The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	0	5177	5036925		Mycobacterium_phage(100.0%)	7	NA	NA
WP_001258810.1|708_2115_+	chitoporin	NA	NA	NA	NA	NA
WP_000733579.1|2164_2491_+	chitosugar-induced verified lipoprotein	NA	NA	NA	NA	NA
WP_000131702.1|2574_3021_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_001406816.1|3013_3100_-	fur leader peptide	NA	NA	NA	NA	NA
WP_001018618.1|3309_3840_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_024187969.1|3979_4273_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_021523820.1|4412_5177_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	4.9e-05
>prophage 2
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	11832	23665	5036925		Hokovirus(40.0%)	10	NA	NA
WP_000186082.1|11832_12510_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001313659.1|12506_15191_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001467928.1|15183_15756_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_021523821.1|15764_17813_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	2.1e-26
WP_001682707.1|17835_19509_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001365534.1|19508_19598_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424789.1|19910_20117_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075783.1|20217_20727_+	YbgA family protein	NA	NA	NA	NA	NA
WP_021523822.1|20723_22142_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	6.8e-61
WP_001032722.1|22183_23665_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 3
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	27043	27835	5036925		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114006.1|27043_27835_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	7.5e-09
>prophage 4
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	55231	58751	5036925		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|55231_55951_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951271.1|55947_56889_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000784342.1|57002_57383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001357154.1|57698_58751_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	48.8	1.7e-80
>prophage 5
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	63114	69690	5036925		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|63114_64131_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_021523829.1|64393_65866_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_021548009.1|65933_66722_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|66850_67000_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_000113014.1|67166_67940_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604037.1|67939_68629_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891671.1|68631_69690_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	9.7e-20
>prophage 6
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	80001	82531	5036925	transposase	Phage_Gifsy-1(50.0%)	2	NA	NA
WP_000817269.1|80001_81132_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
WP_021523832.1|81226_82531_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.7e-18
>prophage 7
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	88858	89767	5036925		Streptococcus_phage(100.0%)	1	NA	NA
WP_001304790.1|88858_89767_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 8
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	100365	112028	5036925		Anomala_cuprea_entomopoxvirus(20.0%)	9	NA	NA
WP_100272920.1|100365_102102_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	3.0e-18
WP_001295890.1|103092_103764_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007119.1|103992_105354_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_021523836.1|105890_108041_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000386565.1|108068_109031_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000253506.1|109171_110257_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|110485_110746_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|111010_111277_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990167.1|111350_112028_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	6.9e-19
>prophage 9
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	118591	123818	5036925		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|118591_119314_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|119310_119970_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|120108_120855_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100799.1|121258_121762_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	6.5e-06
WP_021523840.1|122062_122950_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|123184_123250_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|123302_123818_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 10
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	128814	135698	5036925		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|128814_130407_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114252.1|130606_131422_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209353.1|131567_134000_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001313683.1|134005_134905_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001313684.1|135035_135698_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	4.3e-26
>prophage 11
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	138913	140785	5036925		Planktothrix_phage(100.0%)	1	NA	NA
WP_021523842.1|138913_140785_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.3	3.4e-15
>prophage 12
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	152119	153322	5036925		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|152119_153322_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 13
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	161880	171020	5036925		Vibrio_phage(25.0%)	11	NA	NA
WP_001195230.1|161880_162138_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|162297_162585_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_100272922.1|162568_163291_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|163351_164254_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|164341_164818_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126098.1|165167_166280_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996010.1|166374_167508_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105415.1|167517_168462_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|168458_169304_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|169363_169852_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149694.1|169892_171020_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
>prophage 14
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	174145	176883	5036925		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|174145_174874_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001313703.1|175091_175607_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|175732_176056_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|176052_176883_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 15
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	180470	182189	5036925		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815372.1|180470_182189_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 16
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	191485	215209	5036925	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188147.1|191485_193432_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|193504_193729_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|194051_194372_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|194402_196679_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|197364_197583_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|197867_198572_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202198.1|198613_200335_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043638.1|200335_202102_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_024187964.1|202224_203190_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	6.5e-63
WP_000228473.1|203733_204228_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_100272923.1|204362_208391_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|208549_209161_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|209171_210515_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|210605_211898_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850284.1|212136_214581_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	4.6e-222
WP_000213106.1|214591_215209_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	61.1	1.3e-77
>prophage 17
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	218294	221509	5036925		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|218294_219035_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|219226_221509_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 18
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	225607	226696	5036925		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057124.1|225607_226696_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
>prophage 19
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	231783	236323	5036925		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|231783_232068_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705728.1|232273_234538_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|234574_236323_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 20
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	251028	261831	5036925	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|251028_251577_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|251603_252251_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|252300_253491_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_021523905.1|253681_254770_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	7.0e-98
WP_000117881.1|255372_256773_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001298298.1|256941_258144_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_021523906.1|258409_261022_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	1.2e-18
WP_021523907.1|261063_261831_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	8.3e-29
>prophage 21
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	270586	272494	5036925		Tupanvirus(100.0%)	1	NA	NA
WP_000053063.1|270586_272494_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 22
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	285092	287147	5036925		Bacillus_phage(100.0%)	1	NA	NA
WP_021523911.1|285092_287147_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	3.8e-20
>prophage 23
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	291381	357610	5036925	terminase,lysis,protease,portal,holin,integrase	Enterobacteria_phage(41.54%)	88	283880:283896	324042:324058
283880:283896	attL	TGACCGTTGGCGAGAGC	NA	NA	NA	NA
WP_000375136.1|291381_292041_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001058323.1|292760_293879_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_100272925.1|293875_295669_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186413.1|295687_296395_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003644.1|296391_296979_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063964.1|296975_297374_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004917.1|297370_298228_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_021537876.1|298361_299906_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460803.1|299917_301054_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|301066_301159_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_021523915.1|301238_302549_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000087763.1|302536_302749_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|303034_303247_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|303257_303446_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|303420_303651_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|303640_303814_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_021523916.1|303862_304936_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054737.1|305018_307751_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.4e-38
WP_000533660.1|307845_308919_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	9.0e-199
WP_001303849.1|308896_309115_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545737.1|309154_309322_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000002113.1|309394_309679_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	5.4e-50
WP_000208021.1|309671_310295_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.8	1.8e-53
WP_000582230.1|310305_311061_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	1.4e-142
WP_001289944.1|311062_311707_-	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	98.3	2.6e-60
WP_001350881.1|311703_311913_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	98.6	2.0e-33
WP_001214454.1|311924_312092_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_001111288.1|312102_312399_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_000073093.1|312422_313010_-	hypothetical protein	NA	G9L666	Escherichia_phage	97.9	6.0e-104
WP_015674620.1|313006_313687_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	99.6	1.0e-126
WP_000613346.1|313695_313884_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_015674621.1|313880_313994_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	97.3	1.0e-12
WP_001198858.1|313986_314127_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000095087.1|314348_314972_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	95.7	2.3e-106
WP_000088206.1|315033_315306_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	1.7e-40
WP_000438344.1|315283_315466_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	8.2e-28
WP_001081279.1|315750_316680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522969.1|316676_317222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274754.1|317341_318055_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	95.4	6.8e-126
WP_000437875.1|318155_318356_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_034169236.1|318494_318791_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	98.0	2.0e-47
WP_000166207.1|318823_318970_+	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000067068.1|318962_319823_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	4.3e-159
WP_100272926.1|319930_321811_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.2	0.0e+00
WP_021561742.1|321893_322505_+	HNH endonuclease	NA	A0A2I6PIF0	Escherichia_phage	98.5	1.3e-109
WP_042200809.1|322565_322781_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	5.0e-32
WP_001281772.1|322791_323028_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_033811690.1|322984_323431_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	97.3	1.5e-78
WP_001254230.1|323427_323610_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	93.3	1.8e-27
WP_000566998.1|323606_323777_+	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	100.0	7.2e-26
WP_100272927.1|323769_324492_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	91.2	1.8e-118
324042:324058	attR	TGACCGTTGGCGAGAGC	NA	NA	NA	NA
WP_000002243.1|324491_324782_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_042094888.1|324778_325141_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NRL7	Escherichia_phage	99.2	3.5e-62
WP_089580037.1|325280_325895_+	hypothetical protein	NA	A0A2H4FND2	Salmonella_phage	88.7	6.9e-103
WP_000839574.1|326375_326591_+|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_100272929.1|326590_327088_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_097335886.1|327084_327522_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	9.4e-70
WP_001016386.1|327727_328246_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
WP_000807780.1|328599_328842_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	78.8	7.6e-29
WP_000091987.1|328843_329023_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	100.0	3.7e-25
WP_001436504.1|329046_329469_+	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_100272930.1|329465_330881_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	2.6e-278
WP_021537887.1|330882_333081_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
WP_021537888.1|333171_334068_+	phage scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	84.9	7.5e-114
WP_001529832.1|334088_335348_+	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	66.1	2.2e-151
WP_000078363.1|335388_335577_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	87.1	7.4e-24
WP_001554895.1|335557_336019_+	phage DNA stabilization protein	NA	A5VW70	Enterobacteria_phage	98.7	7.8e-83
WP_021537889.1|336028_337447_+	DNA stabilization protein	NA	Q716G7	Shigella_phage	99.2	3.9e-274
WP_021537890.1|337446_338148_+	hypothetical protein	NA	A0A2D1GLK3	Escherichia_phage	97.0	5.6e-117
WP_021537891.1|338147_338603_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	6.7e-87
WP_021557677.1|338605_339298_+	hypothetical protein	NA	A5VW66	Enterobacteria_phage	98.7	1.8e-115
WP_001529839.1|339308_340724_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	80.5	4.8e-200
WP_100272931.1|340720_342856_+	DNA transfer protein	NA	Q9AYY9	Salmonella_phage	92.1	0.0e+00
WP_000895335.1|342856_343186_-	hypothetical protein	NA	Q9AYY8	Salmonella_phage	99.1	1.7e-52
WP_000757526.1|343216_343582_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_001085430.1|343595_343775_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000903306.1|343913_344450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001051912.1|344449_344698_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000410000.1|344812_344965_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_015674611.1|345226_346156_+	phage antirepressor Ant	NA	I6R977	Salmonella_phage	86.1	6.3e-148
WP_100272932.1|346256_349202_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.3	0.0e+00
WP_001264953.1|349891_350920_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|350892_351585_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|351714_352887_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063134.1|352886_355433_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.8	2.6e-71
WP_000209904.1|355429_356029_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|356384_356690_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|356689_357610_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 24
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	360640	362225	5036925		Enterobacteria_phage(100.0%)	2	NA	NA
WP_001273658.1|360640_360814_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_021523919.1|360896_362225_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	8.2e-234
>prophage 25
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	377062	378127	5036925		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258758.1|377062_378127_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 26
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	386738	390537	5036925		Acanthocystis_turfacea_Chlorella_virus(50.0%)	5	NA	NA
WP_021523971.1|386738_387677_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	30.2	2.7e-05
WP_021523972.1|387731_388469_+	phosphatase	NA	NA	NA	NA	NA
WP_021523973.1|388492_389047_+	molecular chaperone	NA	NA	NA	NA	NA
WP_001297187.1|389148_389640_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001189321.1|389703_390537_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 27
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	394674	395208	5036925		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|394674_395208_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 28
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	404515	405436	5036925		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|404515_405436_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 29
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	410098	410344	5036925		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|410098_410344_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 30
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	426224	427166	5036925		Brevibacillus_phage(100.0%)	1	NA	NA
WP_012601461.1|426224_427166_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 31
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	439521	440703	5036925		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|439521_440256_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|440466_440703_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 32
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	443975	445618	5036925		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257002.1|443975_444617_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267922.1|444613_445618_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 33
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	457941	458199	5036925		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|457941_458199_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 34
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	465486	469209	5036925		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|465486_466188_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251365.1|466187_467432_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291300.1|467460_468372_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|468387_469209_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 35
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	472481	474459	5036925		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|472481_473339_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531578.1|473322_474459_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 36
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	479481	480852	5036925		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423737.1|479481_480852_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
>prophage 37
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	483988	486857	5036925		Phage_21(50.0%)	4	NA	NA
WP_000444487.1|483988_485239_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001445545.1|485322_485448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|485500_485905_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332310.1|486125_486857_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
>prophage 38
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	501061	502749	5036925		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|501061_501481_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457587.1|501480_502749_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.0	6.9e-206
>prophage 39
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	518777	519536	5036925		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173310.1|518777_519536_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 40
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	531978	534730	5036925		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033350.1|531978_533658_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|533782_534730_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 41
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	537866	544135	5036925		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|537866_538949_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456474.1|538948_539782_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|539778_540171_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257054.1|540174_540984_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|541019_541874_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170963.1|542022_542130_-	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_000063608.1|542534_543635_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|543904_544135_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 42
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	555267	565157	5036925		Escherichia_phage(25.0%)	10	NA	NA
WP_021524048.1|555267_556806_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	1.1e-19
WP_000571684.1|556802_557513_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|557512_558190_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_021524049.1|558795_559638_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|559687_560146_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|560258_561164_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_021524050.1|561255_562269_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|562470_563379_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|563522_563936_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|564539_565157_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 43
