The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024898	UNVERIFIED_ORG: Citrobacter freundii strain AR_0021 chromosome, complete genome	4784670	2754126	2762690	4784670	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_032943978.1|2754126_2755074_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
WP_048234924.1|2755057_2755789_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|2755769_2755877_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|2756076_2756808_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_100272128.1|2757033_2758719_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	7.4e-280
WP_003840155.1|2758715_2759435_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003834454.1|2759481_2759952_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
WP_100272129.1|2759992_2760451_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.3	7.1e-52
WP_032943974.1|2760656_2762690_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	8.9e-54
>prophage 2
NZ_CP024898	UNVERIFIED_ORG: Citrobacter freundii strain AR_0021 chromosome, complete genome	4784670	2857269	2865463	4784670		Enterobacteria_phage(42.86%)	8	NA	NA
WP_100272163.1|2857269_2858664_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.0	5.5e-23
WP_060854693.1|2858829_2859723_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.7	1.6e-44
WP_100272164.1|2860092_2861178_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	4.4e-100
WP_100272165.1|2861177_2862077_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	1.0e-30
WP_100272166.1|2862128_2863007_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	1.6e-105
WP_100272167.1|2863011_2863560_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.6	1.2e-50
WP_100272168.1|2863602_2864748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272169.1|2864680_2865463_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	32.4	8.2e-08
>prophage 3
NZ_CP024898	UNVERIFIED_ORG: Citrobacter freundii strain AR_0021 chromosome, complete genome	4784670	2938136	2947949	4784670		Escherichia_phage(30.0%)	14	NA	NA
WP_072213458.1|2938136_2938808_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	3.9e-67
WP_044700602.1|2938931_2939285_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_000855179.1|2939332_2939695_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_100272201.1|2939712_2941464_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_100272202.1|2941511_2942801_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.7	2.7e-173
WP_100272203.1|2942813_2943239_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	3.3e-51
WP_065554936.1|2943305_2943602_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100272204.1|2943702_2944794_+	permease	NA	NA	NA	NA	NA
WP_065554934.1|2945076_2945310_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	2.7e-31
WP_100272205.1|2945355_2945601_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	62.2	1.3e-20
WP_065554933.1|2945730_2945931_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	1.9e-17
WP_048221174.1|2945933_2946293_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	64.4	4.0e-42
WP_100272206.1|2946289_2947330_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	50.4	2.1e-96
WP_060683642.1|2947343_2947949_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	72.1	5.6e-81
>prophage 4
NZ_CP024898	UNVERIFIED_ORG: Citrobacter freundii strain AR_0021 chromosome, complete genome	4784670	2992719	3030648	4784670	head,integrase,holin,portal,protease,capsid,terminase,tail	Salmonella_phage(28.57%)	55	2992538:2992597	3030835:3030958
2992538:2992597	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGG	NA	NA	NA	NA
WP_100272223.1|2992719_2993730_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	87.5	9.5e-174
WP_065944714.1|2993729_2993957_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	88.0	4.6e-36
WP_100272225.1|2994342_2994558_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	1.7e-08
WP_100272226.1|2994554_2994959_-	DUF551 domain-containing protein	NA	G5DA83	Enterobacteria_phage	37.0	7.2e-08
WP_100272896.1|2995460_2995769_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	73.9	3.8e-33
WP_100272227.1|2995773_2996187_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	76.6	3.8e-20
WP_100272228.1|2996170_2997211_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.8	7.7e-163
WP_100272229.1|2997210_2997624_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	72.1	6.8e-46
WP_100272230.1|2997671_2998109_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	42.8	6.2e-29
WP_100272231.1|2998996_2999203_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	1.6e-16
WP_100272232.1|2999241_2999592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100272233.1|2999591_3000026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165919942.1|3000042_3000750_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	55.8	2.4e-75
