378_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.0e-39
WP_077249358.1|349419_349806_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	99.2	2.6e-63
WP_063079546.1|349805_350510_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	93.2	5.0e-113
WP_001206306.1|350569_350914_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000968644.1|350910_351360_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|351356_351695_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|351703_352021_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766109.1|352097_353315_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|353329_353929_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|353921_355148_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_000127863.1|356547_358209_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.8	1.4e-278
WP_001353110.1|358192_358549_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001145897.1|358837_359278_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287826.1|359277_359577_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.1	2.1e-28
WP_122989180.1|359569_360742_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.9	1.6e-204
WP_000798771.1|360785_361346_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	5.7e-88
WP_000733258.1|361400_362570_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	75.5	1.1e-162
WP_001053661.1|362856_363363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145405.1|363398_363647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063079356.1|363692_363977_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126643.1|363992_364418_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000761808.1|364628_366749_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.9	4.4e-173
WP_000810461.1|366745_367045_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000543729.1|367050_367284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609228.1|367287_367488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523360.1|367480_367684_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000094457.1|367889_368087_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	43.1	9.5e-06
WP_157732779.1|368144_368318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038671.1|368698_369277_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.6	9.2e-57
WP_001168899.1|369334_369613_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000993956.1|369844_370495_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|370494_370842_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|370861_372433_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_032251080.1|372587_375011_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FP96	Escherichia_phage	99.7	5.0e-197
WP_063079247.1|375010_375493_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	7.4e-84
WP_001135103.1|375640_375991_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|376516_376810_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|376900_377083_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_103758532.1|377299_377833_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.2e-98
WP_000193264.1|377896_378247_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|378251_378467_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|378774_378963_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323611.1|379223_379559_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.8	6.8e-44
WP_000562553.1|379839_379971_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001545909.1|380866_381688_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000139998.1|381702_382065_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001612875.1|382065_383124_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	3.1e-90
WP_000993956.1|383239_383890_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|383889_384237_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|384256_385828_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_074150508.1|385831_386110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001112736.1|386056_386236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|386277_386433_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001224662.1|387523_387706_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|387799_388156_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_063079200.1|388209_388635_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	6.3e-63
WP_103758533.1|388675_389746_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	59.1	2.5e-55
WP_000693850.1|389817_390243_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|390226_390469_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_063079154.1|390860_391199_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.9	2.5e-06
WP_000379589.1|391491_391647_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_032173275.1|391806_392025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|391989_392193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358566.1|392593_392782_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001365098.1|392778_392970_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048273.1|393063_395535_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|395596_395866_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|395834_396953_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000580316.1|397119_397914_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759317.1|397910_398957_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|399112_399934_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
399550:399567	attR	GCGTTACCAGCAAAAAGC	NA	NA	NA	NA
WP_000291257.1|399949_400861_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_024191477.1|400889_402134_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033692.1|402133_402835_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 11
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	410124	410382	4917635		Erwinia_phage(100.0%)	1	NA	NA
WP_016244522.1|410124_410382_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 12
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	422713	424356	4917635		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267941.1|422713_423718_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|423714_424356_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 13
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	427628	428810	4917635		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|427628_427865_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|428075_428810_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 14
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	441462	442614	4917635	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_103758534.1|441462_442614_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 15
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	459194	465955	4917635	transposase	Salmonella_phage(33.33%)	9	NA	NA
WP_001217754.1|459194_459440_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
WP_000414437.1|459729_459984_+	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_000872815.1|460098_461217_+	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_001323065.1|461237_461378_+	DUF2770 family protein	NA	NA	NA	NA	NA
WP_021539078.1|461533_462514_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
WP_063079513.1|462672_463137_+	cytochrome b	NA	NA	NA	NA	NA
WP_000749261.1|463140_463716_+	YceI family protein	NA	NA	NA	NA	NA
WP_016244508.1|463757_464810_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_000183364.1|465034_465955_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 16
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	475263	475797	4917635		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|475263_475797_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 17
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	480011	484075	4917635	transposase	Escherichia_phage(33.33%)	3	NA	NA
WP_021539078.1|480011_480992_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
WP_085947917.1|481685_482958_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001189321.1|483241_484075_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 18
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	489202	490561	4917635		Bacillus_phage(100.0%)	1	NA	NA
WP_000409849.1|489202_490561_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
>prophage 19
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	497380	498445	4917635		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|497380_498445_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 20
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	513205	515305	4917635		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|513205_513700_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001326838.1|513720_515049_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|515131_515305_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 21
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	519227	531483	4917635		Klosneuvirus(20.0%)	13	NA	NA
WP_000420617.1|519227_520148_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|520147_520453_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209866.1|520545_521145_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_016244491.1|521141_523688_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	9.0e-72
WP_001230242.1|523687_524860_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|524989_525682_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264919.1|525654_526683_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_071988638.1|526765_529510_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_016244489.1|529581_530655_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|530703_530877_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001323678.1|530866_531097_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|531071_531260_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|531270_531483_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 22
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	542229	543503	4917635	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085949152.1|542229_543503_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 23
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	552419	553079	4917635	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375138.1|552419_553079_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
>prophage 24
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	557312	559367	4917635		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|557312_559367_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 25
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	571966	573874	4917635		Tupanvirus(100.0%)	1	NA	NA
WP_000053119.1|571966_573874_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	4.1e-53
>prophage 26
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	589795	600928	4917635	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_016244471.1|589795_590563_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_016244470.1|590769_593382_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_063079859.1|593647_594850_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|595018_596419_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|597020_598109_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_016244469.1|598293_599484_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|599705_600353_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|600379_600928_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 27
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	615633	620174	4917635		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|615633_617382_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_016244465.1|617418_619683_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|619889_620174_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 28
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	625260	626349	4917635		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|625260_626349_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 29
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	630447	633662	4917635		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|630447_632730_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|632921_633662_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 30
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	640748	664544	4917635	tRNA,protease	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|640748_641366_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|641376_643821_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_063079752.1|644059_645352_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067756.1|645442_646786_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_001295343.1|646796_647408_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_063079751.1|647562_651666_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|651800_652295_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|652839_653805_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043614.1|653927_655694_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|655694_657416_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|657457_658162_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|658446_658665_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_063079750.1|659349_661626_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	4.3e-166
WP_000520781.1|661656_661977_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|662300_662525_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188139.1|662597_664544_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 31
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	673949	675152	4917635		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|673949_675152_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 32
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	686485	688357	4917635		Planktothrix_phage(100.0%)	1	NA	NA
WP_063104785.1|686485_688357_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.1	1.8e-16
>prophage 33
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	691675	700017	4917635		Synechococcus_phage(33.33%)	6	NA	NA
WP_001297004.1|691675_692338_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	9.7e-26
WP_001446256.1|692468_693368_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_016244443.1|693373_695806_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114244.1|695951_696767_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|696918_698184_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|698424_700017_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 34
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	705014	710239	4917635		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|705014_705530_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|705582_705648_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|705882_706770_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|707068_707572_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|707975_708722_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|708860_709520_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|709516_710239_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 35
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	713779	728591	4917635		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|713779_714040_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_063079868.1|714304_716587_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_024191470.1|716628_717306_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	6.9e-19
WP_000146343.1|717379_717646_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|717910_718171_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_060773736.1|718399_719485_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386540.1|719625_720588_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218658.1|720615_722766_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_001145123.1|722885_723368_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_063079867.1|723599_724964_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001361582.1|725192_725864_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|725866_726862_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_016244434.1|726854_728591_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 36
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	739964	740873	4917635		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|739964_740873_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 37
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	747354	748644	4917635		Klosneuvirus(100.0%)	1	NA	NA
WP_074150598.1|747354_748644_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	6.5e-18
>prophage 38
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	756090	762663	4917635		Planktothrix_phage(33.33%)	7	NA	NA
WP_016244424.1|756090_757149_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_063104649.1|757151_757841_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016244422.1|757840_758614_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|758779_758929_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|759057_759846_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|759913_761386_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|761646_762663_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 39
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	767026	770546	4917635		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109192.1|767026_768079_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.6e-81
WP_000784351.1|768394_768775_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|768888_769830_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_016244421.1|769826_770546_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	26.5	1.7e-15
>prophage 40
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	803748	804540	4917635		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|803748_804540_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 41
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	808695	811637	4917635		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|808695_810177_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207136.1|810218_811637_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	1.6e-62
>prophage 42
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	819693	825674	4917635		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_063079352.1|819693_821742_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	5.5e-27
WP_016244403.1|821750_822323_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_040091374.1|822315_825000_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_016244401.1|824996_825674_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	1.5e-26
>prophage 43
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	833106	833871	4917635		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|833106_833871_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 44
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	838022	841836	4917635	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_016244399.1|838022_839687_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
WP_001023104.1|839889_841836_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 45
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	846602	848267	4917635		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|846602_848267_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 46
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	852362	853442	4917635		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|852362_853442_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 47
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	861338	862064	4917635		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631384.1|861338_862064_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 48
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	872585	875168	4917635	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_016244390.1|872585_875168_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.5e-183
>prophage 49
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	882178	884618	4917635		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|882178_883267_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|883406_884618_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 50
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	889433	890080	4917635		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|889433_889817_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|889870_890080_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 51
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	905505	907620	4917635		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|905505_905934_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|906054_907620_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 52
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	910729	912552	4917635		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029813.1|910729_911950_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
WP_000502945.1|911922_912552_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 53
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	927098	933917	4917635		Klosneuvirus(50.0%)	2	NA	NA