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	574723	576738	5036925		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110954.1|574723_575737_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|575733_576738_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 44
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	584672	652161	5036925	terminase,lysis,capsid,head,tail,protease,portal,holin,integrase	Enterobacteria_phage(39.22%)	74	577290:577305	644165:644180
577290:577305	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_000113674.1|584672_585803_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|585780_586029_-	excisionase	NA	NA	NA	NA	NA
WP_021535863.1|586093_588565_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.5	4.0e-56
WP_021524056.1|588657_588849_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021524057.1|588845_589034_-	phage cell division inhibition protein	NA	NA	NA	NA	NA
WP_021524058.1|589044_589899_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_012601410.1|590399_590666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|590654_590993_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379586.1|591004_591157_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000362153.1|591422_591842_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|591942_592224_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|592207_592633_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_100273069.1|592655_593618_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.1	2.4e-70
WP_000788950.1|593624_594371_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|594392_595163_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|595178_595604_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|595778_596444_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|596624_596837_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|597004_597277_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_021524061.1|597278_598334_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	5.2e-90
WP_021524062.1|598334_598715_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.9e-34
WP_021524063.1|598711_599533_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	5.5e-79
WP_001536853.1|599759_599957_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	8.0e-29
WP_021535865.1|602430_604284_+	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	87.8	0.0e+00
WP_000284510.1|604434_604650_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|604654_604999_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|604964_605237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|605342_605876_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_001082539.1|606174_606642_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
WP_000347013.1|606992_607133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|607265_607451_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_001405844.1|607886_608393_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_021535866.1|608364_610293_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.4e-258
WP_021535867.1|610276_610480_+|head	head-stabilizing protein	head	K7PM10	Enterobacteria_phage	54.1	2.1e-08
WP_021535868.1|610476_612069_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.2e-185
WP_001556921.1|612058_613564_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256823.1|613600_613948_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_021535869.1|614005_615034_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	1.6e-112
WP_021535870.1|615085_615454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021535871.1|615446_615800_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	5.1e-42
WP_000974994.1|615815_616391_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_000683079.1|616387_616783_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_021537915.1|616790_617543_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479095.1|617556_617988_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|618014_618428_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_032218216.1|618408_620982_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	0.0e+00
WP_021535896.1|620978_621308_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.4e-56
WP_021535895.1|621307_622006_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_021537917.1|622010_622754_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	3.0e-145
WP_000090879.1|622690_623293_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|623365_623704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272940.1|623770_627250_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_021535892.1|627317_627917_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	1.2e-104
WP_021537919.1|627981_631152_+|tail	phage tail fiber assembly protein	tail	X2KTY7	Enterobacteria_phage	58.6	2.0e-81
WP_000885577.1|631151_631736_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|631790_632459_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|632515_632785_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079498.1|633556_634063_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_072145561.1|634108_634591_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000443050.1|634935_635742_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|635741_636935_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001541273.1|636946_638305_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_021537922.1|638308_639904_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194639.1|639903_641466_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|641557_641602_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_021524075.1|641739_642621_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|642617_643238_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_024187957.1|643265_645155_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
644165:644180	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
WP_001291206.1|645367_646243_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|646282_646873_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_021524077.1|646869_647628_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422056.1|647847_648897_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.9	1.5e-20
WP_001031530.1|648932_649184_-	YciN family protein	NA	NA	NA	NA	NA
WP_001682840.1|649563_652161_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 45
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	657063	657654	5036925		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|657063_657654_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 46
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	665466	667401	5036925		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|665466_667401_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 47
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	676334	678352	5036925		Salmonella_phage(50.0%)	2	NA	NA
WP_000135020.1|676334_677498_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.6e-28
WP_000573407.1|677545_678352_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 48
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	697693	698776	5036925		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|697693_698776_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 49
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	716000	716516	5036925		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945020.1|716000_716516_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	8.3e-25
>prophage 50
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	721257	730678	5036925	tRNA	Bacillus_phage(20.0%)	7	NA	NA
WP_012601490.1|721257_722490_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|722744_723728_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|724002_724176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001591989.1|724205_725579_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	3.3e-52
WP_001157412.1|725707_726643_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001295593.1|728969_729404_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|729544_730678_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 51
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	735637	736627	5036925		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|735637_736627_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 52
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	755133	759036	5036925		Klosneuvirus(100.0%)	1	NA	NA
WP_021524150.1|755133_759036_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 53
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	762976	763925	5036925		Escherichia_phage(50.0%)	2	NA	NA
WP_001350640.1|762976_763507_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|763751_763925_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 54
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	775774	777736	5036925		Phage_TP(100.0%)	1	NA	NA
WP_001313806.1|775774_777736_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 55
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	781365	782379	5036925		Mycoplasma_phage(100.0%)	1	NA	NA
WP_021524156.1|781365_782379_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	6.6e-26
>prophage 56
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	787875	789978	5036925		Salmonella_phage(100.0%)	1	NA	NA
WP_021524157.1|787875_789978_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	3.6e-135
>prophage 57
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	794620	797026	5036925		Ralstonia_phage(100.0%)	1	NA	NA
WP_021535880.1|794620_797026_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.6	5.6e-23
>prophage 58
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	804491	806036	5036925		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|804491_806036_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 59
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	817460	819219	5036925		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|817460_817745_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605675.1|817744_818023_-	hypothetical protein	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000642412.1|818208_819219_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
>prophage 60
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	822626	825026	5036925		Klosneuvirus(100.0%)	1	NA	NA
WP_021524166.1|822626_825026_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.5e-09
>prophage 61
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	830495	837431	5036925		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_072251740.1|830495_833291_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
WP_000832485.1|833335_835708_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001304373.1|835745_837431_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	3.8e-10
>prophage 62
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	859068	860487	5036925		Bacillus_phage(100.0%)	1	NA	NA
WP_021524178.1|859068_860487_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 63
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	868337	870467	5036925		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091198.1|868337_868721_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_021524179.1|868752_868971_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012593.1|869027_870467_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.8e-30
>prophage 64
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	877969	878860	5036925		Bacillus_phage(100.0%)	1	NA	NA
WP_021524182.1|877969_878860_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 65
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	883246	945548	5036925	terminase,lysis,capsid,head,tail,portal,holin,integrase	Escherichia_phage(43.86%)	74	890404:890418	933976:933990
WP_000214712.1|883246_883450_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000526706.1|883485_884946_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	5.1e-43
WP_000347484.1|885034_886318_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000555630.1|886758_887673_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001576746.1|887672_888500_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
WP_001101732.1|888496_889354_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_021537975.1|889350_890208_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_021537976.1|890299_890593_-	hypothetical protein	NA	NA	NA	NA	NA
890404:890418	attL	ACCACGGCATATTCA	NA	NA	NA	NA
WP_021537977.1|890603_891308_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	3.9e-57
WP_000654140.1|891317_891599_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	7.0e-18
WP_100272948.1|891598_893971_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	6.3e-168
WP_021541891.1|894122_894722_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	1.4e-100
WP_100272949.1|894789_898269_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_071778932.1|898329_898962_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.5e-95
WP_024188206.1|898898_899642_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_021537983.1|899647_900346_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	2.0e-130
WP_000847339.1|900345_900675_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_021537984.1|900671_901730_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.6	4.9e-165
WP_148722780.1|901755_902301_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.4	3.7e-84
WP_000459474.1|903163_903598_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000479162.1|903579_904002_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.8e-71
WP_001467857.1|904017_904758_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	3.8e-132
WP_000683128.1|904765_905161_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_021537986.1|905157_905736_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_100272950.1|905747_906101_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
WP_021537987.1|906112_906508_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.5e-55
WP_021537988.1|906549_907575_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	1.2e-189
WP_021537989.1|907629_907962_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_021537990.1|907971_909291_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.2e-232
WP_021538605.1|909271_910873_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
WP_000198149.1|910869_911076_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027268.1|911072_912998_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453576.1|912972_913518_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001331705.1|913906_914140_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000079508.1|914197_914608_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_021537992.1|914915_915380_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.7e-61
WP_021537993.1|915678_916212_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	2.0e-98
WP_000372595.1|916570_916786_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_113263695.1|916859_916919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874243.1|917093_917282_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_100272951.1|917542_917878_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.8	1.7e-42
WP_000562553.1|918158_918290_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_021537995.1|919186_920008_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	3.6e-78
WP_000904114.1|920004_920379_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_021537996.1|920391_921441_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	7.2e-108
WP_023147795.1|921442_921721_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980999.1|921787_922039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|922254_922467_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_050517950.1|922958_923603_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000782641.1|923626_924265_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001151189.1|924461_924863_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_021537998.1|924903_925869_-	phage replication protein O	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_021537999.1|925849_926359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001594109.1|926342_926570_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|926650_927058_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_021538000.1|927226_927382_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
WP_021538001.1|927666_928137_-	hypothetical protein	NA	A4KWR7	Enterobacteria_phage	42.0	8.4e-16
WP_000560212.1|928680_928902_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_021538002.1|929025_931500_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	3.6e-57
WP_122993697.1|931584_931821_+	excisionase family protein	NA	S4TND0	Salmonella_phage	49.3	8.7e-14
WP_024188207.1|931840_933136_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	7.4e-155
WP_001531709.1|933161_933266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836075.1|933323_934343_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
933976:933990	attR	ACCACGGCATATTCA	NA	NA	NA	NA
WP_001298659.1|934354_935569_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_001304355.1|935774_936101_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705201.1|936235_936577_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|936611_937172_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_072251714.1|937174_937885_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778146.1|937992_938298_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_021524185.1|938496_940923_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	3.5e-214
WP_001468025.1|940983_943407_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_021538005.1|943417_944035_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	3.6e-75
WP_000526507.1|944036_944891_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148695.1|944933_945548_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
>prophage 66
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	963311	964613	5036925		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|963311_964613_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 67
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	974508	976320	5036925		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945913.1|974508_976320_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 68
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	996110	997385	5036925	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|996110_997385_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 69
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1004296	1005795	5036925		Salmonella_phage(50.0%)	2	NA	NA
WP_001298528.1|1004296_1004818_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_021524194.1|1004898_1005795_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	31.3	8.0e-07
>prophage 70
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1010211	1019015	5036925		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101209.1|1010211_1011039_+	lipoprotein	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|1011166_1011748_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701049.1|1011893_1013063_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|1013228_1013318_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|1013616_1014642_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269494.1|1014638_1015571_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|1015683_1016895_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|1017185_1018334_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|1018373_1019015_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 71
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1024519	1026786	5036925		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587583.1|1024519_1025332_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_021524196.1|1025335_1026121_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001518634.1|1026117_1026786_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 72
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1035077	1040161	5036925		environmental_halophage(33.33%)	5	NA	NA
WP_000144571.1|1035077_1036298_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
WP_000907963.1|1036294_1037566_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948882.1|1037540_1038287_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_001304330.1|1038296_1039784_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367158.1|1039792_1040161_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
>prophage 73
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1058579	1078172	5036925	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553669.1|1058579_1060280_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.8e-31
WP_000069409.1|1060336_1062715_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|1063047_1063881_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|1064037_1065084_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001313872.1|1065215_1065407_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175635.1|1065410_1066847_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001298229.1|1066909_1067623_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209783.1|1067869_1068334_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_000029464.1|1068411_1069161_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154199.1|1069160_1069712_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|1069773_1070754_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|1070854_1071154_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_021524221.1|1071158_1073546_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|1073560_1074544_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1074827_1074872_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|1074994_1075351_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1075403_1075601_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1075697_1076240_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|1076243_1078172_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 74
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1087548	1089810	5036925		Tupanvirus(100.0%)	1	NA	NA
WP_000077890.1|1087548_1089810_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.4	2.3e-143
>prophage 75
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1095937	1096765	5036925		Bacillus_virus(100.0%)	1	NA	NA
WP_000175018.1|1095937_1096765_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.7e-73
>prophage 76
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1104241	1105462	5036925		Klosneuvirus(100.0%)	1	NA	NA
WP_000081990.1|1104241_1105462_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 77
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1112225	1112879	5036925		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|1112225_1112879_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 78
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1117269	1119225	5036925		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235807.1|1117269_1119225_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 79
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1124151	1128237	5036925		Tupanvirus(50.0%)	4	NA	NA
WP_021535906.1|1124151_1124793_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
WP_000438809.1|1124885_1126244_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|1126361_1127120_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723717.1|1127256_1128237_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
>prophage 80
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1137050	1137905	5036925		Indivirus(100.0%)	1	NA	NA
WP_001337804.1|1137050_1137905_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	8.7e-11
>prophage 81
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1141223	1145800	5036925		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|1141223_1142507_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_100272957.1|1142653_1144129_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|1144309_1145800_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 82
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1154767	1162873	5036925	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|1154767_1156453_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1156657_1157239_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220976.1|1157278_1157974_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1158031_1159942_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001351125.1|1160073_1160418_+	RidA family protein	NA	NA	NA	NA	NA