WP_000140647.1|927098_927914_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_016244372.1|930035_933917_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	3.4e-62
>prophage 54
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	945358	948502	4917635		Leptospira_phage(100.0%)	1	NA	NA
WP_016244365.1|945358_948502_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	9.8e-60
>prophage 55
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	951772	956532	4917635		Bacillus_phage(33.33%)	3	NA	NA
WP_000770953.1|951772_952456_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_063079569.1|952445_953894_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_016244361.1|954630_956532_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	4.1e-29
>prophage 56
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	960568	961903	4917635		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_063079571.1|960568_961903_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.4e-20
>prophage 57
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	973582	976713	4917635	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|973582_974449_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|974450_974663_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|974770_975292_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|975327_976713_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 58
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	986422	990501	4917635	transposase	Staphylococcus_phage(50.0%)	3	NA	NA
WP_001254932.1|986422_987574_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000540996.1|988442_989228_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_016244326.1|989355_990501_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.7	3.1e-48
>prophage 59
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	997475	999257	4917635		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|997475_999257_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 60
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1008040	1008727	4917635		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|1008040_1008727_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 61
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1011863	1012541	4917635		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|1011863_1012541_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 62
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1017080	1020141	4917635		uncultured_virus(50.0%)	2	NA	NA
WP_016244319.1|1017080_1019585_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.9e-114
WP_063079827.1|1019799_1020141_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	9.3e-41
>prophage 63
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1028385	1036946	4917635		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_016244318.1|1028385_1029345_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	1.7e-15
WP_063079825.1|1029341_1030304_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1030539_1031184_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678208.1|1031363_1033238_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1033347_1033953_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1033952_1034282_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122007.1|1034334_1036266_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1036394_1036946_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 64
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1043954	1047104	4917635		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1043954_1047104_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 65
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1056717	1060264	4917635		Bacillus_phage(100.0%)	2	NA	NA
WP_016244315.1|1056717_1058499_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_016244314.1|1058491_1060264_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
>prophage 66
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1063587	1064283	4917635		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|1063587_1064283_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 67
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1067411	1072458	4917635	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1067411_1067684_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1067892_1070247_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1070434_1071709_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1071834_1072458_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 68
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1083662	1086251	4917635	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000993956.1|1083662_1084313_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|1084312_1084660_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|1084679_1086251_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
>prophage 69
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1098877	1107858	4917635	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_049590200.1|1098877_1099348_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	3.0e-29
WP_001150428.1|1099436_1100540_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.3e-54
WP_000543535.1|1100543_1100993_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|1101143_1101683_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1101981_1102866_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1103042_1103390_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1103518_1104490_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1104500_1106348_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1106375_1106708_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1106730_1107858_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 70
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1114810	1124782	4917635		Bacillus_phage(60.0%)	7	NA	NA
WP_016244309.1|1114810_1116106_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.2e-26
WP_000113933.1|1116163_1116853_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_063079760.1|1117042_1118245_+	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.1	5.3e-06
WP_000698942.1|1118241_1121385_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_032160076.1|1121510_1122695_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219312.1|1122837_1123746_-	fructokinase	NA	NA	NA	NA	NA
WP_063079761.1|1123870_1124782_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	3.5e-103
>prophage 71
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1129071	1130187	4917635		Bacillus_phage(100.0%)	1	NA	NA
WP_063079758.1|1129071_1130187_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.9	3.3e-18
>prophage 72
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1137602	1215231	4917635	holin,transposase	Escherichia_phage(12.5%)	58	NA	NA
WP_000830741.1|1137602_1138760_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
WP_063079211.1|1138760_1139384_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_021539078.1|1139517_1140498_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
WP_085947917.1|1142629_1143902_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001295337.1|1146244_1147219_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004049.1|1147324_1148176_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114609.1|1148172_1149000_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939375.1|1148996_1149764_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
WP_001317652.1|1149776_1150739_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362029.1|1151354_1152026_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_000860439.1|1152035_1153232_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024183734.1|1153209_1153791_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000596085.1|1153792_1154566_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001141271.1|1154753_1155029_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842103.1|1155063_1156173_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	1.2e-31
WP_000419042.1|1156266_1157100_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016244305.1|1157325_1157865_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000107624.1|1157966_1159178_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001013499.1|1159353_1160367_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|1160363_1161314_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_000160734.1|1161310_1162120_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_063079286.1|1162129_1162996_-	2-hydroxy-6-oxonona-2,4-dienedioate hydrolase	NA	NA	NA	NA	NA
WP_000543457.1|1163013_1163958_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_016244304.1|1163959_1165624_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_001316894.1|1165700_1166648_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805910.1|1166724_1167807_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.4	1.1e-191
WP_016244303.1|1167929_1171004_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.2	0.0e+00
WP_000291549.1|1171055_1172309_+	lactose permease	NA	NA	NA	NA	NA
WP_001335915.1|1172374_1172986_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_001542685.1|1173088_1174270_-	cyanate transporter CynX	NA	NA	NA	NA	NA
WP_000616241.1|1174275_1174746_-	cyanase	NA	NA	NA	NA	NA
WP_000658652.1|1174776_1175436_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016244302.1|1175545_1176445_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
WP_001299008.1|1176577_1177861_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|1177850_1179110_-	cytosine permease	NA	NA	NA	NA	NA
WP_001275861.1|1181459_1182911_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_016244299.1|1186064_1187651_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_000691956.1|1187748_1188024_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_074150589.1|1188170_1188842_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000290608.1|1188858_1189104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063079525.1|1189576_1190332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226495.1|1190574_1191624_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	8.3e-72
WP_063079524.1|1192000_1193383_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_063079526.1|1193392_1194343_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_000083455.1|1194578_1195997_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_063079523.1|1195996_1197544_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_063079522.1|1197533_1198397_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_063079521.1|1198436_1199042_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013890.1|1199299_1199797_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_063079520.1|1199888_1200821_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074150590.1|1200862_1201510_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|1201528_1202801_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_072097009.1|1203428_1207412_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	1.4e-124
WP_000131044.1|1207984_1210018_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|1210146_1210734_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_063079265.1|1210747_1212220_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_063104600.1|1212233_1213904_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
WP_001352368.1|1214022_1215231_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 73
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1220819	1260375	4917635	integrase,transposase	Shigella_phage(32.43%)	48	1236064:1236078	1258464:1258478
WP_001046306.1|1220819_1222145_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_063079311.1|1222253_1222454_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000066482.1|1223732_1223948_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_021539078.1|1224224_1225205_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
WP_000087756.1|1225447_1225660_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122985741.1|1225714_1225804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047084.1|1226075_1226828_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_016230662.1|1226841_1227831_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001061398.1|1227838_1228636_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
WP_063104668.1|1228655_1229045_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_000066918.1|1229041_1229695_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_074150530.1|1229694_1230189_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.9	4.0e-85
WP_063079611.1|1230185_1231127_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
WP_001250272.1|1231116_1231296_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000526668.1|1231471_1232029_-	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001191669.1|1232021_1232282_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_063079610.1|1232379_1233072_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	4.9e-121
WP_000135680.1|1233774_1234137_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1234202_1235027_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|1235154_1235691_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|1235681_1236044_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|1236043_1236349_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
1236064:1236078	attL	AGAACTGATTAAAGA	NA	NA	NA	NA
WP_000433942.1|1236348_1236699_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	99.1	4.1e-60
WP_000051894.1|1236575_1237739_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	4.5e-228
WP_000617441.1|1238299_1238587_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001528727.1|1239203_1240160_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	42.5	4.2e-62
WP_000098670.1|1240172_1240610_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	37.3	5.1e-15
WP_042025458.1|1241402_1241792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029844.1|1241810_1243916_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	7.2e-91
WP_000246960.1|1243915_1245337_-	DNA transfer protein	NA	B6SCW4	Bacteriophage	52.7	2.8e-123
WP_000909175.1|1245336_1246014_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000420674.1|1246007_1246469_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_063079291.1|1247230_1249987_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.1	1.5e-298
WP_001208877.1|1249973_1250345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628966.1|1250337_1250679_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058743.1|1250689_1251292_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.0e-25
WP_000181940.1|1251284_1251506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024679.1|1251502_1251766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|1251762_1251957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613398.1|1251949_1253017_-	ash family protein	NA	NA	NA	NA	NA
WP_000042978.1|1253013_1253193_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019363.1|1253185_1254019_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412533.1|1254031_1254463_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_000035054.1|1254462_1254666_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772646.1|1255093_1256308_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	2.2e-132
WP_016244289.1|1256663_1257917_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|1257928_1259032_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
1258464:1258478	attR	TCTTTAATCAGTTCT	NA	NA	NA	NA
WP_000749879.1|1259319_1260375_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
>prophage 74
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1265052	1266219	4917635		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001396230.1|1265052_1266219_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	3.2e-32
>prophage 75
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1270688	1274607	4917635		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543899.1|1270688_1271462_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|1271647_1271908_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|1271910_1272189_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1272344_1273085_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001365365.1|1273055_1273823_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1274028_1274607_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 76
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1285041	1292895	4917635		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001297205.1|1285041_1285773_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1285837_1286305_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1286301_1287024_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_063079349.1|1287057_1287813_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_063079350.1|1287884_1289243_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211722.1|1289291_1290062_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1290139_1290940_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648604.1|1291180_1292095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063079351.1|1292091_1292895_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.1e-38
>prophage 77
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1299556	1300588	4917635		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|1299556_1300588_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 78
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1313547	1317663	4917635		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_103758539.1|1313547_1317030_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	1.8e-208
WP_000569430.1|1317066_1317663_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 79
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1326491	1327250	4917635		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|1326491_1327250_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 80
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1339129	1340554	4917635	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|1339129_1340554_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 81
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1344483	1344828	4917635		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1344483_1344828_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 82
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1350739	1351537	4917635		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1350739_1351537_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 83
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1356780	1363586	4917635	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_074150617.1|1356780_1359210_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
WP_001294700.1|1359283_1359814_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_063079725.1|1359828_1360533_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1360710_1361166_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937430.1|1361202_1362129_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|1362167_1363586_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 84
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1373247	1375537	4917635	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_000339949.1|1373247_1374144_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.6e-61
WP_001254932.1|1374385_1375537_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 85
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1378629	1385097	4917635		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150613.1|1378629_1379556_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	2.6e-21
WP_000651599.1|1379664_1380327_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1380367_1380904_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001349940.1|1381109_1383500_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_063079704.1|1383546_1385097_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 86
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1392746	1394171	4917635		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1392746_1394171_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 87
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1402681	1403233	4917635		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923727.1|1402681_1403233_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 88
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1407478	1408522	4917635		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|1407478_1408522_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 89
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1434495	1436220	4917635		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|1434495_1436220_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 90
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1448923	1449622	4917635		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916323.1|1448923_1449622_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 91
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1455985	1461408	4917635		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035670.1|1455985_1458337_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_063079932.1|1458501_1461408_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 92
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1469152	1470552	4917635		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|1469152_1469995_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|1470072_1470552_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 93