WP_015912513.1|1160779_1161160_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1161258_1161438_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854994.1|1161511_1162873_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	34.7	8.6e-45
>prophage 83
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1166731	1168288	5036925		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1166731_1168288_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 84
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1173929	1174139	5036925		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1173929_1174139_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 85
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1179471	1181520	5036925		Moraxella_phage(100.0%)	1	NA	NA
WP_021524233.1|1179471_1181520_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	2.3e-86
>prophage 86
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1189012	1193481	5036925		Escherichia_phage(33.33%)	7	NA	NA
WP_000812743.1|1189012_1189669_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.0e-56
WP_000976472.1|1190063_1190405_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879320.1|1190417_1191290_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|1191293_1191668_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1191806_1192037_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|1192138_1192795_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1192818_1193481_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 87
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1201537	1203013	5036925		Cyanophage(100.0%)	1	NA	NA
WP_021524238.1|1201537_1203013_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 88
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1207011	1214073	5036925		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|1207011_1208334_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|1208349_1209282_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1209360_1210116_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571478.1|1210112_1210898_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1211042_1212053_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1212061_1212673_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|1212811_1212877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024939.1|1212947_1213550_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1213551_1214073_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 89
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1217966	1220017	5036925		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639284.1|1217966_1218785_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	3.2e-71
WP_000252980.1|1218837_1219233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1219273_1220017_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 90
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1226633	1228367	5036925	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|1226633_1228367_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 91
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1232894	1237163	5036925		Tupanvirus(33.33%)	4	NA	NA
WP_000763860.1|1232894_1233284_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
WP_000036385.1|1233298_1234348_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|1234350_1235211_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001313042.1|1235501_1237163_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 92
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1247250	1248765	5036925		Cedratvirus(100.0%)	1	NA	NA
WP_001187788.1|1247250_1248765_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.1e-12
>prophage 93
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1260757	1261510	5036925		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|1260757_1261510_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 94
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1274868	1275951	5036925		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000737290.1|1274868_1275951_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 95
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1292269	1304638	5036925		Bacillus_phage(33.33%)	12	NA	NA
WP_001351132.1|1292269_1293964_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.5e-17
WP_000009302.1|1294134_1294317_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922688.1|1294395_1295313_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_021524253.1|1295485_1296406_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|1296394_1296865_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157268.1|1296845_1298264_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_021524254.1|1298330_1299026_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001330593.1|1299065_1299431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824389.1|1299995_1301054_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.1	2.5e-92
WP_021524255.1|1301649_1302501_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|1302608_1303967_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_001347103.1|1303966_1304638_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 96
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1308689	1406406	5036925	terminase,lysis,capsid,head,tail,portal,transposase,holin,integrase	Escherichia_phage(41.54%)	103	1350801:1350818	1387318:1387335
WP_021524258.1|1308689_1309910_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.1	3.3e-80
WP_021524259.1|1310023_1311844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097730840.1|1312034_1313197_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_100272960.1|1313259_1314684_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_021524261.1|1314736_1315294_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_000368352.1|1315691_1315997_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_000964096.1|1316642_1318145_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_032147728.1|1318261_1319125_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	36.4	3.2e-21
WP_000122165.1|1319256_1319766_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_001151469.1|1319902_1320739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524263.1|1320798_1321074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000722536.1|1321084_1321615_-	lipoprotein	NA	NA	NA	NA	NA
WP_001298513.1|1322047_1322521_+	DUF4755 domain-containing protein	NA	NA	NA	NA	NA
WP_021524264.1|1322552_1322930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524265.1|1323021_1324194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021524266.1|1324254_1325217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021524268.1|1326570_1327152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524269.1|1327236_1327968_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	41.4	8.7e-44
WP_001233369.1|1328141_1328621_+	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001287374.1|1328779_1329184_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_021524270.1|1329247_1329598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564593.1|1329706_1329949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091322.1|1330022_1330319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021524271.1|1330371_1330662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001607582.1|1330743_1330962_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_021524272.1|1331177_1332014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240857.1|1332703_1332991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204583.1|1333000_1333279_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
WP_100272961.1|1333275_1335342_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	8.2e-148
WP_001513563.1|1335406_1336006_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.8e-108
WP_100272962.1|1336073_1339766_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.0	0.0e+00
WP_071781460.1|1340109_1340742_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	9.3e-103
WP_001528990.1|1340687_1341431_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	3.7e-143
WP_021524657.1|1341441_1342140_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_000847298.1|1342139_1342469_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021538028.1|1342465_1345039_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
WP_000533402.1|1345019_1345433_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|1345459_1345891_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_100272963.1|1345909_1346656_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.0	7.3e-123
WP_000683079.1|1346663_1347059_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974994.1|1347055_1347631_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_001204533.1|1347646_1348000_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001565314.1|1347992_1348376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522592.1|1348427_1349456_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256835.1|1349513_1349861_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_016238736.1|1349897_1351403_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
1350801:1350818	attL	GGCCTGCGCCAGATGACC	NA	NA	NA	NA
WP_021524278.1|1351392_1352985_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_000259002.1|1352981_1353188_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_016247622.1|1353171_1355100_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	7.2e-263
WP_000235436.1|1355071_1355581_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000881609.1|1356195_1356333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|1356539_1356866_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032142285.1|1357176_1357644_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001280932.1|1357646_1357778_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001151823.1|1357792_1357975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001571194.1|1358131_1358665_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	4.3e-101
WP_021538035.1|1358715_1359060_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	92.9	2.2e-53
WP_000284506.1|1359064_1359280_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001538590.1|1359356_1359602_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_023143432.1|1359639_1359822_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001538589.1|1359958_1361920_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	4.3e-239
WP_100272964.1|1362689_1363403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021538037.1|1363539_1363737_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	1.2e-27
WP_021538038.1|1363963_1364785_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.5	9.0e-82
WP_021538039.1|1364781_1365156_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.9e-35
WP_021538040.1|1365168_1366218_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.2e-109
WP_024193993.1|1366219_1366498_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000902693.1|1366665_1366878_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_001557860.1|1366922_1367030_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000206826.1|1367363_1367708_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_021538041.1|1367704_1367890_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	90.6	1.6e-18
WP_021538042.1|1368403_1368763_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.5	2.4e-39
WP_001224662.1|1368928_1369111_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_021538043.1|1369204_1369561_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209475.1|1369538_1370000_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_024188212.1|1369996_1370293_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_072146789.1|1370289_1370571_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	78.5	3.4e-33
WP_100272965.1|1370603_1371320_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	8.7e-73
WP_001379651.1|1371353_1371776_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_021538047.1|1371807_1372845_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	69.5	3.7e-88
WP_000693918.1|1372916_1373342_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887447.1|1373325_1373598_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	8.5e-13
WP_001329851.1|1373707_1374109_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.3e-12
WP_000100899.1|1374136_1374328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000936799.1|1374327_1374615_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021538048.1|1374888_1375041_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000394541.1|1375052_1375391_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_012601410.1|1375379_1375646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012601409.1|1375575_1375836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1376149_1376338_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1376334_1376523_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021538049.1|1376618_1379093_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096346.1|1379151_1379355_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001520784.1|1379354_1380380_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	4.4e-102
WP_021524282.1|1380615_1381413_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060158.1|1381750_1383013_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.3	1.3e-71
WP_000703042.1|1383206_1384511_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286281.1|1384538_1385819_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_001304269.1|1385811_1387614_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
1387318:1387335	attR	GGCCTGCGCCAGATGACC	NA	NA	NA	NA
WP_000098391.1|1387600_1389403_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
WP_000140400.1|1389569_1390529_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_021524284.1|1390719_1396827_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_021524285.1|1396914_1406406_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 97
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1449620	1450787	5036925		Stx2-converting_phage(100.0%)	1	NA	NA
WP_100272967.1|1449620_1450787_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.7e-227
>prophage 98
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1456984	1457884	5036925		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1456984_1457884_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 99
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1465239	1481489	5036925		Escherichia_phage(22.22%)	14	NA	NA
WP_000704857.1|1465239_1466406_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.0e-110
WP_000043484.1|1466654_1468061_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000262539.1|1468188_1468983_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_100272968.1|1468984_1470103_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000601187.1|1470087_1470678_-	LPS biosynthesis protein	NA	A0A1V0SJ47	Klosneuvirus	32.6	2.6e-06
WP_001407542.1|1470658_1471651_-	beta-1,6-galactofuranosyltransferase	NA	NA	NA	NA	NA
WP_000639866.1|1471653_1472820_-	O16 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_000272486.1|1472819_1473923_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|1473930_1475178_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_100272969.1|1475174_1475732_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.9	3.9e-52
WP_001023610.1|1476670_1477570_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_021524300.1|1477569_1478655_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.5e-100
WP_021524302.1|1479026_1479920_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.2	3.9e-46
WP_021524303.1|1480094_1481489_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	29.6	1.7e-19
>prophage 100
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1487490	1494284	5036925		Bacillus_phage(25.0%)	6	NA	NA
WP_001405650.1|1487490_1488861_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	9.9e-33
WP_021538055.1|1489053_1490490_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	2.2e-46
WP_000699726.1|1490492_1491716_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001346880.1|1491712_1492192_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043619.1|1492194_1493160_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.4	2.2e-87
WP_000048190.1|1493162_1494284_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 101
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1498528	1509096	5036925		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|1498528_1499368_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_021524307.1|1499460_1501623_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482904.1|1501625_1502069_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1502074_1503214_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_021524308.1|1503871_1505455_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	9.4e-35
WP_100272971.1|1505906_1507760_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_021524310.1|1507781_1508363_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|1508454_1509096_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 102
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1513822	1515175	5036925		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469705.1|1513822_1515175_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 103
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1528282	1530405	5036925		Bacillus_phage(100.0%)	2	NA	NA
WP_000675178.1|1528282_1529686_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|1529682_1530405_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
>prophage 104
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1536244	1636113	5036925	terminase,lysis,capsid,head,tail,tRNA,holin,integrase	Enterobacteria_phage(33.82%)	101	1583950:1583970	1633619:1633639
WP_000476019.1|1536244_1537606_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_001441996.1|1538105_1538423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807341.1|1538838_1539738_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_000178556.1|1539819_1540599_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844230.1|1540698_1541739_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490682.1|1541786_1543142_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823288.1|1543145_1543430_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|1543460_1543913_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_100272972.1|1543922_1545185_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289813.1|1545213_1546068_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|1546296_1547349_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_100272973.1|1547605_1548883_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846206.1|1548879_1549884_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	1.7e-13
WP_000011945.1|1549880_1550846_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|1550819_1551566_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297940.1|1551617_1552436_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822274.1|1552500_1553301_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_021524315.1|1553297_1554086_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_100272974.1|1554308_1554581_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_021524316.1|1554701_1555526_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|1555744_1556083_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_021538059.1|1556163_1557198_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_021524317.1|1557213_1559694_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001683047.1|1560463_1561006_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001046487.1|1561299_1561581_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|1561843_1562953_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001538964.1|1563084_1565118_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
WP_021513713.1|1565258_1569047_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_100272975.1|1569056_1572689_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_021524320.1|1572749_1573055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313986.1|1573631_1574720_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_021524321.1|1574730_1577010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524322.1|1577002_1578139_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	2.6e-164
WP_021538060.1|1578135_1580136_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|1580260_1580722_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1580762_1581233_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1581279_1581999_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_021524325.1|1581995_1583681_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
1583950:1583970	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261928.1|1584206_1584455_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	84.0	1.8e-30
WP_000355615.1|1584572_1584869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204583.1|1584878_1585157_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
WP_021538061.1|1585153_1587214_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	1.2e-151
WP_021538062.1|1587365_1587965_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	8.5e-106
WP_100272976.1|1588032_1591725_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.2	0.0e+00
WP_122632346.1|1592068_1592701_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.6	1.1e-100
WP_021524275.1|1592646_1593390_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	93.9	2.4e-142
WP_001348269.1|1593400_1594099_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.1e-128
WP_000807940.1|1594098_1594440_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_021541925.1|1594432_1597699_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	80.1	0.0e+00
WP_021517447.1|1597746_1597956_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	94.2	4.8e-32
WP_015674697.1|1598051_1598426_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	91.9	2.9e-59
WP_001275451.1|1598439_1599153_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	95.8	4.1e-123
WP_000133388.1|1599217_1599562_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573362.1|1599558_1600005_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007905.1|1600001_1600352_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|1600361_1600688_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063027.1|1603214_1603436_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000173094.1|1603480_1605418_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	97.8	0.0e+00
WP_016234515.1|1605481_1607143_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_021524333.1|1607139_1607703_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	84.4	2.6e-72
WP_000057924.1|1607992_1608358_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	3.5e-62
WP_000095742.1|1608399_1608591_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	94.8	1.2e-24
WP_000828068.1|1608732_1609059_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_016234517.1|1609397_1609865_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	95.5	6.3e-72
WP_000675927.1|1609866_1609980_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	91.9	4.3e-11
WP_001092866.1|1610201_1610735_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_000284510.1|1611764_1611980_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001514225.1|1612055_1612325_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
WP_001304601.1|1612362_1612545_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_000874509.1|1612681_1614643_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
WP_000271630.1|1615241_1615670_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_016234522.1|1616939_1618022_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	2.7e-166
WP_001204776.1|1618210_1618594_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_021524334.1|1618611_1619601_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	4.0e-193
WP_001072669.1|1619608_1620424_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|1620586_1620982_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210152.1|1620978_1621305_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_001409632.1|1621301_1621955_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.8e-126
WP_072259056.1|1621954_1622449_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	90.1	1.8e-77
WP_021524336.1|1622445_1623429_-	hypothetical protein	NA	Q8SBF1	Shigella_phage	88.9	4.4e-51
WP_000995577.1|1623425_1623725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000620688.1|1623721_1623946_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	90.5	1.9e-34