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1478447	1484108	4917635		Vibrio_phage(50.0%)	4	NA	NA
WP_063079934.1|1478447_1479953_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_063079935.1|1479992_1481135_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349936.1|1481263_1482481_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_063104735.1|1482554_1484108_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	6.2e-31
>prophage 94
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1489578	1490727	4917635		Halovirus(100.0%)	1	NA	NA
WP_000597261.1|1489578_1490727_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 95
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1495170	1497987	4917635	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286888.1|1495170_1497987_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 96
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1501812	1510881	4917635		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681362.1|1501812_1502979_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
WP_001181672.1|1503507_1503717_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118475.1|1503820_1504951_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	7.9e-28
WP_000516135.1|1505039_1506956_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|1507332_1507737_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|1507762_1508476_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|1508624_1509191_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|1509225_1509813_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|1509927_1510881_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 97
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1520413	1525985	4917635	transposase	Staphylococcus_phage(33.33%)	5	NA	NA
WP_001254932.1|1520413_1521565_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001194358.1|1521685_1522402_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920336.1|1522461_1523814_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219614.1|1523871_1525296_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188664.1|1525295_1525985_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 98
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1529268	1534623	4917635		Bacillus_phage(33.33%)	3	NA	NA
WP_000409442.1|1529268_1531206_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|1531416_1533084_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|1533390_1534623_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 99
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1541343	1542666	4917635		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|1541343_1542666_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 100
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1548705	1551581	4917635		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|1548705_1548867_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|1548993_1549599_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|1549991_1551581_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 101
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1559510	1560790	4917635		Salmonella_phage(50.0%)	2	NA	NA
WP_063079881.1|1559510_1560050_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|1560052_1560790_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 102
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1571404	1573060	4917635		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_063104672.1|1571404_1573060_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.4	2.1e-13
>prophage 103
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1578805	1582774	4917635		Synechococcus_phage(50.0%)	2	NA	NA
WP_000819015.1|1578805_1581238_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_001540814.1|1581304_1582774_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.0	9.6e-34
>prophage 104
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1589273	1590218	4917635	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181177.1|1589273_1590218_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.3e-60
>prophage 105
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1597719	1598274	4917635		Clostridioides_phage(100.0%)	1	NA	NA
WP_063104741.1|1597719_1598274_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	3.5e-37
>prophage 106
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1604851	1606312	4917635		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_063079348.1|1604851_1606312_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	4.7e-49
>prophage 107
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1616515	1618191	4917635		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|1616515_1617112_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|1617588_1618191_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 108
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1621551	1622532	4917635		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001295601.1|1621551_1622532_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	1.2e-101
>prophage 109
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1626160	1628295	4917635		Klebsiella_phage(33.33%)	4	NA	NA
WP_063079229.1|1626160_1626382_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
WP_001186774.1|1626444_1626921_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849588.1|1626936_1627422_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234620.1|1627476_1628295_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
>prophage 110
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1636367	1697751	4917635	transposase	Stx2-converting_phage(27.78%)	51	NA	NA
WP_103758541.1|1636367_1637596_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	3.0e-174
WP_001297234.1|1638804_1640289_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_063079219.1|1640610_1641213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077879649.1|1641307_1641586_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000993956.1|1641674_1642325_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|1642324_1642672_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|1642691_1644263_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_085947917.1|1644569_1645843_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000221545.1|1647179_1647749_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|1648008_1648410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|1648397_1648832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|1649186_1649567_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1649563_1649911_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000823243.1|1651584_1652943_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937735.1|1653321_1653513_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000555341.1|1653675_1653933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|1655683_1656205_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_016232429.1|1656201_1657155_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188281.1|1657241_1659566_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879152.1|1659610_1660513_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|1660509_1661508_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|1661504_1662461_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1662461_1663229_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|1663785_1664043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085455693.1|1665094_1666246_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.9e-41
WP_001293435.1|1667302_1669300_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001375347.1|1669362_1670640_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|1670887_1671544_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126123275.1|1671724_1671835_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001387298.1|1672951_1673050_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|1673051_1673834_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|1674139_1675060_+	ribokinase	NA	NA	NA	NA	NA
WP_000998347.1|1675087_1676404_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107480.1|1676415_1677429_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_089516276.1|1677573_1678846_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.6e-176
WP_001446914.1|1679232_1679472_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_000345346.1|1679682_1680939_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705931.1|1680951_1681239_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916805.1|1681254_1681698_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416153.1|1681968_1683000_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_001375333.1|1684350_1684785_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001352291.1|1685693_1686020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228394.1|1686229_1686574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981734.1|1686928_1688278_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102863.1|1688298_1689216_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_001041752.1|1689227_1690424_-	CoA transferase	NA	NA	NA	NA	NA
WP_000018562.1|1690660_1692574_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255944.1|1693607_1694630_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001300609.1|1694626_1695409_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000349548.1|1695447_1695651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085455693.1|1696599_1697751_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.9e-41
>prophage 111
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1701963	1704692	4917635	integrase	Stenotrophomonas_phage(50.0%)	2	1691812:1691828	1711910:1711926
1691812:1691828	attL	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
WP_000772679.1|1701963_1703229_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	4.8e-74
WP_001352285.1|1703672_1704692_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	4.9e-45
1711910:1711926	attR	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
>prophage 112
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1708933	1714097	4917635	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
WP_000397144.1|1708933_1710445_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|1710798_1711242_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416382.1|1711241_1714097_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 113
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1722365	1728462	4917635		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|1722365_1723301_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|1723313_1723775_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|1723847_1724234_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471885.1|1724439_1727136_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.6	8.2e-47
WP_001387276.1|1727276_1727330_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181312.1|1727514_1728462_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 114
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1732100	1734861	4917635		Vibrio_phage(100.0%)	2	NA	NA
WP_000187791.1|1732100_1734239_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|1734396_1734861_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
>prophage 115
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1739177	1745665	4917635		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|1739177_1740176_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|1740208_1741204_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001297255.1|1741190_1742213_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000210557.1|1742226_1743729_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|1743868_1744825_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|1745134_1745665_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 116
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1787204	1788368	4917635		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|1787204_1788368_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 117
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1792300	1805331	4917635	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076332.1|1792300_1794742_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177639.1|1794780_1795206_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1795410_1796709_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1796812_1797010_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1797091_1798096_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1798098_1799358_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|1799443_1800724_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1800799_1801108_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|1801193_1802144_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122505.1|1802136_1803984_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990333.1|1803993_1805331_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 118
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1809246	1809792	4917635		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|1809246_1809792_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 119
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1817775	1818753	4917635		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|1817775_1818753_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 120
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1823673	1824207	4917635		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|1823673_1824207_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 121
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1828724	1830708	4917635		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|1828724_1830371_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|1830414_1830708_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 122
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1845762	1848974	4917635	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_063079679.1|1845762_1847220_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_001295087.1|1847456_1848974_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
>prophage 123
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1868525	1870028	4917635		Burkholderia_virus(100.0%)	1	NA	NA
WP_001313516.1|1868525_1870028_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 124
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1874867	1875656	4917635		Cedratvirus(100.0%)	1	NA	NA
WP_063079623.1|1874867_1875656_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.6	9.5e-12
>prophage 125
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1881260	1882876	4917635		Bacillus_virus(50.0%)	2	NA	NA
WP_016244129.1|1881260_1882019_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
WP_000611428.1|1882195_1882876_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 126
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1892844	1894992	4917635		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|1892844_1894992_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 127
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1904276	1906235	4917635		Staphylococcus_phage(100.0%)	1	NA	NA
WP_063079616.1|1904276_1906235_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 128
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1912596	1913946	4917635		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|1912596_1913946_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 129
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1917763	1921376	4917635		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|1917763_1918300_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|1918553_1921376_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 130
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1925563	1928111	4917635		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_016244145.1|1925563_1926643_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.9	2.3e-29
WP_000918363.1|1926695_1928111_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 131
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1934702	1935311	4917635		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|1934702_1935311_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 132
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1944435	1945551	4917635		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|1944435_1945551_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 133
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1971687	1975371	4917635		Dickeya_phage(100.0%)	1	NA	NA
WP_016244109.1|1971687_1975371_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 134
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1991257	1992847	4917635		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|1991257_1992847_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 135
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	1998215	1999979	4917635		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|1998215_1998488_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|1998674_1999265_-	YjaG family protein	NA	NA	NA	NA	NA
WP_016244104.1|1999307_1999979_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	1.4e-19
>prophage 136
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2009195	2017524	4917635		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2009195_2013419_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2013495_2017524_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 137
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2021640	2024693	4917635		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2021640_2022825_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2023742_2024693_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 138
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2033173	2035018	4917635		Acinetobacter_phage(100.0%)	1	NA	NA
WP_063079376.1|2033173_2035018_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 139
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2041979	2043188	4917635	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|2041979_2043188_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 140
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2055498	2065022	4917635	transposase	Shigella_phage(25.0%)	7	NA	NA
WP_085947917.1|2055498_2056772_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000204101.1|2056931_2057810_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184821.1|2057775_2060073_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_016244093.1|2060123_2060444_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004442.1|2060458_2061538_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_016244092.1|2061846_2064348_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|2064359_2065022_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 141
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2082320	2086823	4917635		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|2082320_2083652_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2083718_2084645_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2084737_2085223_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2085307_2085553_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2085977_2086823_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 142
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2098397	2104035	4917635		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_001033722.1|2098397_2099096_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2099092_2100466_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|2100571_2101246_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001297064.1|2103414_2104035_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 143
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2109495	2112546	4917635		Escherichia_phage(100.0%)	1	NA	NA
WP_149018982.1|2109495_2112546_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.6	4.2e-07
>prophage 144
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2120067	2122847	4917635		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|2120067_2120853_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_063079741.1|2120886_2121783_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|2121950_2122847_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 145
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2139070	2141541	4917635		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_016244078.1|2139070_2140120_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188776.1|2140131_2141541_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 146
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2145619	2148406	4917635		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2145619_2148406_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 147
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2162878	2163493	4917635		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|2162878_2163493_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 148
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2173061	2176348	4917635		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2173061_2173838_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_016244072.1|2173840_2174356_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2174359_2174629_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|2174707_2176348_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 149
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2188878	2190708	4917635		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2188878_2190708_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 150
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2197209	2201068	4917635		Bacillus_phage(100.0%)	3	NA	NA
WP_063079892.1|2197209_2199372_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.8	3.0e-116
WP_001213584.1|2199455_2200172_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|2200171_2201068_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 151
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2219544	2225688	4917635		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|2219544_2220675_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_016244059.1|2220679_2221354_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2221331_2222213_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226604.1|2222231_2223299_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000006625.1|2223298_2224561_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|2224557_2225688_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 152
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2229729	2235141	4917635		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2229729_2230059_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2230189_2231455_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|2231588_2233073_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238890.1|2233119_2235141_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 153
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2243614	2245261	4917635		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012598.1|2243614_2245261_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	4.8e-66
>prophage 154
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2258656	2264509	4917635		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|2258656_2259547_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2259571_2260537_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387771.1|2260541_2262047_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.6e-15
WP_000715936.1|2262054_2262474_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|2262640_2264509_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 155
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2267677	2268670	4917635		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845106.1|2267677_2268670_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 156
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2280622	2289521	4917635		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_000933736.1|2280622_2281993_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|2282154_2283984_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_063079424.1|2285680_2286721_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.0	1.0e-50
WP_000741620.1|2286807_2287767_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|2287766_2288657_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|2288747_2289521_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 157
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2296437	2297711	4917635	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947917.1|2296437_2297711_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 158
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2301845	2303183	4917635		Moraxella_phage(100.0%)	1	NA	NA
WP_000019346.1|2301845_2303183_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 159
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2313381	2324247	4917635	transposase	Stx2-converting_phage(42.86%)	12	NA	NA
WP_001307474.1|2313381_2313639_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|2313602_2313962_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2313978_2314119_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|2314348_2314429_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|2314725_2316129_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|2316133_2317234_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|2317233_2318307_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_063104744.1|2318335_2320750_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_063104743.1|2320989_2321448_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.6	5.0e-13
WP_000381442.1|2321658_2323230_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_000624618.1|2323249_2323597_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000993956.1|2323596_2324247_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
>prophage 160
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2328880	2330029	4917635		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2328880_2330029_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 161
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2334456	2335410	4917635		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|2334456_2334870_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|2334981_2335410_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 162
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2341762	2350923	4917635		Aeromonas_phage(25.0%)	10	NA	NA
WP_016244042.1|2341762_2343478_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828500.1|2343474_2344968_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	26.2	2.7e-31
WP_000511291.1|2345014_2345464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|2345572_2345920_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|2345909_2346272_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|2346268_2346766_+	radical SAM protein	NA	NA	NA	NA	NA
WP_063079873.1|2346773_2347958_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000060506.1|2348376_2348466_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|2349030_2349129_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|2349234_2350923_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 163
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2358345	2359680	4917635		Moraxella_phage(100.0%)	1	NA	NA
WP_074150565.1|2358345_2359680_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 164
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2368574	2371163	4917635	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000993956.1|2368574_2369225_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|2369224_2369572_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|2369591_2371163_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
>prophage 165
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2374510	2375902	4917635		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2374510_2375902_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 166
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2381023	2388946	4917635		Morganella_phage(40.0%)	7	NA	NA
WP_000280488.1|2381023_2383132_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|2383150_2383426_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|2383480_2384104_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_016244023.1|2384360_2386043_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	2.8e-21
WP_000924289.1|2386039_2386657_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001299758.1|2386948_2387773_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	6.9e-90
WP_021548889.1|2388121_2388946_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	82.4	1.2e-97
>prophage 167
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2393318	2401524	4917635	integrase	Morganella_phage(40.0%)	11	2390099:2390114	2403102:2403117
2390099:2390114	attL	CCTGCGTGGCGCTGGC	NA	NA	NA	NA
WP_063079692.1|2393318_2395760_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.1	4.8e-139
WP_016244016.1|2395772_2396399_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	35.2	1.1e-23
WP_016244015.1|2396395_2396659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016244014.1|2396655_2396835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016244013.1|2396827_2397553_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_021548883.1|2397539_2397722_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001565826.1|2397714_2398548_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	1.2e-20
WP_001565825.1|2398560_2398992_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.3	4.2e-30
WP_001565824.1|2398991_2399195_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_063079583.1|2399301_2400252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032319047.1|2400270_2401524_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	80.0	8.1e-199
2403102:2403117	attR	CCTGCGTGGCGCTGGC	NA	NA	NA	NA
>prophage 168
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2404867	2409430	4917635		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|2404867_2405323_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|2405303_2406524_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|2406695_2407364_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|2407580_2407817_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2407837_2408005_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|2408102_2408912_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_063079581.1|2408950_2409430_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	3.7e-27
>prophage 169
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2416868	2418962	4917635		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_103758547.1|2416868_2417894_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
WP_000064013.1|2417978_2418962_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 170
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2422361	2434644	4917635		Synechococcus_phage(20.0%)	8	NA	NA
WP_000587764.1|2422361_2423294_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001213834.1|2425506_2426703_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646013.1|2426712_2427738_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
WP_000483856.1|2429774_2430734_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_063079296.1|2430737_2432021_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	7.9e-08
WP_000116565.1|2432030_2433575_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|2433819_2434251_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|2434392_2434644_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 171
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2456771	2465168	4917635	tRNA	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_103758548.1|2456771_2461001_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.8	1.6e-25
WP_000779792.1|2461229_2461838_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|2461935_2463327_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582456.1|2463323_2465168_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 172
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2479867	2481409	4917635		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2479867_2481409_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 173
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2487504	2488500	4917635		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182672.1|2487504_2488500_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	1.2e-11
>prophage 174
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2493501	2493714	4917635		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2493501_2493714_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 175
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2497368	2499702	4917635		Escherichia_phage(100.0%)	1	NA	NA
WP_000013942.1|2497368_2499702_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	1.8e-71
>prophage 176
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2509916	2511901	4917635		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|2509916_2510900_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_016243984.1|2510896_2511901_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	30.4	3.0e-18
>prophage 177
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2554811	2555459	4917635		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2554811_2555459_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 178
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2561119	2563255	4917635		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_016243971.1|2561119_2561545_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	6.6e-52
WP_001365379.1|2561557_2562847_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	2.1e-173
WP_000008953.1|2562901_2563255_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	7.4e-25
>prophage 179
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2566600	2568643	4917635		Indivirus(100.0%)	1	NA	NA
WP_001308122.1|2566600_2568643_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 180
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2580531	2590842	4917635	transposase	Shigella_phage(25.0%)	8	NA	NA
WP_085947917.1|2580531_2581805_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_016243966.1|2583104_2584172_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016243965.1|2584168_2586904_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
WP_001216257.1|2586903_2588028_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259385.1|2588100_2588376_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_000593555.1|2588372_2588732_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|2589628_2590030_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_016243964.1|2590035_2590842_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 181
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2598734	2602866	4917635		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|2598734_2599400_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|2599620_2599866_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_063079776.1|2599967_2602166_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	1.7e-119
WP_000964718.1|2602239_2602866_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 182
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2605869	2608688	4917635		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|2605869_2606538_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_063079775.1|2606530_2607589_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|2607833_2608688_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 183
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2614421	2615904	4917635		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082110.1|2614421_2615189_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|2615190_2615904_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 184
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2619445	2621256	4917635		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907797.1|2619445_2620516_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073599.1|2620512_2621256_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 185
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2641257	2643705	4917635		Dickeya_phage(100.0%)	1	NA	NA
WP_016243953.1|2641257_2643705_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 186
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2659315	2661709	4917635		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|2659315_2661709_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 187
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2667678	2668557	4917635		Sodalis_phage(100.0%)	1	NA	NA
WP_016243947.1|2667678_2668557_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	2.1e-68
>prophage 188
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2675120	2678887	4917635		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|2675120_2675840_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|2675836_2677189_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_016243944.1|2677264_2678887_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.2e-141
>prophage 189
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2695862	2696699	4917635		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2695862_2696699_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 190
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2714073	2723613	4917635		Acinetobacter_phage(25.0%)	9	NA	NA
WP_016243935.1|2714073_2714637_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.2	1.2e-61
WP_001618902.1|2714722_2715943_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|2716008_2718099_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|2718149_2718782_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|2719083_2719488_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|2719542_2720412_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|2720465_2720684_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_016243934.1|2720677_2721700_-	hydrolase	NA	NA	NA	NA	NA
WP_063079690.1|2721699_2723613_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	7.3e-74
>prophage 191
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2729183	2737117	4917635	transposase	uncultured_Caudovirales_phage(25.0%)	10	NA	NA
WP_001209710.1|2729183_2729570_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|2729569_2729929_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|2729936_2730224_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|2730349_2730724_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|2730820_2731291_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|2731387_2733502_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|2733572_2734757_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000289090.1|2734939_2735134_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_000675515.1|2735206_2735683_+	bacterioferritin	NA	NA	NA	NA	NA
WP_001254932.1|2735965_2737117_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 192
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2755857	2757329	4917635	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004454.1|2755857_2756805_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|2756819_2757329_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 193
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2767837	2771991	4917635		Bacillus_virus(50.0%)	4	NA	NA
WP_063079791.1|2767837_2768596_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.0e-18
WP_016245158.1|2768603_2769707_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_063079792.1|2769716_2770898_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|2770965_2771991_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 194
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2778495	2779380	4917635		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258898.1|2778495_2779380_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 195
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2790700	2791744	4917635		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2790700_2791744_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 196
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2809017	2811542	4917635	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|2809017_2810085_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|2810174_2811542_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 197
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2815507	2817727	4917635	protease,transposase	Pseudomonas_phage(50.0%)	2	NA	NA
WP_000366129.1|2815507_2816005_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_001254932.1|2816575_2817727_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 198
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2821708	2826441	4917635		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|2821708_2823199_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|2823246_2823936_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209004.1|2823932_2824808_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|2824804_2825269_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445157.1|2825328_2826441_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 199
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2833190	2847985	4917635		Staphylococcus_phage(25.0%)	17	NA	NA
WP_016245146.1|2833190_2834120_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|2834215_2836552_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_016245145.1|2836781_2837435_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_063079808.1|2837431_2838160_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|2838156_2838789_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|2839002_2839275_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|2839271_2840126_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|2840171_2840663_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|2840780_2841068_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|2841090_2842524_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|2842571_2843297_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|2843303_2843861_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|2843829_2844405_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|2844401_2844968_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001325168.1|2844988_2845975_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	3.3e-38
WP_000922872.1|2845988_2846966_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|2847175_2847985_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 200
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2852053	2853530	4917635		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|2852053_2852332_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|2852558_2853530_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 201