WP_021524337.1|1623942_1625091_-	phage antirepressor	NA	K7PLX4	Enterobacteria_phage	85.6	9.7e-175
WP_000515850.1|1625087_1625645_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.8	1.1e-96
WP_001191669.1|1625637_1625898_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_012599998.1|1625995_1626688_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	2.4e-120
WP_021524338.1|1627376_1628294_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	37.5	1.5e-48
WP_021524339.1|1628384_1628921_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	1.4e-99
WP_021524340.1|1628911_1629274_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.0e-65
WP_000111289.1|1629270_1629474_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_021524341.1|1629466_1629706_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	2.0e-34
WP_021524342.1|1629702_1630251_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	94.1	1.0e-57
WP_000628775.1|1630764_1631523_+	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.4	1.2e-109
WP_000457723.1|1631607_1631850_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_021524344.1|1631853_1631988_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	1.2e-20
WP_001193437.1|1632006_1632261_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|1632294_1633581_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_028125877.1|1633601_1634303_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.9	6.7e-102
1633619:1633639	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|1634362_1634470_+	protein YohO	NA	NA	NA	NA	NA
WP_000783150.1|1634450_1635182_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_021524345.1|1635186_1636113_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 105
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1656463	1657984	5036925		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|1656463_1657984_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 106
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1661678	1662347	5036925		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|1661678_1662347_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 107
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1669532	1670390	5036925		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|1669532_1670390_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 108
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1684915	1689216	5036925		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001332203.1|1684915_1686382_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
WP_021524356.1|1686499_1687486_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001445498.1|1687524_1688238_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1688649_1689216_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 109
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1694970	1702620	5036925		Vibrio_phage(50.0%)	7	NA	NA
WP_000194893.1|1694970_1696560_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	1.9e-19
WP_000202798.1|1696563_1696908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213368.1|1697241_1698432_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|1698459_1699155_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578056.1|1699304_1701065_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_000494186.1|1701189_1701474_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1701612_1702620_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 110
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1712664	1713282	5036925		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|1712664_1713282_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 111
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1722050	1727852	5036925		Bacillus_phage(25.0%)	5	NA	NA
WP_000422211.1|1722050_1723694_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
WP_000884929.1|1723769_1724420_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	8.3e-06
WP_000786370.1|1724419_1725484_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_021524366.1|1725557_1726613_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_100272977.1|1726724_1727852_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.3	6.1e-113
>prophage 112
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1732129	1736972	5036925		Hokovirus(50.0%)	2	NA	NA
WP_021524367.1|1732129_1734979_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	3.2e-41
WP_021524368.1|1735145_1736972_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 113
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1751826	1754454	5036925		Bacillus_virus(100.0%)	1	NA	NA
WP_001281253.1|1751826_1754454_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 114
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1759887	1765731	5036925		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075170.1|1759887_1762173_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|1762363_1763494_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1763493_1763748_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301031.1|1763801_1764452_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779074.1|1764654_1765731_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 115
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1771624	1776000	5036925	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_021524373.1|1771624_1772587_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.3	3.5e-69
WP_021524374.1|1772627_1773431_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_021524375.1|1773448_1774738_-	MFS transporter	NA	NA	NA	NA	NA
WP_001529341.1|1774794_1776000_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	7.1e-27
>prophage 116
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1779603	1784607	5036925		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|1779603_1780206_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_001467969.1|1780513_1781653_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.5	3.2e-29
WP_021524377.1|1781656_1782625_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	2.0e-35
WP_021524378.1|1782624_1784607_+	bifunctional polymyxin resistance protein ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 117
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1819569	1822797	5036925		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1819569_1820169_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1820227_1822060_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|1822146_1822797_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 118
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1833356	1835216	5036925	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_000156131.1|1833356_1834247_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	4.0e-67
WP_100272981.1|1834442_1835216_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 119
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1839427	1840945	5036925		Mollivirus(100.0%)	1	NA	NA
WP_100272982.1|1839427_1840945_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	1.6e-87
>prophage 120
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1847694	1848831	5036925		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699136.1|1847694_1848831_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
>prophage 121
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1857367	1858453	5036925		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|1857367_1858453_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 122
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1874876	1875809	5036925		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368123.1|1874876_1875809_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
>prophage 123
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1883738	1891315	5036925		Bacillus_phage(50.0%)	4	NA	NA
WP_001331804.1|1883738_1887332_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001317966.1|1887387_1888533_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1888606_1889551_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283513.1|1889620_1891315_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	4.7e-24
>prophage 124
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1895004	1895925	5036925		Morganella_phage(100.0%)	1	NA	NA
WP_000484017.1|1895004_1895925_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	1.7e-76
>prophage 125
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1899743	1900478	5036925		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1899743_1900478_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 126
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1926139	1947867	5036925		Streptococcus_phage(25.0%)	22	NA	NA
WP_021524401.1|1926139_1928155_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	1.0e-150
WP_100272986.1|1928225_1929224_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1929453_1930215_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1930399_1931371_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1931754_1932012_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623142.1|1932056_1933784_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1933824_1934334_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_100272987.1|1934376_1935228_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719965.1|1935332_1935701_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|1935703_1936615_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|1936749_1937847_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1937836_1938712_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|1938711_1939545_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290263.1|1939544_1940561_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517443.1|1940718_1941510_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175632.1|1941789_1942686_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_100272988.1|1942689_1944114_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|1944291_1945191_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838953.1|1945286_1945862_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|1945922_1946372_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1946358_1946784_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102910.1|1946997_1947867_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 127
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1966615	1967566	5036925		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1966615_1967566_+	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 128
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1984807	1985521	5036925		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1984807_1985521_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 129
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	1993000	1997002	5036925		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|1993000_1994290_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|1994375_1995002_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001296287.1|1995326_1996364_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001028626.1|1996363_1997002_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 130
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2003437	2009739	5036925		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|2003437_2003611_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|2003924_2004440_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755178.1|2004455_2004995_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138282.1|2005088_2006666_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|2006734_2008201_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937952.1|2008362_2009739_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.7	8.1e-43
>prophage 131
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2030218	2030650	5036925		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|2030218_2030650_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 132
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2040536	2046874	5036925		Mycoplasma_phage(20.0%)	8	NA	NA
WP_021524424.1|2040536_2041820_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.7e-34
WP_000523612.1|2041878_2042079_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|2042090_2042426_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196626.1|2042427_2044278_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|2044294_2044810_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2044905_2045229_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2045245_2045632_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2045659_2046874_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 133
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2057122	2058634	5036925		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493464.1|2057122_2058634_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
>prophage 134
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2064392	2075700	5036925		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|2064392_2065646_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883120.1|2065973_2067164_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2067208_2067547_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|2067607_2068942_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215879.1|2068931_2069645_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|2069809_2071237_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_021524431.1|2071812_2075700_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	6.5e-130
>prophage 135
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2079821	2080082	5036925		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|2079821_2080082_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 136
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2083541	2087278	5036925		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|2083541_2084222_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2084488_2085463_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|2085478_2087278_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 137
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2092180	2171440	5036925	terminase,lysis,capsid,head,tail,portal,tRNA,plate,integrase	Salmonella_phage(71.15%)	85	2138407:2138452	2172593:2172638
WP_001350302.1|2092180_2092918_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2093049_2094384_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|2094416_2095298_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021524435.1|2095400_2095988_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2096043_2096427_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2096731_2097421_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_021524436.1|2097468_2098506_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2098712_2099132_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2099200_2099899_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_100272992.1|2099930_2102591_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2102704_2104060_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001467872.1|2104105_2104429_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841087.1|2104425_2105724_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
WP_001235102.1|2114209_2116783_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_021524441.1|2116912_2117644_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|2117640_2118621_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_021524442.1|2118755_2119493_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2119762_2120104_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2120207_2120255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200107.1|2120353_2121514_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2121556_2122678_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2122688_2123759_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976008.1|2123969_2124335_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212402.1|2124481_2125000_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969007.1|2124989_2126216_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2126231_2126714_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2126790_2127138_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2127179_2127947_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2127977_2128526_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2128544_2128793_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2128929_2130291_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2130457_2131249_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032140825.1|2131269_2132556_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_021538117.1|2132610_2133204_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2133326_2134205_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2134290_2135952_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2136100_2136442_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2136503_2136794_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2136783_2137260_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2137391_2137874_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2138407:2138452	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000391793.1|2138574_2139057_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.1	1.7e-16
WP_000980501.1|2139083_2139302_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_100272993.1|2139370_2140471_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.2	2.9e-176
WP_000980413.1|2140467_2140953_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_048983535.1|2140949_2144027_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|2144019_2144139_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281004.1|2144153_2144456_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_001207660.1|2144510_2145026_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_088537753.1|2145035_2146208_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	1.2e-204
WP_000905031.1|2146350_2146917_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	2.9e-87
WP_123058834.1|2146947_2147337_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	43.8	4.7e-12
WP_053902275.1|2147363_2147804_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.0	8.0e-53
WP_000384228.1|2147775_2148378_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.5	5.4e-92
WP_053902276.1|2148377_2149937_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.9	1.5e-194
WP_001086836.1|2149933_2150539_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_001583364.1|2150531_2151440_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_053902277.1|2151426_2151786_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.9	2.0e-54
WP_000993769.1|2151782_2152361_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	2.5e-94
WP_000829146.1|2152429_2152876_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_001039939.1|2152868_2153300_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_001337513.1|2153395_2153824_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_000727856.1|2153820_2154198_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_100273073.1|2154199_2154673_-	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	8.3e-80
WP_000171568.1|2154692_2154908_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2154911_2155115_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|2155114_2155579_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_021534472.1|2155674_2156325_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000742510.1|2156328_2157387_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000216237.1|2157403_2158237_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098422.1|2158379_2160146_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520385.1|2160145_2161180_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.1	7.2e-169
WP_000008839.1|2161227_2162637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2162958_2163192_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|2163202_2163391_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_097296848.1|2163544_2165917_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
WP_001420002.1|2165916_2166738_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_063615102.1|2166743_2167598_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.8	2.6e-148
WP_000752619.1|2167594_2167822_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244233.1|2167821_2168055_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	1.6e-31
WP_000996720.1|2168122_2168464_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	1.1e-54
WP_000956192.1|2168581_2168878_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460856.1|2168885_2169395_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.3	1.3e-83
WP_000102105.1|2169427_2169670_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000582125.1|2169789_2170422_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.0	1.3e-104
WP_000155495.1|2170423_2171440_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	93.7	2.0e-187
2172593:2172638	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
>prophage 138
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2177069	2181120	5036925		Klosneuvirus(50.0%)	4	NA	NA
WP_001337980.1|2177069_2178350_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	4.9e-34
WP_001298180.1|2178586_2179987_+	GABA permease	NA	NA	NA	NA	NA
WP_000156818.1|2180007_2180670_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|2180670_2181120_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 139
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2186926	2192224	5036925		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2186926_2187172_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|2187168_2187579_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001592545.1|2187551_2189696_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	4.9e-196
WP_021513762.1|2189705_2190665_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.1	1.6e-133
WP_000985494.1|2191021_2192224_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 140
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2204882	2210269	5036925	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2204882_2205068_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047171.1|2205302_2207933_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|2208061_2208562_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2208630_2209692_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|2209771_2210269_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 141
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2215737	2216703	5036925		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|2215737_2216703_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 142
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2241703	2248843	5036925		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2241703_2244265_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141289.1|2244370_2245027_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_001296319.1|2245077_2245845_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847998.1|2246040_2246949_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_021524449.1|2246945_2248208_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.8e-135
WP_021538119.1|2248204_2248843_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
>prophage 143
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2253216	2256932	5036925		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|2253216_2254209_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2254271_2255411_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2255550_2256177_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_016247751.1|2256170_2256932_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	1.3e-58
>prophage 144
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2260043	2262076	5036925		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|2260043_2260649_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090357.1|2260648_2262076_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.3e-30
>prophage 145
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2276722	2277508	5036925		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|2276722_2277508_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 146
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2281021	2281693	5036925		Vibrio_phage(100.0%)	1	NA	NA
WP_001199974.1|2281021_2281693_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 147