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2860158	2863031	4917635	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|2860158_2862093_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|2862182_2863031_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 202
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2866322	2872961	4917635		Dickeya_phage(50.0%)	4	NA	NA
WP_000207684.1|2866322_2867666_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|2868296_2868749_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|2868776_2870264_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_063079685.1|2870288_2872961_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 203
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2878441	2880331	4917635		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2878441_2880331_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 204
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2886158	2893952	4917635		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_001397440.1|2886158_2886461_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449451.1|2886511_2886955_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|2886934_2887453_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_016245141.1|2887580_2888216_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147624.1|2888288_2889329_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|2889442_2890018_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|2890027_2890618_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246837.1|2890637_2891033_-	YraN family protein	NA	NA	NA	NA	NA
WP_016245140.1|2890990_2893027_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809253.1|2893091_2893952_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 205
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2901227	2902373	4917635		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|2901227_2902373_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 206
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2912236	2914531	4917635		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2912236_2914531_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 207
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2940686	2941652	4917635		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|2940686_2941652_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 208
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2954307	2966634	4917635	integrase,tRNA	Salmonella_phage(40.0%)	9	2956634:2956648	2966505:2966519
WP_016245109.1|2954307_2957400_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	1.1e-156
2956634:2956648	attL	CGTTCGCCATCAAAC	NA	NA	NA	NA
WP_000212475.1|2957583_2958567_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_032160142.1|2958785_2959118_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627220.1|2959159_2960650_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094682.1|2960956_2962477_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|2962630_2963254_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065895.1|2963530_2964295_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000290292.1|2964591_2965908_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.6	3.9e-34
WP_000268405.1|2966037_2966634_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	86.9	3.6e-96
2966505:2966519	attR	GTTTGATGGCGAACG	NA	NA	NA	NA
>prophage 209
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2974473	2991588	4917635	transposase	Stx2-converting_phage(57.14%)	9	NA	NA
WP_063079919.1|2974473_2976126_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.0	2.9e-39
WP_001243916.1|2976135_2976663_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_103758553.1|2976678_2985918_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.7	1.3e-56
WP_001258403.1|2985917_2986253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993956.1|2987984_2988635_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|2988634_2988982_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|2989001_2990573_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_000624723.1|2990815_2991166_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_063079470.1|2991162_2991588_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
>prophage 210
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	2995133	2998348	4917635		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_000871034.1|2995133_2996687_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	21.5	1.4e-06
WP_000940060.1|2996683_2998348_-	type I restriction-modification system subunit M	NA	A0A1V0SLK8	Klosneuvirus	30.6	4.7e-29
>prophage 211
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3004725	3005888	4917635	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947598.1|3004725_3005888_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 212
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3010275	3012703	4917635	transposase	Wolbachia_phage(50.0%)	2	NA	NA
WP_001286317.1|3010275_3011346_-	cGAMP-activated phospholipase CapV	NA	A0A1B2LRS3	Wolbachia_phage	31.6	1.7e-19
WP_000436075.1|3012277_3012703_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	78.4	3.0e-36
>prophage 213
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3023933	3027742	4917635		Erwinia_phage(33.33%)	5	NA	NA
WP_001255978.1|3023933_3024173_+	hypothetical protein	NA	A0A1B2IAG5	Erwinia_phage	47.5	2.0e-13
WP_000649890.1|3024191_3024674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234708.1|3025032_3025851_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	5.5e-47
WP_137432245.1|3026183_3026885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131518.1|3027277_3027742_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.9	2.9e-13
>prophage 214
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3032297	3037655	4917635	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_000437371.1|3032297_3034139_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3034333_3036079_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3036189_3036405_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|3036641_3037655_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 215
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3040673	3041654	4917635	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_021539078.1|3040673_3041654_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
>prophage 216
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3045236	3046475	4917635	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|3045236_3046475_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 217
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3051612	3053046	4917635		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3051612_3053046_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 218
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3058358	3069320	4917635		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3058358_3059012_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3059272_3059443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314167.1|3059500_3060274_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|3060389_3061205_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3061242_3062403_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3062408_3063080_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3063227_3064709_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3064913_3065543_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3065543_3065966_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3065990_3066818_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3066817_3067399_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|3067427_3069320_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 219
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3074277	3086434	4917635	transposase	Stx_converting_phage(20.0%)	9	NA	NA
WP_000712658.1|3074277_3074670_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_016245096.1|3075748_3078007_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	8.3e-85
WP_000965712.1|3078239_3078977_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|3079051_3080464_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|3080574_3082794_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848522.1|3082836_3083094_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_085947917.1|3083417_3084691_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_063079481.1|3084687_3085407_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|3085606_3086434_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 220
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3092510	3093395	4917635		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3092510_3093395_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 221
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3131968	3133123	4917635		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3131968_3133123_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 222
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3144102	3144780	4917635		Bacillus_virus(100.0%)	1	NA	NA
WP_016245069.1|3144102_3144780_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	2.2e-09
>prophage 223
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3162786	3164019	4917635		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3162786_3164019_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 224
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3172546	3177919	4917635		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_001544984.1|3172546_3175420_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
WP_000951948.1|3175685_3176429_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032359762.1|3176485_3177919_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.5	1.5e-31
>prophage 225
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3181843	3187929	4917635	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
WP_000806650.1|3181843_3182740_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	1.8e-30
WP_016245061.1|3182763_3183474_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813212.1|3183479_3185213_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|3185303_3186401_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|3186411_3187929_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
>prophage 226
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3191347	3192103	4917635		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3191347_3192103_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 227
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3200190	3202685	4917635		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603530.1|3200190_3200952_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.6e-19
WP_000256438.1|3201266_3202685_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 228
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3212316	3219089	4917635		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|3212316_3213030_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|3213098_3213788_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3214472_3215003_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|3215015_3217262_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_016245052.1|3217412_3218288_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|3218294_3219089_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 229
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3224565	3239952	4917635	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001138150.1|3224565_3227454_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
WP_016245049.1|3227446_3230989_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	2.6e-08
WP_000775975.1|3230988_3232815_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	1.6e-25
WP_000237947.1|3232876_3234208_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|3234439_3235693_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|3236272_3237370_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_016245048.1|3237446_3238253_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	4.5e-17
WP_000184252.1|3238303_3238747_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_004985928.1|3238746_3239952_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.0e-73
>prophage 230
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3251477	3252233	4917635		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3251477_3252233_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 231
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3257091	3257940	4917635		Vibrio_phage(100.0%)	1	NA	NA
WP_000100420.1|3257091_3257940_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 232
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3265474	3269589	4917635		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|3265474_3268231_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_016245043.1|3268287_3269589_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.6e-38
>prophage 233
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3273621	3278541	4917635		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|3273621_3275259_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|3275346_3276645_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_052974475.1|3276704_3277577_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288227.1|3277590_3277731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199978.1|3277869_3278541_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 234
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3283136	3283922	4917635		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_063079564.1|3283136_3283922_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 235
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3307968	3310001	4917635		Hokovirus(50.0%)	2	NA	NA
WP_016245025.1|3307968_3309396_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	3.7e-30
WP_001173673.1|3309395_3310001_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 236
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3313113	3316829	4917635		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|3313113_3313875_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3313868_3314495_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_016245024.1|3314634_3315774_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3315836_3316829_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 237
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3322044	3329184	4917635		Escherichia_phage(66.67%)	6	NA	NA
WP_001278994.1|3322044_3322683_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3322679_3323942_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3323938_3324847_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|3325042_3325810_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141339.1|3325860_3326517_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_001289433.1|3326622_3329184_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 238
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3348651	3349665	4917635		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000989159.1|3348651_3349665_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 239
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3357140	3358106	4917635		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|3357140_3358106_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 240
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3363572	3369135	4917635	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_063079670.1|3363572_3364070_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	3.4e-31
WP_000963143.1|3364149_3365211_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|3365453_3365954_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_063079671.1|3366081_3368712_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	2.5e-80
WP_000906486.1|3368949_3369135_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 241
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3382190	3388264	4917635		Bacillus_virus(25.0%)	4	NA	NA
WP_000985494.1|3382190_3383393_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000246570.1|3385494_3387639_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	1.1e-195
WP_000080947.1|3387611_3388022_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|3388018_3388264_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 242
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3392199	3396325	4917635		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|3392199_3392649_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_063079393.1|3392649_3393312_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_063079394.1|3393332_3394733_-	GABA permease	NA	NA	NA	NA	NA
WP_063079268.1|3395044_3396325_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	7.1e-33
>prophage 243
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3408156	3411985	4917635	integrase	Vibrio_phage(33.33%)	3	3392743:3392756	3412295:3412308
3392743:3392756	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_063079157.1|3408156_3408363_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	46.7	3.1e-07
WP_063079169.1|3409478_3410720_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.8	8.5e-100
WP_000162574.1|3411502_3411985_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3412295:3412308	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 244
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3426395	3427466	4917635		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_016244972.1|3426395_3427466_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 245
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3434813	3437387	4917635		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3434813_3437387_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 246
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3443165	3444464	4917635		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3443165_3444464_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 247
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3449757	3455840	4917635	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|3449757_3450177_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3450383_3451421_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|3451468_3452158_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|3452462_3452846_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_063079716.1|3452901_3453489_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_016244967.1|3453591_3454473_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|3454505_3455840_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 248
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3461611	3465354	4917635		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|3461611_3463411_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|3463426_3464401_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|3464673_3465354_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 249
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3468813	3485706	4917635	tRNA,transposase	Bacillus_phage(33.33%)	12	NA	NA
WP_001196283.1|3468813_3469074_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_001013779.1|3469129_3469978_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254932.1|3470397_3471549_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001295367.1|3472069_3472606_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734212.1|3472602_3474159_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_016244964.1|3474416_3478304_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
WP_001297612.1|3478861_3480289_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215861.1|3480453_3481167_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|3481156_3482491_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|3482551_3482890_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_016244963.1|3482934_3484125_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|3484452_3485706_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 250
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3491464	3492976	4917635		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493439.1|3491464_3492976_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	2.8e-12
>prophage 251
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3508112	3514569	4917635		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|3508112_3509327_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|3509354_3509741_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|3509757_3510081_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|3510176_3510692_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_063079958.1|3510708_3512559_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	9.4e-103
WP_001124469.1|3512560_3512896_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|3512907_3513108_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_063079957.1|3513285_3514569_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 252
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3524454	3524886	4917635		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3524454_3524886_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 253
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3533715	3584157	4917635	terminase,tail,transposase,holin,integrase	Escherichia_phage(44.44%)	59	3517593:3517608	3591391:3591406
3517593:3517608	attL	ATGGCGCTCAACGTTA	NA	NA	NA	NA
WP_000937933.1|3533715_3535086_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|3535247_3536714_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|3536782_3538360_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_021517660.1|3538552_3539809_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	5.7e-237
WP_001055435.1|3539811_3540471_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
WP_063079954.1|3540467_3541118_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	97.2	2.3e-125
WP_001341620.1|3541110_3541362_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_063079953.1|3541519_3541768_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	98.8	1.8e-41
WP_000026204.1|3541817_3542840_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	92.6	9.3e-177
WP_053898312.1|3542849_3543749_-	endonuclease	NA	Q858E0	Salmonella_phage	91.0	1.2e-156
WP_001102251.1|3543745_3544045_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	4.9e-46
WP_053898310.1|3544353_3544938_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.0e-104
WP_001282457.1|3545092_3545323_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
WP_063079952.1|3545690_3546506_+	primosomal protein	NA	Q286X4	Escherichia_phage	94.9	1.9e-116
WP_053898324.1|3546502_3547288_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.2	1.3e-151
WP_063079951.1|3547405_3547750_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.2	3.1e-60
WP_063079950.1|3547811_3548390_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	56.2	7.1e-41
WP_063079949.1|3548386_3548932_+	hypothetical protein	NA	J9Q748	Salmonella_phage	85.0	1.2e-85
WP_063079948.1|3548928_3549228_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	8.1e-57
WP_063079947.1|3549637_3549826_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	3.4e-29
WP_000951712.1|3549827_3550037_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_103758556.1|3550033_3551002_+	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	73.2	1.7e-95
WP_074150651.1|3550998_3551301_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	98.0	2.5e-53
WP_063079946.1|3551293_3551575_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	1.3e-48
WP_001129692.1|3551567_3551906_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	5.4e-57
WP_001090120.1|3551946_3552621_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_063079945.1|3552617_3554093_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	3.8e-296
WP_000999689.1|3554183_3554540_-	hypothetical protein	NA	Q716B1	Shigella_phage	75.4	2.7e-43
WP_000335899.1|3555242_3555449_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000852419.1|3555463_3557143_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
WP_001544823.1|3557139_3557436_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
WP_001702500.1|3557438_3558134_+	hypothetical protein	NA	G9L6C4	Escherichia_phage	98.7	8.7e-94
WP_001555618.1|3558148_3559135_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	94.8	3.9e-180
WP_000627079.1|3559186_3559624_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.9	1.7e-71
WP_000012377.1|3559634_3559970_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000424495.1|3560020_3560344_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_001546918.1|3560343_3560949_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	6.2e-112
WP_063079944.1|3560948_3563420_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	99.5	0.0e+00
WP_000568023.1|3563419_3563884_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_000332877.1|3563883_3564459_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_001145644.1|3564458_3567206_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.8	6.2e-119
WP_063079943.1|3567205_3570595_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	37.0	3.6e-185
WP_000723561.1|3570596_3571448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|3571477_3571639_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001555163.1|3571722_3572235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000163643.1|3572221_3572548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525323.1|3572678_3573371_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.6	1.3e-97
WP_110221350.1|3573416_3573503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188252.1|3573684_3573942_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_063079961.1|3575418_3576813_+	hypothetical protein	NA	K4MM73	Escherichia_phage	61.1	7.9e-171
WP_063079942.1|3576820_3577075_+	hypothetical protein	NA	K4MPX1	Escherichia_phage	56.0	1.5e-19
WP_004146394.1|3577202_3577607_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_023339240.1|3577593_3577899_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_063079941.1|3577888_3578518_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	88.5	5.4e-103
WP_063079940.1|3578514_3578997_+	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	93.8	1.5e-73
WP_016244948.1|3579429_3580620_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	53.4	1.9e-117
WP_085947917.1|3580755_3582029_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_063079663.1|3583487_3583670_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-22
WP_001344399.1|3583983_3584157_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
3591391:3591406	attR	ATGGCGCTCAACGTTA	NA	NA	NA	NA
>prophage 254
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3590590	3594592	4917635		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|3590590_3591229_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_063079664.1|3591228_3592266_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.0	2.4e-71
WP_001295473.1|3592590_3593217_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|3593302_3594592_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 255
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3615836	3616550	4917635		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3615836_3616550_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 256
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3623359	3624340	4917635	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_021539078.1|3623359_3624340_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
>prophage 257
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3635796	3636747	4917635		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3635796_3636747_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 258
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3650492	3651644	4917635	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001254932.1|3650492_3651644_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 259
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3656723	3660299	4917635		Deep-sea_thermophilic_phage(50.0%)	5	NA	NA
WP_000102896.1|3656723_3657593_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|3657806_3658232_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_063079338.1|3658218_3658668_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|3658728_3659304_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|3659399_3660299_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
>prophage 260
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3665914	3666706	4917635		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_063079650.1|3665914_3666706_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	3.0e-18
>prophage 261
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3669723	3682376	4917635		Streptococcus_phage(40.0%)	12	NA	NA
WP_063079648.1|3669723_3670821_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
WP_001297645.1|3670954_3671866_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000710493.1|3672054_3672789_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000719924.1|3672821_3673196_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|3673300_3674152_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|3674193_3674703_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|3674743_3676471_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|3676515_3676773_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|3677156_3678128_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|3678312_3679074_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_016244920.1|3679303_3680290_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|3680360_3682376_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 262
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3704076	3704811	4917635		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3704076_3704811_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 263
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3708629	3709550	4917635		Morganella_phage(100.0%)	1	NA	NA
WP_063079818.1|3708629_3709550_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 264
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3713317	3720894	4917635		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283485.1|3713317_3715012_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_016244914.1|3715081_3716026_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|3716099_3717245_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_074150607.1|3717300_3720894_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	2.3e-36
>prophage 265
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3728170	3735023	4917635	integrase,transposase	Enterobacteria_phage(60.0%)	5	3725067:3725083	3737033:3737049
3725067:3725083	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_063079142.1|3728170_3728581_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.0	8.0e-55
WP_001329117.1|3728638_3728812_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.1	2.5e-10
WP_085947917.1|3730234_3731508_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_021526115.1|3732621_3733779_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	1.3e-222
WP_000368131.1|3734090_3735023_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3737033:3737049	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 266
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3752915	3754001	4917635		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|3752915_3754001_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 267
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3762565	3763702	4917635		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|3762565_3763702_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 268
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3770178	3771696	4917635		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|3770178_3771696_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 269
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3775907	3777768	4917635		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|3775907_3776681_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_001625563.1|3776877_3777768_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	1.2e-66
>prophage 270
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3788328	3791556	4917635		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203392.1|3788328_3788979_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
WP_001012899.1|3789065_3790898_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|3790956_3791556_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 271
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3825979	3830983	4917635		Tupanvirus(50.0%)	4	NA	NA
WP_016244890.1|3825979_3827962_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461657.1|3827961_3828930_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_001388277.1|3828933_3830073_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_001297077.1|3830380_3830983_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 272
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3834586	3838902	4917635	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_063079806.1|3834586_3835792_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
WP_001295288.1|3835848_3837138_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992988.1|3837155_3837959_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140570.1|3837999_3838902_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 273
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3845570	3859770	4917635		Pseudomonas_phage(33.33%)	8	NA	NA
WP_063079708.1|3845570_3846647_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|3847108_3847759_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|3847812_3848067_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|3848066_3849197_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075170.1|3849430_3851716_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_063079709.1|3852411_3856146_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	24.6	1.5e-19
WP_000990754.1|3856273_3856996_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|3857142_3859770_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 274
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3873144	3880758	4917635	transposase	Staphylococcus_phage(33.33%)	4	NA	NA
WP_001254932.1|3873144_3874296_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_063079421.1|3874533_3875919_-	acetoacetate metabolism transcriptional regulator AtoC	NA	NA	NA	NA	NA
WP_063079420.1|3875915_3877742_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876014.1|3877908_3880758_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 275
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3885035	3890813	4917635		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865558.1|3885035_3886139_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	6.2e-118
WP_000406103.1|3886250_3887306_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_016244871.1|3887379_3888444_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_063079597.1|3888443_3889094_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	9.9e-07
WP_000422188.1|3889169_3890813_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 276
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3899581	3900199	4917635		Bacillus_virus(100.0%)	1	NA	NA
WP_005136718.1|3899581_3900199_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.0	4.3e-12
>prophage 277
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3915236	3936599	4917635	integrase,transposase	Stx2-converting_phage(27.27%)	26	3902273:3902287	3938008:3938022
3902273:3902287	attL	CCAATCACCGTCGCC	NA	NA	NA	NA
WP_021558665.1|3915236_3915746_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	61.8	1.1e-42
WP_021558666.1|3916077_3916365_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_063079369.1|3916361_3916898_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	37.0	1.5e-08
WP_063079368.1|3916934_3917360_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_096111108.1|3917356_3918100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993956.1|3918396_3919047_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|3919046_3919394_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|3919413_3920985_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_063079361.1|3921043_3922450_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	55.9	9.6e-108
WP_063079360.1|3922446_3922746_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021558672.1|3922751_3922985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061892447.1|3922977_3923211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063079359.1|3923183_3923444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074151405.1|3923433_3924405_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000447941.1|3924424_3924631_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000465857.1|3924801_3925044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101918.1|3925160_3926402_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.8	5.0e-100
WP_000256200.1|3926762_3928523_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001135667.1|3928542_3928770_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050789.1|3928951_3929959_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|3930097_3930382_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|3930506_3932267_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|3932415_3933111_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|3933138_3934329_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|3934661_3935006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194879.1|3935009_3936599_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
3938008:3938022	attR	CCAATCACCGTCGCC	NA	NA	NA	NA
>prophage 278
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3942353	3949885	4917635	transposase	Clostridioides_phage(33.33%)	7	NA	NA
WP_000241011.1|3942353_3942920_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|3943331_3944045_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|3944083_3945070_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_063079407.1|3945187_3946654_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	6.6e-43
WP_001136827.1|3946876_3947449_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000389030.1|3947603_3947858_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001254932.1|3948733_3949885_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 279
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3961965	3962823	4917635		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|3961965_3962823_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 280
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3966893	3968885	4917635		Acinetobacter_phage(100.0%)	1	NA	NA
WP_061349451.1|3966893_3968885_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 281
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3974234	3974903	4917635		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|3974234_3974903_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 282
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3978597	3980118	4917635		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_063079539.1|3978597_3980118_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	4.5e-10
>prophage 283
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	3988906	3989887	4917635	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_021539078.1|3988906_3989887_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
>prophage 284
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4002326	4011767	4917635		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569356.1|4002326_4003253_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|4003257_4003989_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4003969_4004077_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4004136_4004868_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4005089_4006775_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4006771_4007491_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|4007537_4008008_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|4008047_4008509_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_063079780.1|4008633_4010634_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292769.1|4010630_4011767_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 285
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4023399	4025433	4917635	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|4023399_4025433_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 286
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4039411	4040416	4917635		Serratia_phage(100.0%)	1	NA	NA
WP_000846245.1|4039411_4040416_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	9.9e-14
>prophage 287
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4050429	4053808	4917635		Catovirus(50.0%)	2	NA	NA
WP_000807362.1|4050429_4051329_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_158649909.1|4053052_4053808_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	34.6	6.3e-05
>prophage 288
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4075461	4103311	4917635	bacteriocin,integrase,transposase	Stx2-converting_phage(25.0%)	31	4070739:4070798	4113591:4114359
4070739:4070798	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000993956.1|4075461_4076112_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|4076111_4076459_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|4076478_4078050_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_063096957.1|4078093_4078813_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845915.1|4078809_4079244_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117157.1|4079312_4081280_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	8.1e-20
WP_000006015.1|4081343_4081577_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290797.1|4081634_4082162_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	3.0e-46
WP_042634651.1|4082995_4083559_-	class I SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	3.5e-16
WP_063079204.1|4083605_4084967_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|4085018_4085249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634741.1|4086281_4086473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001613000.1|4086469_4086892_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001671341.1|4086938_4087241_-	antirestriction protein	NA	NA	NA	NA	NA
WP_103758564.1|4087336_4087909_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_001398215.1|4088603_4089158_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104869.1|4089051_4089273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074150441.1|4089273_4089756_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	39.9	9.2e-18