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2285481	2288505	5036925		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|2285481_2286780_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2286867_2288505_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 148
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2292538	2296653	5036925		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046816.1|2292538_2293840_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.1e-38
WP_100272997.1|2293896_2296653_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
>prophage 149
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2304185	2305034	5036925		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|2304185_2305034_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 150
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2309892	2310648	5036925		Bacillus_phage(100.0%)	1	NA	NA
WP_001314086.1|2309892_2310648_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 151
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2322224	2324730	5036925	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001338000.1|2322224_2323430_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.7e-74
WP_000184272.1|2323429_2323873_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|2323923_2324730_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 152
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2333560	2338698	5036925		Cronobacter_phage(50.0%)	2	NA	NA
WP_000147358.1|2333560_2336206_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	1.9e-96
WP_021538123.1|2336217_2338698_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.9	3.2e-05
>prophage 153
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2342943	2343204	5036925		Burkholderia_virus(100.0%)	1	NA	NA
WP_001117813.1|2342943_2343204_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	38.5	2.5e-06
>prophage 154
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2356804	2373419	5036925		Paramecium_bursaria_Chlorella_virus(14.29%)	10	NA	NA
WP_021524472.1|2356804_2357752_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	9.0e-17
WP_001066237.1|2357823_2358420_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_000382413.1|2358422_2359598_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810553.1|2359597_2361178_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_021524473.1|2361209_2362034_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_021524474.1|2362291_2363545_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_001765039.1|2363776_2365108_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_100272998.1|2365169_2366996_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	3.5e-25
WP_021524476.1|2366995_2370538_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_021535951.1|2370530_2373419_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	9.0e-68
>prophage 155
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2378896	2385669	5036925		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2378896_2379691_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2379697_2380573_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_021524480.1|2380723_2382970_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2382982_2383513_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|2384197_2384887_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2384955_2385669_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 156
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2395299	2397794	5036925		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|2395299_2396718_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000602503.1|2397032_2397794_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.8e-20
>prophage 157
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2402079	2402835	5036925		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2402079_2402835_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 158
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2427114	2442506	5036925	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|2427114_2428515_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|2428532_2429849_+	guanine deaminase	NA	NA	NA	NA	NA
WP_021524487.1|2429884_2431252_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	5.6e-161
WP_000838415.1|2431287_2431776_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_021524488.1|2431775_2433695_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001363024.1|2434130_2435579_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
WP_001050745.1|2435580_2435706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2435702_2435774_-	protein YqfH	NA	NA	NA	NA	NA
WP_001683257.1|2435828_2436377_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|2436419_2437937_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2437946_2439045_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813189.1|2439135_2440869_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	8.3e-61
WP_000715230.1|2440874_2441585_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2441609_2442506_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 159
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2446311	2450784	5036925		Pandoravirus(50.0%)	2	NA	NA
WP_001350137.1|2446311_2447745_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
WP_100273001.1|2447910_2450784_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
>prophage 160
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2458919	2460152	5036925		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2458919_2460152_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 161
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2473685	2474363	5036925		Bacillus_virus(100.0%)	1	NA	NA
WP_001546257.1|2473685_2474363_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	2.9e-09
>prophage 162
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2479415	2480324	5036925		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|2479415_2480324_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 163
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2488477	2489632	5036925		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2488477_2489632_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 164
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2512327	2513590	5036925	integrase	Pseudomonas_phage(100.0%)	1	2503344:2503357	2514791:2514804
2503344:2503357	attL	TTTGCTGGCCCCAG	NA	NA	NA	NA
WP_001218820.1|2512327_2513590_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
WP_001218820.1|2512327_2513590_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
2514791:2514804	attR	TTTGCTGGCCCCAG	NA	NA	NA	NA
>prophage 165
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2520228	2522645	5036925	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_000080195.1|2520228_2521842_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2521872_2522223_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2522219_2522645_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
>prophage 166
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2544931	2547101	5036925		Yersinia_phage(33.33%)	4	NA	NA
WP_021538150.1|2544931_2545750_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	2.5e-47
WP_021538151.1|2545840_2546326_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.8e-13
WP_001537421.1|2546340_2546817_+	RadC family protein	NA	NA	NA	NA	NA
WP_021524511.1|2546879_2547101_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 167
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2552625	2553609	5036925		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001331698.1|2552625_2553609_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 168
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2567191	2567851	5036925		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000590258.1|2567191_2567851_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
>prophage 169
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2600424	2601597	5036925		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_021538158.1|2600424_2601597_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 170
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2623821	2624706	5036925		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_100273075.1|2623821_2624706_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	1.1e-64
>prophage 171
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2630549	2637868	5036925		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013141.1|2630549_2631377_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	3.6e-62
WP_001546133.1|2631576_2632503_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848521.1|2632553_2632811_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095216.1|2632852_2635072_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438650.1|2635323_2636073_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_001546134.1|2636395_2637868_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	7.6e-47
>prophage 172
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2645326	2650366	5036925		Bacillus_virus(50.0%)	4	NA	NA
WP_001281888.1|2645326_2647585_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_001468194.1|2647722_2649330_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021538160.1|2649438_2649921_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2649973_2650366_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 173
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2658208	2664469	5036925		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_000986428.1|2658208_2659192_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_021524521.1|2659188_2659998_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	9.4e-15
WP_021524522.1|2660371_2662513_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195274.1|2662576_2664469_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
>prophage 174
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2668816	2670654	5036925		Erwinia_phage(50.0%)	2	NA	NA
WP_000831543.1|2668816_2669488_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2669493_2670654_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
>prophage 175
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2681887	2682541	5036925		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|2681887_2682541_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 176
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2686454	2687888	5036925		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|2686454_2687888_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 177
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2693025	2694264	5036925	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_021524530.1|2693025_2694264_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 178
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2700672	2716741	5036925	tRNA	Moraxella_phage(16.67%)	11	NA	NA
WP_001539750.1|2700672_2701686_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|2701923_2702139_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_021521058.1|2702248_2703994_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
WP_000437380.1|2704188_2706030_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_001468200.1|2706867_2707632_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_001468201.1|2707919_2708543_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021524532.1|2708571_2710092_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000633402.1|2710398_2711889_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450588.1|2711930_2712263_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212447.1|2712481_2713465_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_021538166.1|2713648_2716741_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	1.4e-156
>prophage 179
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2729072	2730038	5036925		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|2729072_2730038_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 180
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2749922	2752217	5036925		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861710.1|2749922_2752217_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 181
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2758371	2759517	5036925		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296434.1|2758371_2759517_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 182
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2776201	2783997	5036925		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809265.1|2776201_2777065_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_021524542.1|2777129_2779166_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246829.1|2779123_2779519_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2779538_2780129_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2780138_2780714_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147603.1|2780826_2781867_-	permease	NA	NA	NA	NA	NA
WP_001346704.1|2781939_2782575_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001350449.1|2782702_2783221_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449450.1|2783200_2783644_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189321.1|2783694_2783997_+	DNA damage response exodeoxyribonuclease YhbQ	NA	A0A068LKN9	Peridroma_alphabaculovirus	55.4	3.0e-14
>prophage 183
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2789699	2791589	5036925		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2789699_2791589_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 184
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2797070	2803709	5036925		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|2797070_2799743_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|2799767_2801255_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2801282_2801735_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2802365_2803709_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 185
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2807789	2810662	5036925	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764750.1|2807789_2808638_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.6e-23
WP_001107467.1|2808727_2810662_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 186
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2817291	2818776	5036925		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2817291_2818263_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|2818497_2818776_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 187
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2822844	2837638	5036925		Staphylococcus_phage(25.0%)	16	NA	NA
WP_000438245.1|2822844_2823654_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922880.1|2823863_2824841_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2824854_2825841_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|2825861_2826428_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_100273008.1|2826424_2827000_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2826968_2827526_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2827532_2828258_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_021524545.1|2828305_2829739_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2829761_2830049_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|2830166_2830658_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2830703_2831558_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2831554_2831827_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000047069.1|2832668_2833397_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719791.1|2833393_2834047_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809764.1|2834276_2836613_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	9.9e-41
WP_001296449.1|2836708_2837638_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 188
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2846341	2897203	5036925	tRNA,protease,integrase	Organic_Lake_phycodnavirus(28.57%)	46	2894202:2894234	2898090:2898122
WP_000108476.1|2846341_2847832_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224704.1|2847940_2848834_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074795.1|2848955_2849747_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|2849854_2850352_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000257293.1|2850357_2850996_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|2851390_2851783_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|2851798_2852227_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_021524548.1|2852446_2853574_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|2853767_2854166_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001298588.1|2854319_2855687_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
WP_021566012.1|2855776_2856844_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_001295272.1|2856906_2857845_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257847.1|2858279_2858750_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|2859113_2859377_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_021524549.1|2859431_2859704_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_021524550.1|2859795_2861763_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854033.1|2861768_2862701_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|2862708_2862912_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|2863094_2864024_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055909.1|2864151_2865597_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_001253536.1|2865752_2869553_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|2869620_2871090_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203095.1|2871079_2871673_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|2871681_2872170_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802518.1|2872169_2873273_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|2873338_2874382_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241477.1|2874686_2876627_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148484.1|2876778_2877753_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000354622.1|2878732_2879203_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884645.1|2879213_2880563_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_021524552.1|2880654_2881701_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000048611.1|2881697_2882660_-	sugar kinase	NA	NA	NA	NA	NA
WP_000137052.1|2882681_2883671_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000132912.1|2883671_2885171_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
WP_001298583.1|2885231_2886122_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275538.1|2886157_2887012_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_050517944.1|2887353_2888184_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	9.3e-10
WP_001296457.1|2888215_2889151_+	sugar kinase	NA	NA	NA	NA	NA
WP_000381175.1|2889242_2889485_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175716.1|2889474_2890926_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145827.1|2890937_2891819_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|2892147_2893113_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|2893138_2893435_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
2894202:2894234	attL	AACGGGTCTTATGTGGTGATGATCGTTATGTTG	NA	NA	NA	NA
WP_100273076.1|2894329_2895274_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_100273009.1|2895270_2896197_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069903715.1|2896189_2897203_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	26.3	6.7e-10
2898090:2898122	attR	CAACATAACGATCATCACCACATAAGACCCGTT	NA	NA	NA	NA
>prophage 189
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2904846	2909000	5036925		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000738577.1|2904846_2905872_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_001350444.1|2907130_2908234_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021535983.1|2908241_2909000_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	2.6e-19
>prophage 190
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2919336	2920808	5036925	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2919336_2919846_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|2919860_2920808_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 191
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2942032	2943985	5036925		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|2942032_2943985_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 192
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2952815	2961382	5036925		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_021538187.1|2952815_2955518_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
WP_000031783.1|2955809_2956994_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2957064_2959179_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2959275_2959746_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2959842_2960217_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903382.1|2960342_2960630_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820731.1|2960636_2960996_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209693.1|2960995_2961382_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
>prophage 193
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2966952	2976492	5036925		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2966952_2968866_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_100273010.1|2968865_2969888_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2969881_2970100_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274684.1|2970153_2971023_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2971077_2971482_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2971783_2972416_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_157796866.1|2972466_2974557_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	98.6	8.5e-76
WP_021524561.1|2974619_2975843_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|2975928_2976492_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 194
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	2995410	2996247	5036925		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2995410_2996247_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 195
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3013225	3016992	5036925		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|3013225_3014848_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253708.1|3014923_3016276_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3016272_3016992_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 196
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3023565	3024459	5036925		Sodalis_phage(100.0%)	1	NA	NA
WP_021524569.1|3023565_3024459_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	4.3e-69
>prophage 197
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3030688	3033082	5036925		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_021513836.1|3030688_3033082_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 198
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3037472	3038699	5036925		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105470.1|3037472_3038699_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 199
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3054111	3056559	5036925		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|3054111_3056559_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 200
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3076429	3078240	5036925		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073603.1|3076429_3077173_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
WP_000907827.1|3077169_3078240_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 201
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3081781	3083264	5036925		Planktothrix_phage(50.0%)	2	NA	NA
WP_097747543.1|3081781_3082495_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	5.4e-14
WP_000082101.1|3082496_3083264_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 202
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3088986	3099087	5036925		Dickeya_phage(33.33%)	11	NA	NA
WP_000130217.1|3088986_3089841_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|3090085_3091144_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|3091136_3091805_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_021524581.1|3091807_3093289_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000743193.1|3093438_3094035_+	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_001295207.1|3094024_3094294_+	DUF1145 family protein	NA	NA	NA	NA	NA