WP_001254932.1|4089824_4090976_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_063074623.1|4091256_4091550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959884.1|4091697_4092660_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000361384.1|4092662_4093013_+	protein stbB	NA	NA	NA	NA	NA
WP_001027529.1|4093163_4093676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282376.1|4094116_4095652_+|bacteriocin	pore-forming bacteriocin colicin B	bacteriocin	NA	NA	NA	NA
WP_000203267.1|4095669_4096197_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_085949152.1|4096492_4097766_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_032340917.1|4097784_4098591_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|4098640_4098994_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001164199.1|4099166_4099949_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465043.1|4099950_4100364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158649909.1|4102555_4103311_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	34.6	6.3e-05
4113591:4114359	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCTATAAAAGCGTTGTTTTTTATTATGATTTTCTCAGCACCAATACATATAATATAGAGGGAATCAAAATAAAGATTCCCTCTATGCTTTTTAATAACATCCAGCACAGGCAGGATTACAACAAAGTTCACAGCAGTAAAATGTGTTGTTCATATTTTCTGATTTTTTTTCACTGTTGTTTTTTACAACATCACACTTTTTAGTCTCTAATGTAATTTTCTCTTTTGAAGAGTCAAGTGATTCAGTTGACTGACTAAAAGAGGGGAAAGATAATACAGAAATAAAAATTGCCAACATTAGCTTTTTCATGTTACCTCCCGTCATGTTGTTTCACGGATATTTGAGATTAGTTAAACGGATTTTGCAATTTTTTTATTTTTTTTTGTGAGTTGCATCATGTTATATGTCGAGGTGCACTCGCTTTTTATATATTATTTTCATAGTGTTATATATGTTAATTGTCTGGCTATCTGGTTTTTTTTACTATCAATATCATATTAAGTGATGGTTTTATCCTTTTCTTGTTCGGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTT	NA	NA	NA	NA
>prophage 289
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4115672	4121523	4917635	tRNA	Bacillus_phage(66.67%)	4	NA	NA
WP_063079308.1|4115672_4117034_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_001300972.1|4118877_4119210_-	YegP family protein	NA	NA	NA	NA	NA
WP_063079309.1|4119400_4120123_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	2.4e-30
WP_063079310.1|4120119_4121523_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 290
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4134966	4136319	4917635		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_063079551.1|4134966_4136319_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.4	1.0e-05
>prophage 291
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4141822	4148994	4917635		Catovirus(20.0%)	7	NA	NA
WP_001295424.1|4141822_4142464_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001741947.1|4142555_4143137_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	3.6e-32
WP_063079387.1|4143158_4145012_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_063079388.1|4145064_4145355_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001227701.1|4145344_4145683_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_063079389.1|4145757_4147341_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	1.6e-34
WP_024177909.1|4148103_4148994_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	2.5e-45
>prophage 292
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4164946	4174304	4917635	transposase	Escherichia_phage(37.5%)	8	NA	NA
WP_125269812.1|4164946_4165186_+	hypothetical protein	NA	K4MM73	Escherichia_phage	50.6	1.5e-16
WP_063079644.1|4166342_4167749_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.1	2.5e-39
WP_039268428.1|4167967_4169032_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.3e-104
WP_039268427.1|4169045_4169915_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_039268426.1|4169946_4170837_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	1.3e-28
WP_063079645.1|4170851_4171406_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.8	6.6e-52
WP_063079646.1|4171584_4172751_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	53.2	2.7e-108
WP_001254932.1|4173152_4174304_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 293
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4178400	4183311	4917635		Hokovirus(33.33%)	4	NA	NA
WP_021570144.1|4178400_4179816_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.9	1.8e-53
WP_000192834.1|4179839_4181222_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.2	1.1e-31
WP_001310941.1|4181227_4182013_+	O9 family O-antigen ABC transporter permease subunit Wzm	NA	NA	NA	NA	NA
WP_000025034.1|4182015_4183311_+	O9 family O-antigen ABC transporter ATP-binding protein Wzt	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.5e-14
>prophage 294
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4196476	4197376	4917635		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|4196476_4197376_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 295
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4205021	4253772	4917635	transposase	Stx2-converting_phage(30.77%)	35	NA	NA
WP_001446926.1|4205021_4206188_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	1.9e-226
WP_021571894.1|4206306_4206780_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200895.1|4206977_4208036_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|4208207_4208537_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_063079555.1|4208637_4208772_-	propanediol utilization protein	NA	NA	NA	NA	NA
WP_000381442.1|4208814_4210386_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_000624618.1|4210405_4210753_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000993956.1|4210752_4211403_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_103758567.1|4213338_4214612_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.3e-177
WP_063079228.1|4214655_4214838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854760.1|4214834_4215212_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|4215301_4215670_-	antitoxin	NA	NA	NA	NA	NA
WP_063079229.1|4215832_4216054_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
WP_001186774.1|4216116_4216593_-	RadC family protein	NA	NA	NA	NA	NA
WP_063079232.1|4216608_4217082_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_063079230.1|4217423_4218242_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_001323397.1|4218396_4218555_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_103758568.1|4218625_4221472_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_103758569.1|4221844_4222717_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000881502.1|4223719_4224652_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000973199.1|4225575_4226121_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001333892.1|4226117_4226861_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_020239704.1|4226872_4227952_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986345.1|4228013_4228949_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011023.1|4230424_4231375_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_103758570.1|4232372_4233070_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	4.0e-131
WP_103758571.1|4234415_4235112_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	1.1e-131
WP_000532923.1|4235318_4236035_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060231.1|4236377_4237832_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_020239326.1|4237933_4239250_-	shikimate transporter	NA	NA	NA	NA	NA
WP_063079530.1|4239564_4240617_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|4249349_4250147_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001394427.1|4250899_4251307_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.4e-56
WP_103758572.1|4251328_4252477_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|4252499_4253772_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 296
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4257532	4267748	4917635	transposase	Burkholderia_phage(28.57%)	9	NA	NA
WP_001340597.1|4257532_4258204_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000826783.1|4258203_4259562_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001581832.1|4259669_4260521_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_063079212.1|4261112_4262171_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.1	3.3e-92
WP_021539078.1|4262743_4263724_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
WP_024191499.1|4264774_4265077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365560.1|4265116_4265812_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.4e-06
WP_001157281.1|4265878_4267297_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.8	9.4e-103
WP_000786003.1|4267277_4267748_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
>prophage 297
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4288860	4290780	4917635	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_103758573.1|4288860_4290069_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.1e-208
WP_000334581.1|4290108_4290780_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	4.8e-81
>prophage 298
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4302552	4303305	4917635		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4302552_4303305_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 299
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4316073	4317588	4917635		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187813.1|4316073_4317588_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 300
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4327676	4333320	4917635		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_016244771.1|4327676_4329338_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_063079905.1|4329383_4330985_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.9	6.8e-17
WP_063079904.1|4331003_4331864_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|4331866_4332916_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|4332930_4333320_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 301
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4338572	4434039	4917635	tRNA,portal,capsid,head,protease,transposase,tail,plate,integrase	Enterobacteria_phage(19.23%)	111	4348878:4348898	4394137:4394157
WP_063079901.1|4338572_4340306_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	1.2e-86
WP_001300190.1|4340521_4341088_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|4341101_4341848_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214309.1|4342235_4343336_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176827.1|4343360_4345790_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564746.1|4345954_4346926_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019590.1|4346922_4347666_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252979.1|4347706_4348102_-	membrane protein	NA	NA	NA	NA	NA
WP_050582975.1|4348154_4348934_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
4348878:4348898	attL	CACGCAGTTAAAGTGGCGGGC	NA	NA	NA	NA
WP_063079900.1|4348930_4350190_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	89.7	2.5e-224
WP_023283988.1|4350232_4350478_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
WP_063079899.1|4350481_4350697_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.4	2.0e-12
WP_023304908.1|4350698_4350917_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.6e-09
WP_063079898.1|4350913_4351759_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	63.7	1.4e-130
WP_063079897.1|4351755_4352412_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	2.3e-112
WP_023283323.1|4352408_4352567_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_063079896.1|4352563_4353244_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	91.2	4.1e-120
WP_061357275.1|4353240_4354086_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.5e-68
WP_016529276.1|4354101_4354386_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_061357274.1|4354393_4355365_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	2.5e-38
WP_019704100.1|4355452_4355647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048986758.1|4356074_4356278_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.2e-19
WP_052921344.1|4356323_4357142_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_046653794.1|4357138_4357963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178801.1|4358130_4358250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032443189.1|4358272_4358971_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	1.8e-107
WP_004201115.1|4359082_4359310_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|4359350_4359572_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_029363675.1|4359657_4360512_+	replication protein	NA	K7PGT1	Enterobacteria_phage	54.5	4.8e-62
WP_063079895.1|4360496_4361366_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.7	2.6e-95
WP_012542626.1|4361362_4361656_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_052921347.1|4362064_4362634_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	39.3	3.9e-07
WP_052921348.1|4362626_4362866_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	5.0e-09
WP_052921349.1|4362949_4363132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269997.1|4363128_4363392_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
WP_001548464.1|4363498_4364095_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	1.2e-56
WP_024194779.1|4364303_4364594_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
WP_029363688.1|4364590_4364953_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
WP_001548467.1|4364949_4365090_+	YlcG family protein	NA	NA	NA	NA	NA
WP_053290030.1|4365086_4365776_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	4.5e-58
WP_004146347.1|4366855_4367170_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_063079894.1|4367172_4367676_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	80.2	5.0e-75
WP_063079893.1|4367672_4368062_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	50.4	7.7e-23
WP_063079906.1|4368231_4368792_-|protease	Clp protease	protease	NA	NA	NA	NA
WP_029394712.1|4368941_4369580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021571825.1|4369827_4370391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021571826.1|4370332_4372459_+	hypothetical protein	NA	A0A0C5ABH4	Bacteriophage	35.0	2.3e-97
WP_000483310.1|4372467_4372731_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_021543304.1|4372730_4374365_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.1	2.6e-88
WP_021543305.1|4374361_4375228_+	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	48.1	1.4e-48
WP_021543306.1|4375229_4375820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543307.1|4375819_4376227_+|head	head decoration protein	head	NA	NA	NA	NA
WP_021543308.1|4376325_4377375_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	34.0	1.2e-51
WP_021543309.1|4377376_4377754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543310.1|4377758_4378118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543311.1|4378114_4378660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543312.1|4378662_4378848_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_021543313.1|4378844_4380356_+	hypothetical protein	NA	B5TK67	Pseudomonas_phage	44.6	4.1e-104
WP_063079443.1|4380359_4380731_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000818812.1|4380732_4381011_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_063079442.1|4381152_4383006_+	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	3.1e-21
WP_063079441.1|4383052_4384453_+	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
WP_000102291.1|4384449_4385535_+|tail	tail protein	tail	Q8SBG7	Shigella_phage	30.7	3.3e-39
WP_063079440.1|4385531_4386113_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_063079439.1|4386109_4386559_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	41.2	5.6e-17
WP_063079438.1|4386548_4387697_+|plate	baseplate J/gp47 family protein	plate	J9QE72	Clostridium_phage	29.8	2.4e-08
WP_021543317.1|4387693_4388368_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_103758575.1|4388394_4389180_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_063079195.1|4389158_4390250_-	acyltransferase	NA	NA	NA	NA	NA
WP_103758576.1|4391960_4393122_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_063079574.1|4393161_4393680_+	hypothetical protein	NA	A0A2H4N7C5	Pectobacterium_phage	34.1	1.2e-15
WP_063079573.1|4393785_4394004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000891610.1|4394228_4394795_-	hydrolase	NA	NA	NA	NA	NA
4394137:4394157	attR	CACGCAGTTAAAGTGGCGGGC	NA	NA	NA	NA
WP_001258662.1|4395104_4396877_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|4396994_4397447_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|4397475_4398216_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|4398250_4398772_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_063079572.1|4398773_4399376_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|4399445_4399511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4399649_4400261_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|4400269_4401280_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|4401523_4402309_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|4402305_4403061_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|4403139_4404072_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184054.1|4404087_4405410_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_016244712.1|4405529_4406501_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|4406632_4408075_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|4408202_4409072_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301727.1|4409409_4410885_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_016244710.1|4411119_4412931_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_016244709.1|4412967_4413609_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_016244708.1|4413664_4414843_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|4414976_4415267_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|4415333_4415690_+	protein YebF	NA	NA	NA	NA	NA
WP_063079378.1|4416016_4416676_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_016244707.1|4416884_4418945_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|4418941_4419604_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|4419627_4420284_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|4420385_4420616_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|4420754_4421129_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879298.1|4421132_4422005_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|4422017_4422359_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|4422754_4423411_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|4423411_4423603_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|4423707_4423944_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_024191489.1|4424061_4425501_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_063079727.1|4425580_4428214_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|4428182_4429466_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_016244705.1|4430190_4430898_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|4430917_4432966_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|4433157_4434039_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 302
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4438296	4438506	4917635		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4438296_4438506_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 303
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4444146	4445703	4917635		Moraxella_phage(100.0%)	1	NA	NA
WP_016244701.1|4444146_4445703_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 304
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4449565	4457671	4917635	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000855020.1|4449565_4450927_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|4451000_4451180_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|4451299_4451659_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_039066042.1|4452020_4452365_-	RidA family protein	NA	NA	NA	NA	NA
WP_016244699.1|4452496_4454407_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	5.9e-92
WP_001220987.1|4454464_4455160_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|4455199_4455781_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_077788458.1|4455985_4457671_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	4.5e-35
>prophage 305
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4472423	4477000	4917635		Bacillus_phage(100.0%)	3	NA	NA
WP_063079800.1|4472423_4473914_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.0	1.2e-07
WP_000616421.1|4474094_4475570_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_063079799.1|4475716_4477000_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 306
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4480318	4481173	4917635		Indivirus(100.0%)	1	NA	NA
WP_001186345.1|4480318_4481173_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 307
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4490763	4494849	4917635		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723724.1|4490763_4491744_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
WP_063079738.1|4491880_4492639_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032207957.1|4492756_4494115_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135075.1|4494207_4494849_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 308
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4499775	4501737	4917635		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|4499775_4501737_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 309