WP_021524582.1|3094296_3094656_-	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_000964718.1|3094796_3095423_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_021524583.1|3095496_3097695_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	6.5e-119
WP_000130621.1|3097955_3098201_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|3098421_3099087_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 203
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3106980	3112062	5036925		Bacillus_virus(50.0%)	4	NA	NA
WP_021524586.1|3106980_3107787_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
WP_001190062.1|3107792_3108194_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_021524587.1|3108202_3109327_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149180.1|3109326_3112062_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 204
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3121747	3127156	5036925		Indivirus(50.0%)	5	NA	NA
WP_100273016.1|3121747_3123790_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.4	3.1e-46
WP_000954225.1|3123992_3124835_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_000160795.1|3124906_3126259_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_001295215.1|3126312_3126396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065791.1|3126730_3127156_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
>prophage 205
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3137827	3139297	5036925		Pithovirus(50.0%)	2	NA	NA
WP_000622316.1|3137827_3138598_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_000123131.1|3138649_3139297_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 206
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3185098	3187083	5036925		Bacillus_virus(50.0%)	2	NA	NA
WP_000103579.1|3185098_3186103_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196477.1|3186099_3187083_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 207
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3202813	3205147	5036925		Escherichia_phage(100.0%)	1	NA	NA
WP_021524601.1|3202813_3205147_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	3.1e-71
>prophage 208
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3208801	3209014	5036925		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3208801_3209014_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 209
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3213244	3214240	5036925		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182669.1|3213244_3214240_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	1.6e-11
>prophage 210
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3219557	3221099	5036925		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146502.1|3219557_3221099_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 211
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3240673	3245287	5036925		Clostridioides_phage(50.0%)	3	NA	NA
WP_016233639.1|3240673_3241969_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000741500.1|3242100_3243252_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000582430.1|3243442_3245287_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 212
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3268132	3277638	5036925		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|3268132_3268384_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_100273018.1|3268524_3268956_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|3269200_3270745_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|3270754_3272038_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001765163.1|3272041_3273001_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982125.1|3272987_3274022_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646018.1|3274260_3275286_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213845.1|3275295_3276492_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	4.9e-36
WP_000587750.1|3276705_3277638_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 213
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3281046	3283140	5036925		Catovirus(50.0%)	2	NA	NA
WP_000064025.1|3281046_3282030_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
WP_000364803.1|3282111_3283140_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
>prophage 214
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3290578	3295141	5036925		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|3290578_3291058_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114542.1|3291096_3291906_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001051798.1|3292003_3292171_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3292191_3292428_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|3292644_3293313_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|3293484_3294705_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|3294685_3295141_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 215
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3298515	3305266	5036925		Morganella_phage(25.0%)	6	NA	NA
WP_001297973.1|3298515_3299340_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
WP_000924289.1|3299631_3300249_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_021535996.1|3300245_3301928_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	22.8	3.3e-22
WP_001295237.1|3302185_3302809_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3302863_3303139_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|3303157_3305266_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 216
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3309567	3310959	5036925		environmental_Halophage(100.0%)	1	NA	NA
WP_021524616.1|3309567_3310959_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	99.3	1.6e-70
>prophage 217
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3323570	3324608	5036925		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|3323570_3324608_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 218
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3330058	3331393	5036925		Moraxella_phage(100.0%)	1	NA	NA
WP_001467796.1|3330058_3331393_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 219
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3338697	3350575	5036925		Micromonas_sp._RCC1109_virus(16.67%)	12	NA	NA
WP_000168476.1|3338697_3340386_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001312198.1|3340491_3340590_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001304999.1|3340990_3342175_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	5.2e-14
WP_000148034.1|3342182_3342680_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3342676_3343039_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3343028_3343376_-	YidH family protein	NA	NA	NA	NA	NA
WP_021524631.1|3343435_3344929_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	1.1e-29
WP_021535997.1|3344925_3346641_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.2e-40
WP_021524633.1|3346807_3347674_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|3347763_3349425_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|3349621_3350050_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3350161_3350575_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 220
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3355004	3356153	5036925		Oenococcus_phage(100.0%)	1	NA	NA
WP_021524634.1|3355004_3356153_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.5	1.8e-51
>prophage 221
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3360858	3368227	5036925		Bacillus_virus(33.33%)	8	NA	NA
WP_001298010.1|3360858_3363273_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
WP_000060112.1|3363301_3364375_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3364374_3365475_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3365479_3366883_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|3367179_3367260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|3367489_3367630_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3367646_3368006_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3367969_3368227_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 222
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3378425	3379763	5036925		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3378425_3379763_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 223
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3390134	3397649	5036925		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|3390134_3390908_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251985.1|3390998_3391889_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3391888_3392848_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3392934_3393975_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|3394288_3396118_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933730.1|3396278_3397649_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 224
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3409603	3410596	5036925		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3409603_3410596_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 225
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3413764	3419617	5036925		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3413764_3415633_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001346607.1|3415799_3416219_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387779.1|3416226_3417732_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3417736_3418702_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001297966.1|3418726_3419617_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.8	9.7e-05
>prophage 226
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3433008	3434655	5036925		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012591.1|3433008_3434655_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	3.7e-66
>prophage 227
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3442252	3447666	5036925		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|3442252_3444274_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_000535977.1|3444320_3445805_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3445940_3447206_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3447336_3447666_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 228
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3451708	3457852	5036925		Enterobacteria_phage(40.0%)	6	NA	NA
WP_021523603.1|3451708_3452839_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	5.1e-27
WP_000006614.1|3452835_3454098_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	7.7e-24
WP_021523604.1|3454097_3455165_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.0e-101
WP_000676056.1|3455183_3456065_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145189.1|3456042_3456717_+	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
WP_000612051.1|3456721_3457852_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 229
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3465859	3467515	5036925		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395835.1|3465859_3467515_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 230
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3475665	3484272	5036925		Salmonella_phage(50.0%)	8	NA	NA
WP_021523606.1|3475665_3476985_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	47.4	8.7e-10
WP_021513889.1|3476981_3478460_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.1	1.1e-42
WP_000799889.1|3478648_3478852_+	lipoprotein	NA	NA	NA	NA	NA
WP_001160656.1|3478888_3479713_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000812802.1|3479709_3480417_+	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_021523607.1|3480413_3481310_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.3	3.2e-24
WP_001213586.1|3481309_3482026_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|3482109_3484272_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 231
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3491642	3493472	5036925		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3491642_3493472_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 232
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3503932	3505441	5036925		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|3503932_3505441_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 233
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3527435	3530722	5036925		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|3527435_3529076_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|3529154_3529424_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459601.1|3529427_3529943_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|3529945_3530722_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 234
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3539603	3540218	5036925		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3539603_3540218_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 235
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3553908	3556695	5036925		uncultured_virus(100.0%)	1	NA	NA
WP_000249991.1|3553908_3556695_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 236
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3560816	3563287	5036925		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|3560816_3562226_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_001553782.1|3562237_3563287_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.9e-07
>prophage 237
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3577010	3579790	5036925		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718885.1|3577010_3577907_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621626.1|3578074_3578971_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3579004_3579790_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 238
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3588524	3591575	5036925		Escherichia_phage(100.0%)	1	NA	NA
WP_077627280.1|3588524_3591575_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 239
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3602360	3607220	5036925		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001350871.1|3602360_3602981_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.4e-63
WP_021523623.1|3603240_3604224_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_021523624.1|3604372_3605047_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3605151_3606525_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033719.1|3606521_3607220_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 240
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3618830	3623333	5036925		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3618830_3619676_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3620100_3620346_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3620430_3620916_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3621008_3621935_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3622001_3623333_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 241
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3636543	3641137	5036925		Pandoravirus(100.0%)	3	NA	NA
WP_021523631.1|3636543_3638094_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
WP_000105536.1|3638326_3639451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694071.1|3639583_3641137_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.7e-09
>prophage 242
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3647949	3655196	5036925		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424857.1|3647949_3648612_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185150.1|3648623_3651125_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|3651433_3652513_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3652527_3652848_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184858.1|3652898_3655196_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 243
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3667340	3668555	5036925		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691039.1|3667340_3668555_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.1	7.7e-45
>prophage 244
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3673995	3675312	5036925		Burkholderia_virus(100.0%)	1	NA	NA
WP_100273027.1|3673995_3675312_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	2.3e-58
>prophage 245
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3688155	3691208	5036925		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3688155_3689106_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3690023_3691208_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 246
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3695203	3703532	5036925		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3695203_3699232_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3699308_3703532_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 247
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3711828	3713592	5036925		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3711828_3712500_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|3712542_3713133_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3713319_3713592_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 248
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3718954	3720544	5036925		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_021523712.1|3718954_3720544_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 249
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3734241	3737925	5036925		Dickeya_phage(100.0%)	1	NA	NA
WP_000096035.1|3734241_3737925_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 250
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3762265	3763381	5036925		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3762265_3763381_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 251
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3770732	3771341	5036925		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3770732_3771341_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 252
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3783635	3786183	5036925		Escherichia_phage(50.0%)	2	NA	NA
WP_001296639.1|3783635_3785051_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_001147347.1|3785103_3786183_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 253
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3791753	3793172	5036925		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_021523645.1|3791753_3793172_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	4.3e-39
>prophage 254
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3803115	3806729	5036925		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357763.1|3803115_3805938_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_000168305.1|3806192_3806729_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 255
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3810547	3811897	5036925		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|3810547_3811897_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 256
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3818023	3819982	5036925		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078223.1|3818023_3819982_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
>prophage 257
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3829465	3830993	5036925		Planktothrix_phage(100.0%)	2	NA	NA
WP_100273033.1|3829465_3830170_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.0e-21
WP_000132446.1|3830156_3830993_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
>prophage 258
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3834910	3837058	5036925		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|3834910_3837058_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 259
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3842303	3848672	5036925		Tetraselmis_virus(50.0%)	5	NA	NA
WP_021523654.1|3842303_3844289_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	1.1e-149
WP_001171676.1|3844561_3845491_-	allose kinase	NA	NA	NA	NA	NA
WP_001314355.1|3845474_3846170_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_021523655.1|3846180_3847161_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_021516676.1|3847139_3848672_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
>prophage 260
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3854794	3856344	5036925		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611415.1|3854794_3855475_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
WP_001075531.1|3855585_3856344_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
>prophage 261
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3861948	3862737	5036925		Pithovirus(100.0%)	1	NA	NA
WP_001193414.1|3861948_3862737_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.1e-12
>prophage 262
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3867577	3869080	5036925		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|3867577_3869080_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 263
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3888643	3946202	5036925	tRNA,transposase,holin	Pseudomonas_phage(16.67%)	57	NA	NA
WP_100273035.1|3888643_3890161_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.8	3.5e-87
WP_000856826.1|3890397_3891855_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_001296667.1|3891913_3894061_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|3894140_3895475_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187191.1|3895840_3897379_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001588930.1|3898115_3898970_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839291.1|3899054_3899252_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761667.1|3899263_3899752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854747.1|3899748_3900126_-	toxin	NA	NA	NA	NA	NA
WP_021538665.1|3900215_3900584_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001825901.1|3900658_3900880_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	1.2e-09
WP_001186747.1|3900942_3901419_-	RadC family protein	NA	NA	NA	NA	NA
WP_021538211.1|3901434_3901920_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	3.1e-13
WP_001234693.1|3902011_3902830_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
WP_021538212.1|3902930_3903164_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001097364.1|3903169_3903847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010387.1|3903965_3904850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021538213.1|3904956_3905889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000816117.1|3905885_3906695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778605.1|3908027_3908558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075495.1|3909227_3909959_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000558152.1|3910479_3910932_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000332862.1|3911467_3912403_+	pseudouridine kinase	NA	NA	NA	NA	NA
WP_001290195.1|3912395_3913331_+	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_001328687.1|3913414_3914665_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_000370278.1|3914683_3915778_-	sugar kinase	NA	NA	NA	NA	NA
WP_001126810.1|3917096_3917663_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000991598.1|3917920_3918493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958091.1|3918561_3918798_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000426383.1|3919068_3920400_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_021538214.1|3920417_3921755_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_000433594.1|3921972_3922917_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_000926370.1|3923633_3924212_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.1	7.7e-11
WP_001270145.1|3924234_3925053_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001217009.1|3925052_3925571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502008.1|3926090_3926369_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502010.1|3926386_3926671_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001206281.1|3926685_3926964_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000570988.1|3927017_3928604_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_000599365.1|3928630_3928888_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_001288714.1|3928903_3930058_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000035053.1|3930084_3933471_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_001275637.1|3933522_3934470_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_001086630.1|3934481_3934946_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000564322.1|3934942_3935563_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_000139438.1|3935574_3936240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095890.1|3936272_3936674_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000481835.1|3936689_3937019_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_001328252.1|3937805_3939314_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_011478084.1|3939622_3939994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328253.1|3939920_3940367_-|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	1.3e-42
WP_000163269.1|3940388_3940715_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	96.3	3.5e-53
WP_001521630.1|3941188_3942367_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_001063847.1|3942359_3943811_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_001237092.1|3944444_3944699_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	60.3	3.5e-16
WP_000745631.1|3944720_3944819_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001328257.1|3945272_3946202_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	38.1	1.4e-51
>prophage 264
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3952817	3954083	5036925	integrase	Enterobacteria_phage(100.0%)	1	3945865:3945878	3961530:3961543
3945865:3945878	attL	GGGCAAATGCTTCC	NA	NA	NA	NA
WP_021538220.1|3952817_3954083_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_021538220.1|3952817_3954083_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
3961530:3961543	attR	GGGCAAATGCTTCC	NA	NA	NA	NA
>prophage 265
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3962417	3964401	5036925		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3962417_3962711_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3962754_3964401_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 266
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3968605	3969139	5036925		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3968605_3969139_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 267
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3974059	3975037	5036925		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3974059_3975037_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 268
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3983033	3983579	5036925		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_021523665.1|3983033_3983579_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.7e-28
>prophage 269
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	3987494	4000525	5036925	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990304.1|3987494_3988832_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
WP_001298688.1|3988841_3990689_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001280359.1|3990681_3991632_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3991717_3992026_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|3992101_3993382_+	GTPase HflX	NA	NA	NA	NA	NA
WP_001683484.1|3993467_3994727_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3994729_3995734_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3995815_3996013_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3996116_3997415_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3997619_3998045_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_021523666.1|3998083_4000525_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 270
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4004367	4005531	5036925		Ralstonia_phage(100.0%)	1	NA	NA
WP_001683485.1|4004367_4005531_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	6.4e-81
>prophage 271
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4016957	4020038	5036925		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000086755.1|4016957_4017602_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.0	5.2e-24
WP_000692345.1|4017620_4017842_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001424026.1|4017910_4018387_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|4018402_4018876_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_016244184.1|4019216_4020038_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	2.3e-45
>prophage 272
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4035539	4094162	5036925	transposase,integrase	Stx2-converting_phage(33.33%)	58	4082454:4082468	4089234:4089248
WP_002431009.1|4035539_4035920_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	97.6	2.3e-64
WP_000612632.1|4035916_4036264_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_000997960.1|4036313_4037699_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	2.0e-259
WP_000823243.1|4037937_4039296_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4040027_4040285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4042033_4042555_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001068910.1|4042551_4043505_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_100273040.1|4043591_4045916_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001534011.1|4045960_4046863_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4046859_4047858_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4047854_4048811_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4048811_4049579_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4050135_4050393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|4050790_4051216_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4051212_4051563_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|4051593_4053207_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001298062.1|4053281_4053833_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100273003.1|4054095_4055106_-	P fimbria tip G-adhesin PapG-II	NA	NA	NA	NA	NA
WP_021538146.1|4055149_4055650_-	P fimbrial tip protein PapF	NA	NA	NA	NA	NA
WP_021538147.1|4055724_4056246_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000597719.1|4056272_4056809_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000261304.1|4056818_4057400_-	protein papJ	NA	NA	NA	NA	NA
WP_000265730.1|4057436_4058171_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000654940.1|4058241_4060752_-	P fimbrial usher protein PapC	NA	NA	NA	NA	NA
WP_042043459.1|4060810_4061398_-	P fimbrial minor subunit PapH	NA	NA	NA	NA	NA
WP_021538233.1|4061461_4062025_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000930062.1|4062232_4062547_-	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000006206.1|4062969_4063203_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_096950962.1|4063766_4064980_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	2.4e-163
WP_001513409.1|4065070_4065184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|4067009_4067270_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109148.1|4067311_4067872_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001322949.1|4067911_4068340_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_001622039.1|4068892_4069108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405924.1|4069111_4069480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096951010.1|4069770_4070043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016244173.1|4074417_4074636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001545792.1|4076413_4076608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016244172.1|4076927_4077233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001545794.1|4077929_4078976_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	1.4e-34
WP_001545795.1|4078987_4081066_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000783757.1|4081134_4082166_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012601866.1|4082162_4083479_-	MFS transporter	NA	NA	NA	NA	NA
4082454:4082468	attL	CACAGCCAGAAGGGC	NA	NA	NA	NA
WP_000089291.1|4083551_4085093_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000621911.1|4085092_4085722_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001131670.1|4086004_4087186_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	47.9	2.2e-97
WP_042043470.1|4087360_4088176_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170781.1|4088175_4088862_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|4088990_4089266_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
4089234:4089248	attR	CACAGCCAGAAGGGC	NA	NA	NA	NA
WP_001216676.1|4089593_4089989_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4089995_4090310_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4090314_4090542_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4090583_4091033_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001350063.1|4091103_4091898_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_044804197.1|4092520_4092946_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.7	1.6e-42
WP_157796868.1|4092953_4093184_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	84.2	2.0e-31
WP_157796869.1|4093187_4093865_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	95.6	6.7e-115
WP_001413937.1|4093871_4094162_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	99.0	3.2e-42
>prophage 273
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4113586	4120074	5036925		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|4113586_4114117_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|4114426_4115383_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|4115522_4117025_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001297255.1|4117038_4118061_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|4118047_4119043_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4119075_4120074_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 274
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4124261	4127024	5036925		Vibrio_phage(100.0%)	2	NA	NA
WP_001106226.1|4124261_4124726_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|4124885_4127024_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 275
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4130662	4136759	5036925		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|4130662_4131610_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4131794_4131848_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|4131988_4134685_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|4134890_4135277_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4135349_4135811_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013064.1|4135823_4136759_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	2.5e-51
>prophage 276
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4145063	4157157	5036925	tRNA,integrase	Klosneuvirus(20.0%)	8	4152061:4152075	4164401:4164415
WP_000416407.1|4145063_4147919_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|4147918_4148362_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4148715_4150227_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|4150493_4151594_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4151593_4152676_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
4152061:4152075	attL	TGGCAACAACTTCGT	NA	NA	NA	NA
WP_001315985.1|4152794_4154297_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001315986.1|4154426_4155446_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	3.2e-44
WP_001218948.1|4155912_4157157_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.1e-83
4164401:4164415	attR	TGGCAACAACTTCGT	NA	NA	NA	NA
>prophage 277
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4161595	4166839	5036925		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_024174459.1|4161595_4164376_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.0	2.6e-08
WP_000431483.1|4164388_4166839_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	25.5	7.7e-20
>prophage 278
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4182272	4183781	5036925		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189111.1|4182272_4183781_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 279
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4195075	4204095	5036925	transposase	Enterobacteria_phage(33.33%)	9	NA	NA
WP_000416152.1|4195075_4196107_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916805.1|4196377_4196821_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705931.1|4196836_4197124_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345346.1|4197136_4198393_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001446914.1|4198603_4198843_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_088130945.1|4199228_4200457_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.0e-174
WP_000080172.1|4200514_4202128_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000624688.1|4202158_4202509_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_097730840.1|4202933_4204095_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 280
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4210017	4215370	5036925	transposase	Stx2-converting_phage(40.0%)	6	NA	NA
WP_000080195.1|4210017_4211631_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|4211661_4212012_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|4212008_4212434_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000177057.1|4212831_4213089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4213645_4214413_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4214413_4215370_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 281
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4223358	4223550	5036925		Escherichia_phage(100.0%)	1	NA	NA
WP_000937736.1|4223358_4223550_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
>prophage 282
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4227300	4227681	5036925		Stx2-converting_phage(100.0%)	1	NA	NA
WP_002431009.1|4227300_4227681_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	97.6	2.3e-64
>prophage 283
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4243175	4245310	5036925		Yersinia_phage(33.33%)	4	NA	NA
WP_001513427.1|4243175_4243994_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	4.4e-44
WP_000849588.1|4244048_4244534_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001560709.1|4244549_4245026_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|4245088_4245310_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 284
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4248930	4249911	5036925		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001295601.1|4248930_4249911_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	1.2e-101
>prophage 285
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4253271	4254947	5036925		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|4253271_4253874_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_097403191.1|4254350_4254947_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	6.6e-50
>prophage 286
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4265150	4266611	5036925		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_021538258.1|4265150_4266611_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 287
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4286320	4291685	5036925		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919540.1|4286320_4287985_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|4288033_4289395_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|4289609_4290524_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106043.1|4290662_4291685_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 288
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4294912	4296192	5036925		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|4294912_4295650_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098811.1|4295652_4296192_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 289
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4304016	4306892	5036925		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|4304016_4305606_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|4305998_4306604_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4306730_4306892_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 290
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4312396	4313719	5036925		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477822.1|4312396_4313719_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	4.0e-79
>prophage 291
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4321482	4327292	5036925		Enterococcus_phage(33.33%)	5	NA	NA
WP_000093834.1|4321482_4322715_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000513550.1|4322806_4323139_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|4323140_4323425_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046754.1|4323480_4325148_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409429.1|4325354_4327292_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 292
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4330569	4332683	5036925		Bacillus_phage(50.0%)	2	NA	NA
WP_001188687.1|4330569_4331259_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_021536056.1|4331258_4332683_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.1e-10
>prophage 293
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4344452	4345406	5036925		Cyanophage(100.0%)	1	NA	NA
WP_000130187.1|4344452_4345406_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 294
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4348542	4363066	5036925	tRNA	Chrysochromulina_ericina_virus(16.67%)	12	NA	NA
WP_000516135.1|4348542_4350459_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4350547_4351678_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|4351782_4351992_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274832.1|4352549_4353311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021535948.1|4353330_4354824_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	3.6e-28
WP_000494924.1|4354952_4356212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681386.1|4356446_4357613_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	3.0e-91
WP_000062878.1|4357672_4358578_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|4358673_4358937_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001337277.1|4359039_4359258_+	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
WP_100273049.1|4359265_4360207_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286823.1|4360249_4363066_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 295
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4367874	4369023	5036925		Halovirus(100.0%)	1	NA	NA
WP_021537798.1|4367874_4369023_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 296
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4374526	4380186	5036925		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001298634.1|4374526_4376080_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	2.7e-34
WP_000349942.1|4376152_4377370_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|4377498_4378641_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_021523576.1|4378671_4380186_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 297
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4388080	4390041	5036925		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|4388080_4388560_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|4388645_4388879_+	antitoxin	NA	NA	NA	NA	NA
WP_001160966.1|4388881_4389196_+	CcdB family protein	NA	NA	NA	NA	NA
WP_001765384.1|4389192_4390041_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 298
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4397786	4403208	5036925		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117001.1|4397786_4400693_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_100273050.1|4400856_4403208_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	8.7e-37
>prophage 299
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4411477	4412176	5036925		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916270.1|4411477_4412176_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.2	8.9e-22
>prophage 300
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4423654	4425379	5036925		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425644.1|4423654_4425379_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 301
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4451465	4452509	5036925		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4451465_4452509_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 302
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4456755	4457307	5036925		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923733.1|4456755_4457307_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.9e-11
>prophage 303
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4469724	4471149	5036925		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_021537795.1|4469724_4471149_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	8.4e-43
>prophage 304
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4483284	4485559	5036925		uncultured_virus(50.0%)	3	NA	NA
WP_000683335.1|4483284_4483821_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|4483861_4484524_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|4484632_4485559_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 305
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4488821	4489706	5036925	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339913.1|4488821_4489706_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.4	4.7e-60
>prophage 306
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4499596	4506366	5036925	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_100273052.1|4499596_4500979_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.1e-26
WP_000937411.1|4501017_4501944_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4501980_4502436_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396047.1|4502613_4503318_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_021523594.1|4503332_4503863_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_021523595.1|4503936_4506366_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.7	2.3e-40
>prophage 307
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4511501	4512299	5036925		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4511501_4512299_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 308
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4518210	4518555	5036925		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4518210_4518555_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 309
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4522484	4596820	5036925	tRNA,protease,plate	uncultured_Mediterranean_phage(10.0%)	59	NA	NA
WP_000753936.1|4522484_4523909_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
WP_000929439.1|4524063_4525221_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000272188.1|4525273_4525660_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186656.1|4525978_4526803_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_021537789.1|4526833_4529506_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|4529567_4530362_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|4530729_4531455_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|4531589_4532441_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|4532587_4533313_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|4533462_4534020_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811911.1|4534111_4535308_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_100273053.1|4535496_4536255_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922441.1|4536267_4537125_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001298422.1|4537136_4538489_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_021523600.1|4538518_4540951_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4541072_4541558_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|4541561_4542587_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4542691_4543147_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4543150_4543939_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139678.1|4543938_4545087_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569423.1|4545083_4545680_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294798.1|4545716_4549199_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000055742.1|4549211_4550171_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_021523601.1|4550268_4552410_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901082.1|4552466_4552856_+	VOC family protein	NA	NA	NA	NA	NA