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4507335	4507989	4917635		Planktothrix_phage(100.0%)	1	NA	NA
WP_001299561.1|4507335_4507989_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
>prophage 310
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4514753	4515974	4917635		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|4514753_4515974_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 311
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4523439	4524267	4917635		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|4523439_4524267_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 312
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4528020	4530282	4917635		Tupanvirus(100.0%)	1	NA	NA
WP_063079298.1|4528020_4530282_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 313
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4542355	4560191	4917635	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_001144192.1|4542355_4544284_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|4544287_4544830_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|4544926_4545124_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|4545176_4545533_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|4545655_4545700_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|4545982_4546966_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_016244669.1|4546980_4549368_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|4549372_4549672_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956529.1|4549772_4550753_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|4550815_4551367_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|4551366_4552116_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_063079607.1|4552193_4552658_+	endopeptidase	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001299570.1|4552904_4553618_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_063079608.1|4553680_4555117_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|4555120_4555312_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|4555443_4556490_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_016244666.1|4556646_4557480_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_063079609.1|4557812_4560191_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.2e-171
>prophage 314
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4573271	4578355	4917635		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|4573271_4573640_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|4573648_4575136_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|4575145_4575892_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_016244657.1|4575866_4577138_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144563.1|4577134_4578355_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 315
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4589641	4590454	4917635		Edwardsiella_phage(100.0%)	1	NA	NA
WP_000587555.1|4589641_4590454_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 316
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4595958	4604749	4917635		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|4595958_4596600_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|4596639_4597788_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182363.1|4598078_4599290_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|4599402_4600335_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|4600331_4601357_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|4601655_4601745_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_063079549.1|4601910_4603080_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|4603225_4603807_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_063079548.1|4603933_4604749_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 317
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4613551	4615050	4917635		Indivirus(50.0%)	2	NA	NA
WP_016244651.1|4613551_4614448_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|4614528_4615050_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 318
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4621226	4622501	4917635	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|4621226_4622501_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 319
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4642376	4644188	4917635		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|4642376_4644188_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 320
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4654083	4655385	4917635		Bacillus_phage(100.0%)	1	NA	NA
WP_000732526.1|4654083_4655385_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	5.5e-17
>prophage 321
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4665485	4772239	4917635	portal,protease,lysis,tail,transposase,integrase	Enterobacteria_phage(33.33%)	99	4673838:4673854	4693789:4693805
WP_001260857.1|4665485_4666307_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4666406_4666490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|4666582_4666918_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|4668091_4669345_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|4669451_4670345_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4670479_4671700_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4671824_4672520_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|4672472_4673765_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
4673838:4673854	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_063079528.1|4673923_4674538_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.5e-28
WP_000526492.1|4674580_4675435_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4675436_4676054_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_074150575.1|4676064_4678488_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
WP_000041688.1|4678548_4680975_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	2.0e-214
WP_001295396.1|4681173_4681479_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_074150519.1|4681586_4682297_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|4682299_4682860_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|4682894_4683236_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4683370_4683697_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_032239025.1|4683902_4685117_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	9.0e-46
WP_016244636.1|4685128_4686148_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001389342.1|4686205_4686334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|4686335_4687616_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|4687650_4687887_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_103758577.1|4687974_4690383_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.3e-59
WP_103758513.1|4690455_4691152_+|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	5.2e-131
WP_000066484.1|4691292_4691508_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|4692261_4692477_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189918.1|4692481_4692793_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_001092966.1|4692789_4693323_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|4693319_4693817_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
4693789:4693805	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|4694180_4694393_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|4694403_4694592_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|4694739_4694895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|4695067_4695241_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|4695536_4695743_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000993956.1|4696245_4696896_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_000624618.1|4696895_4697243_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|4697262_4698834_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_000421825.1|4700340_4700880_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001072975.1|4702983_4703196_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985945.1|4703195_4704704_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.8	7.8e-289
WP_077879669.1|4704648_4706676_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|4706762_4707086_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4707078_4707354_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677132.1|4707365_4707944_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079419.1|4707940_4708342_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_001774465.1|4708352_4709096_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	9.5e-131
WP_001774464.1|4709156_4709543_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	6.4e-62
WP_001161009.1|4709551_4709881_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_063079475.1|4709852_4712918_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447253.1|4712917_4713247_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152409.1|4713256_4713955_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000194781.1|4713960_4714704_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_143212325.1|4714640_4715273_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_103758579.1|4715333_4718732_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	87.5	0.0e+00
WP_089633757.1|4718798_4719398_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.0	5.9e-107
WP_103758580.1|4719462_4723065_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	97.9	0.0e+00
WP_063079167.1|4723336_4723927_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	9.5e-25
WP_000836768.1|4724243_4724477_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4724545_4724659_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_063079166.1|4725715_4727158_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	6.5e-43
WP_000214712.1|4727192_4727396_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_103758513.1|4727592_4728290_-|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	5.2e-131
WP_000215549.1|4728348_4729035_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|4729123_4729870_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_016244629.1|4730006_4732052_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_016244628.1|4732095_4732614_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_063079771.1|4732889_4733282_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592826.1|4733536_4734427_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000901367.1|4734645_4734741_-	protein MgtS	NA	NA	NA	NA	NA
WP_063079770.1|4734867_4735968_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_016244624.1|4735970_4737329_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_016244623.1|4737353_4738793_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	9.7e-31
WP_000803659.1|4738849_4739068_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|4739099_4739483_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|4739502_4739937_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_063079769.1|4740148_4740814_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_016244622.1|4740838_4742029_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_063079768.1|4742178_4743294_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366497.1|4743370_4744252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063079767.1|4744352_4745741_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|4745804_4746731_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191027.1|4746730_4747090_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_063079766.1|4747228_4748647_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.0	6.5e-19
WP_063079765.1|4748873_4750325_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000637082.1|4750531_4751446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286597.1|4751449_4752208_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|4752264_4752555_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774189.1|4752578_4753454_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_063079764.1|4753480_4754503_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222721.1|4754514_4755507_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911182.1|4755506_4756535_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_016244613.1|4756528_4758064_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000154339.1|4758312_4759266_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_063079763.1|4759344_4760937_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_063079762.1|4761467_4766888_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.1	7.9e-142
WP_001296726.1|4767096_4767363_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125461.1|4767362_4768685_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_085947917.1|4770965_4772239_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 322
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4786587	4789179	4917635		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_063079206.1|4786587_4789179_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	1.4e-16
>prophage 323
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4794454	4798261	4917635		Bacillus_virus(50.0%)	2	NA	NA
WP_000426272.1|4794454_4795837_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_074150513.1|4795861_4798261_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 324
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4802577	4804483	4917635		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193521.1|4802577_4803564_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.7e-18
WP_001285541.1|4803556_4804483_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
>prophage 325
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4807756	4809197	4917635		Tupanvirus(50.0%)	2	NA	NA
WP_063079374.1|4807756_4808767_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	2.5e-25
WP_000781370.1|4808912_4809197_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 326
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4815209	4815458	4917635		Enterobacteria_phage(100.0%)	1	NA	NA
WP_063079239.1|4815209_4815458_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	66.2	2.2e-23
>prophage 327
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4821795	4823340	4917635		Escherichia_phage(100.0%)	1	NA	NA
WP_016244602.1|4821795_4823340_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 328
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4833620	4835729	4917635		Ralstonia_phage(100.0%)	1	NA	NA
WP_103758583.1|4833620_4835729_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.4	8.1e-26
>prophage 329
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4841413	4843516	4917635		Salmonella_phage(100.0%)	1	NA	NA
WP_063079283.1|4841413_4843516_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	6.2e-135
>prophage 330
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4848555	4849365	4917635		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867982.1|4848555_4849365_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 331
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4852746	4862920	4917635	transposase	Mycoplasma_phage(20.0%)	10	NA	NA
WP_000220411.1|4852746_4853760_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_063079343.1|4853777_4854923_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063079344.1|4855167_4856574_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|4856652_4857069_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|4857114_4857291_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_074150579.1|4857512_4857743_+	DUF2554 family protein	NA	NA	NA	NA	NA
WP_001619413.1|4857834_4859796_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_016244590.1|4859868_4860405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001326689.1|4860457_4861672_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826402.1|4861711_4862920_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	7.8e-207
>prophage 332
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4874731	4875680	4917635		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|4874731_4874905_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|4875149_4875680_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 333
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4879619	4883522	4917635		Klosneuvirus(100.0%)	1	NA	NA
WP_063079658.1|4879619_4883522_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 334
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4887117	4888269	4917635	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001254932.1|4887117_4888269_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 335
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4893890	4894880	4917635		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|4893890_4894880_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 336
NZ_CP024978	Escherichia coli strain CV839-15 chromosome, complete genome	4917635	4899840	4916371	4917635	tail	Escherichia_phage(50.0%)	13	NA	NA
WP_000837924.1|4899840_4900974_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|4901114_4901549_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000286867.1|4902133_4903048_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983721.1|4903047_4903875_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_063079542.1|4903871_4904729_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968131.1|4904725_4905583_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_103758584.1|4905978_4909755_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	78.2	0.0e+00
WP_103758585.1|4909819_4910419_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.8e-108
WP_103758586.1|4910487_4913967_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_000090891.1|4914026_4914659_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_103758587.1|4914595_4915339_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001499538.1|4915343_4916042_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	3.3e-133
WP_000847402.1|4916041_4916371_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
>prophage 1
NZ_CP024976	Escherichia coli strain CV839-15 plasmid pCV839-15-p2, complete sequence	195578	85940	119249	195578	transposase	Stx2-converting_phage(50.0%)	32	NA	NA
WP_000993956.1|85940_86591_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_000624618.1|86590_86938_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|86957_88529_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_089565019.1|88798_88960_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000993956.1|89335_89986_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_000624618.1|89985_90333_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|90352_91924_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_001234485.1|92685_93507_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.5	7.7e-41
WP_000243702.1|93802_94405_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151524.1|94725_95109_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283385.1|95295_95985_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_063079194.1|96083_96479_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000994782.1|96511_96877_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012126.1|96891_97203_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399792.1|97224_97791_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|97801_98506_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_103758515.1|99054_99795_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.3	4.6e-08
WP_063079260.1|99849_100410_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_063079259.1|100544_100757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063079258.1|101267_101579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|101979_102129_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083845.1|102412_102670_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001375168.1|102903_102978_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000079923.1|104747_105017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|105013_105295_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_063079397.1|105334_105898_+	hypothetical protein	NA	K7RFY5	Vibrio_phage	43.8	4.7e-13
WP_000427623.1|106184_107189_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_157895655.1|108889_109081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029488841.1|109666_110476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074150541.1|110846_112040_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.5	3.2e-51
WP_097476783.1|115923_116946_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.7e-199
WP_085949006.1|118036_119249_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	4.9e-169
>prophage 2
NZ_CP024976	Escherichia coli strain CV839-15 plasmid pCV839-15-p2, complete sequence	195578	185140	191997	195578	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_103758513.1|185140_185837_+|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	5.2e-131
WP_077879640.1|186975_187188_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	83.9	7.8e-22
WP_089565020.1|187136_187841_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000993956.1|187969_188620_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_000624618.1|188619_188967_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381442.1|188986_190558_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_000977522.1|191412_191997_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	39.8	7.7e-11