WP_100273054.1|4552920_4554219_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|4554266_4554527_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4554513_4554714_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|4554879_4555425_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635528.1|4555421_4555844_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239186.1|4555857_4556568_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000360464.1|4556723_4557548_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260694.1|4557600_4559319_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094007.1|4559429_4560137_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202331.1|4560133_4560538_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|4560655_4561471_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294595.1|4561510_4562164_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4562156_4563188_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140167.1|4563375_4563948_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997016.1|4569709_4570513_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648563.1|4570509_4571424_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4571664_4572465_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211719.1|4572542_4573313_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644691.1|4573361_4574720_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001295200.1|4575579_4576302_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021523742.1|4576298_4576766_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001298181.1|4576830_4577562_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	5.8e-40
WP_001049698.1|4578099_4578885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013181.1|4579224_4579704_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_021523744.1|4584633_4586082_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021535947.1|4586086_4586830_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614310.1|4586826_4589589_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	3.6e-82
WP_001282177.1|4589598_4590363_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000224522.1|4590367_4591714_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_021523747.1|4591716_4592241_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|4592237_4593530_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896713.1|4593534_4594584_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_157796870.1|4594547_4596389_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946069.1|4596394_4596820_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 310
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4600275	4604844	5036925	transposase	Ralstonia_phage(50.0%)	3	NA	NA
WP_100273056.1|4600275_4602258_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	3.5e-23
WP_000571853.1|4602364_4603411_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_097730840.1|4603682_4604844_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 311
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4613100	4616423	5036925		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|4613100_4613679_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4613883_4614651_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4614621_4615362_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|4615673_4616423_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
>prophage 312
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4622494	4623646	5036925		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001335538.1|4622494_4623646_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
>prophage 313
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4628323	4657190	5036925	integrase	Enterobacteria_phage(26.67%)	29	4628930:4628944	4636428:4636442
WP_000749899.1|4628323_4629379_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
4628930:4628944	attL	ACCGCTGGCGCGTTT	NA	NA	NA	NA
WP_001285288.1|4629666_4630770_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|4630781_4632035_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_021546205.1|4632390_4633605_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000251023.1|4633747_4634629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|4634826_4635024_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_021542405.1|4635023_4635455_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_054377109.1|4635467_4636301_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000476150.1|4636293_4636476_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
4636428:4636442	attR	ACCGCTGGCGCGTTT	NA	NA	NA	NA
WP_100273057.1|4636469_4637498_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_001065738.1|4637490_4637685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|4637681_4637945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|4637941_4638163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529721.1|4638155_4638758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016234635.1|4638770_4641122_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.2	9.9e-73
WP_000987941.1|4641298_4641529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000070012.1|4641518_4642256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273058.1|4643036_4644503_+	acyltransferase	NA	B6SCW4	Bacteriophage	53.3	1.1e-106
WP_019841347.1|4644502_4646608_+	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	1.4e-86
WP_016231257.1|4646670_4647108_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_021538549.1|4647887_4648865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032329946.1|4648894_4649335_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.7	2.6e-43
WP_000617443.1|4649487_4649769_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188903.1|4650064_4650250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284450.1|4650370_4650913_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001350215.1|4650905_4651265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772639.1|4651636_4651975_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_001298126.1|4652409_4652934_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021523760.1|4653059_4657190_-	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	7.3e-281
>prophage 314
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4675472	4676324	5036925		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|4675472_4676324_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 315
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4682369	4685674	5036925		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295799.1|4682369_4683239_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_021523762.1|4683398_4683992_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4684003_4684240_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046332.1|4684348_4685674_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
>prophage 316
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4695599	4703168	5036925	holin,integrase	Escherichia_phage(33.33%)	5	4694560:4694573	4709643:4709656
4694560:4694573	attL	TTCACCAACGGCAA	NA	NA	NA	NA
WP_001295805.1|4695599_4696163_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_021523763.1|4697248_4698919_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
WP_021523764.1|4698932_4700405_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021523765.1|4700418_4701006_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|4701134_4703168_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
4709643:4709656	attR	TTCACCAACGGCAA	NA	NA	NA	NA
>prophage 317
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4715998	4720536	5036925		Bacillus_virus(50.0%)	4	NA	NA
WP_000447324.1|4715998_4717483_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	6.1e-12
WP_000818888.1|4717475_4718447_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750342.1|4718443_4719400_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021523770.1|4719486_4720536_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 318
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4729031	4730918	5036925		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021535944.1|4729031_4730918_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	1.8e-53
>prophage 319
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4735775	4743058	5036925		Herpes_simplex_virus(33.33%)	5	NA	NA
WP_001533000.1|4735775_4738850_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.6	0.0e+00
WP_000805859.1|4738972_4740055_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	2.4e-191
WP_001096710.1|4740256_4740796_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419066.1|4741022_4741856_-	S-formylglutathione hydrolase FrmB	NA	NA	NA	NA	NA
WP_000842109.1|4741948_4743058_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 320
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4748350	4749118	5036925		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|4748350_4749118_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 321
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4756026	4757184	5036925		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830766.1|4756026_4757184_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 322
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4764598	4765714	5036925		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|4764598_4765714_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 323
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4770000	4780099	5036925		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4770000_4770912_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219295.1|4771037_4771946_+	fructokinase	NA	NA	NA	NA	NA
WP_001331503.1|4772214_4773399_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_021523783.1|4773524_4776668_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221292.1|4776664_4777867_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4778056_4778746_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893597.1|4778803_4780099_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.2	4.5e-27
>prophage 324
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4787050	4795893	5036925	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4787050_4788178_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4788200_4788533_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|4788560_4790408_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4790418_4791390_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4791519_4791867_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295827.1|4791904_4792789_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001298536.1|4793087_4793627_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4793777_4794227_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150440.1|4794230_4795334_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_001021161.1|4795422_4795893_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 325
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4817326	4822373	5036925	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4817326_4817950_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4818075_4819350_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4819537_4821892_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4822100_4822373_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 326
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4825513	4826209	5036925		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4825513_4826209_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 327
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4829532	4833079	5036925		Bacillus_phage(100.0%)	2	NA	NA
WP_100273062.1|4829532_4831305_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.8e-50
WP_021523793.1|4831297_4833079_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	5.2e-42
>prophage 328
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4841915	4845065	5036925		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|4841915_4845065_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 329
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4852073	4860518	5036925		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4852073_4852625_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|4852753_4854685_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4854737_4855067_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4855066_4855672_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4855781_4857656_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_021523796.1|4857836_4858481_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|4858612_4859575_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801820.1|4859549_4860518_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	6.0e-16
>prophage 330
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4870080	4873322	5036925		Escherichia_phage(66.67%)	3	NA	NA
WP_000057524.1|4870080_4870383_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	2.2e-41
WP_000806442.1|4870418_4870760_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_021513535.1|4870817_4873322_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.2e-115
>prophage 331
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4879203	4879881	5036925		Bacillus_virus(100.0%)	1	NA	NA
WP_021523798.1|4879203_4879881_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.4e-26
>prophage 332
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4883017	4883704	5036925		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4883017_4883704_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 333
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4890039	4891821	5036925		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001313634.1|4890039_4891821_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 334
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4898011	4899157	5036925		Streptococcus_phage(100.0%)	1	NA	NA
WP_021523803.1|4898011_4899157_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
>prophage 335
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4911092	4915570	5036925	tRNA,tail	Moumouvirus(33.33%)	6	NA	NA
WP_000912345.1|4911092_4912478_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143501.1|4912513_4913035_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4913142_4913355_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4913356_4914223_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000025786.1|4914263_4914461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259980.1|4915264_4915570_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
>prophage 336
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4924362	4926478	5036925		Hokovirus(50.0%)	2	NA	NA
WP_000253820.1|4924362_4925805_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000770953.1|4925794_4926478_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 337
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4929623	4932767	5036925		Leptospira_phage(100.0%)	1	NA	NA
WP_000573983.1|4929623_4932767_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.3e-59
>prophage 338
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4943800	4949843	5036925		Tupanvirus(50.0%)	3	NA	NA
WP_021523805.1|4943800_4947682_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	2.2e-61
WP_016233919.1|4947897_4949031_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140646.1|4949027_4949843_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 339
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4964113	4965936	5036925		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|4964113_4964743_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_100273066.1|4964715_4965936_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	7.9e-58
>prophage 340
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4969042	4971157	5036925		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4969042_4970608_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001295855.1|4970728_4971157_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
>prophage 341
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4985246	4985893	5036925		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4985246_4985456_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4985509_4985893_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 342
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4990309	4992749	5036925		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4990309_4991521_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_021523809.1|4991660_4992749_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 343
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	4999759	5004882	5036925	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_100273067.1|4999759_5002342_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
WP_001044880.1|5002576_5003059_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207536.1|5003103_5004039_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_021523810.1|5004156_5004882_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	2.2e-31
>prophage 344
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	5012826	5013906	5036925		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|5012826_5013906_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 345
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	5018004	5019669	5036925		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337076.1|5018004_5019669_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	1.4e-84
>prophage 346
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	5024294	5026241	5036925		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|5024294_5026241_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 347
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	5029295	5030054	5036925		Moraxella_phage(100.0%)	1	NA	NA
WP_000480543.1|5029295_5030054_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 348
NZ_CP024886	Escherichia coli strain AR_0017 chromosome, complete genome	5036925	5034547	5035309	5036925		Escherichia_phage(100.0%)	1	NA	NA
WP_000679501.1|5034547_5035309_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
>prophage 1
NZ_CP024887	Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence	102544	0	5245	102544		Escherichia_phage(50.0%)	6	NA	NA
WP_000239529.1|777_1053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633911.1|1046_1691_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_001103694.1|1919_2891_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000340835.1|2895_3288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000109079.1|4562_5000_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000619112.1|4996_5245_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
>prophage 2
NZ_CP024887	Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence	102544	8841	9525	102544		Vibrio_phage(100.0%)	1	NA	NA
WP_000086169.1|8841_9525_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	2.8e-28
>prophage 3
NZ_CP024887	Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence	102544	13277	85725	102544	tail,transposase,integrase	Escherichia_phage(21.05%)	69	34306:34322	95797:95813
WP_100273082.1|13277_13805_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.6	3.0e-46
WP_024261882.1|13861_14095_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	1.5e-05
WP_100273083.1|14156_16115_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.6e-20
WP_000845900.1|16169_16604_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_100273084.1|17315_17867_+	hypothetical protein	NA	A0A096XER3	Escherichia_phage	55.3	7.5e-16
WP_000117628.1|18373_18874_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000218859.1|19602_20037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052994747.1|20129_20396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096923607.1|20460_21375_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.5e-66
WP_100273085.1|21435_21630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148285.1|21660_21912_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100273087.1|22491_23340_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_089618595.1|23426_23762_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291057.1|23994_24327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991407.1|24338_27059_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_000077653.1|27279_29580_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_000152384.1|29560_30685_-	DsbC family protein	NA	NA	NA	NA	NA
WP_001346191.1|32353_32500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081067.1|33080_33332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000598962.1|33721_34189_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	34.9	4.0e-18
34306:34322	attL	GCTGATATCCGTGATGA	NA	NA	NA	NA
WP_001155250.1|34348_34972_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000266543.1|35169_35385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001363143.1|35388_35757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322946.1|36056_36329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302699.1|36628_36781_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_015056434.1|37407_38055_-	plasmid IncI1-type surface exclusion protein ExcA	NA	NA	NA	NA	NA
WP_000691811.1|38142_40302_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_088137400.1|41708_42833_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	43.7	3.4e-47
WP_072252537.1|42887_43160_+	shufflon protein B	NA	NA	NA	NA	NA
WP_089577059.1|43980_44358_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	43.4	6.7e-24
WP_100273089.1|44362_45685_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_059330920.1|45702_46332_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_088137398.1|46346_46832_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_088137397.1|46876_47413_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_088137396.1|47474_48569_-	type II secretion protein F	NA	NA	NA	NA	NA
WP_088137395.1|48570_50079_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_088137394.1|50181_50640_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_088137393.1|50629_51925_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_001035559.1|51945_53565_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_088137392.1|53596_54034_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_088137391.1|54037_55105_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_088137390.1|55223_55649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137389.1|55641_56529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137388.1|56618_56708_-	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_088137387.1|56781_57291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137385.1|57442_58108_-	traC	NA	NA	NA	NA	NA
WP_088137384.1|58248_58890_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_032145183.1|59600_60464_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001067838.1|61511_62216_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_077459403.1|62245_62473_+	scsC protein	NA	NA	NA	NA	NA
WP_000949451.1|62462_62969_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|63151_63967_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001332815.1|64313_66200_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|66240_66768_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|66871_68251_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|68253_69537_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729218.1|69526_70657_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|70661_71357_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|71343_71829_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|71853_72339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336919.1|74323_74893_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.2	6.4e-26
WP_001189111.1|75458_76967_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000839179.1|79191_79596_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|79592_79940_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000255956.1|81009_82032_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001300609.1|82028_82811_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000080195.1|83308_84922_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|84952_85303_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|85299_85725_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
95797:95813	attR	GCTGATATCCGTGATGA	NA	NA	NA	NA
>prophage 4
NZ_CP024887	Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence	102544	93064	98646	102544	transposase,integrase	Stx2-converting_phage(60.0%)	5	92812:92825	93907:93920
92812:92825	attL	ATCTGCCTGTTCCT	NA	NA	NA	NA
WP_001066947.1|93064_93805_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309253.1|94047_95025_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
93907:93920	attR	AGGAACAGGCAGAT	NA	NA	NA	NA
WP_001309726.1|96097_96205_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	9.7e-13
WP_000612591.1|97921_98269_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|98265_98646_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