WP_047715881.1|3000829_3001081_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	52.2	2.7e-13
WP_100272234.1|3001109_3001664_+	hypothetical protein	NA	U5P4K1	Shigella_phage	51.9	2.9e-47
WP_100272235.1|3001827_3002034_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.9	1.2e-14
WP_100272236.1|3001996_3002917_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	84.1	4.7e-63
WP_100272237.1|3002919_3003363_+	hypothetical protein	NA	U5P0U0	Shigella_phage	30.4	1.4e-12
WP_100272238.1|3003704_3004094_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	66.7	2.7e-44
WP_100272239.1|3004110_3004836_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	53.5	1.5e-56
WP_100272240.1|3004832_3005822_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	70.8	1.9e-142
WP_100272241.1|3005836_3006415_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	54.4	3.3e-46
WP_100272242.1|3006673_3006970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272243.1|3006981_3007485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008784467.1|3007584_3007971_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_072161075.1|3007957_3008239_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	7.0e-18
WP_100272244.1|3008238_3008853_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	8.5e-93
WP_100272245.1|3008860_3009130_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	1.7e-21
WP_100272247.1|3009369_3009726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100272248.1|3009916_3010267_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.2	3.3e-49
WP_100272249.1|3010423_3010897_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	88.5	3.9e-77
WP_100272250.1|3010896_3012654_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.3	0.0e+00
WP_163208360.1|3012662_3012812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038642109.1|3012801_3014028_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	86.5	9.0e-211
WP_058806104.1|3014020_3014620_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	7.8e-91
WP_048997965.1|3014629_3015847_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.8	1.2e-170
WP_038642103.1|3015924_3016245_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	53.9	2.8e-23
WP_100272251.1|3016254_3016593_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	1.7e-39
WP_100272252.1|3016589_3017039_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	1.4e-65
WP_058806107.1|3017035_3017383_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	74.8	7.0e-44
WP_038642094.1|3017440_3018145_+|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	5.7e-93
WP_100272253.1|3018172_3018544_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	86.8	1.9e-55
WP_100272254.1|3018555_3018846_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	90.6	1.8e-40
WP_038642089.1|3018904_3019084_+	hypothetical protein	NA	K7PH36	Enterobacterial_phage	84.7	6.2e-20
WP_100272255.1|3019129_3022414_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	70.5	0.0e+00
WP_100272256.1|3022566_3022782_-	hypothetical protein	NA	H6WRW0	Salmonella_phage	57.6	2.2e-11
WP_100272257.1|3022952_3023546_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	97.0	6.3e-109
WP_049001813.1|3023545_3024130_+	DUF2163 domain-containing protein	NA	S4TND4	Salmonella_phage	95.4	2.3e-103
WP_100272258.1|3024136_3024535_+	hypothetical protein	NA	S4TR39	Salmonella_phage	93.9	2.5e-69
WP_100272259.1|3024534_3027249_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	90.7	0.0e+00
WP_100272260.1|3027248_3028193_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.1	1.6e-119
WP_100272261.1|3028202_3029561_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.5	4.3e-113
WP_003841691.1|3029695_3029938_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.2	1.2e-29
WP_000982849.1|3030013_3030256_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	3.8e-20
WP_047357985.1|3030258_3030648_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	7.8e-52
3030835:3030958	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGGGAAAGAACAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 5
NZ_CP024898	UNVERIFIED_ORG: Citrobacter freundii strain AR_0021 chromosome, complete genome	4784670	3257615	3310495	4784670	head,integrase,holin,coat,terminase,tail	Enterobacteria_phage(36.0%)	72	3245733:3245747	3291030:3291044
3245733:3245747	attL	TTGCCTGCGCACGAA	NA	NA	NA	NA
WP_100272326.1|3257615_3258452_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
WP_003020691.1|3258489_3258819_-	YciU family protein	NA	NA	NA	NA	NA
WP_003020687.1|3258853_3260314_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_094301000.1|3260456_3260630_+	YciY family protein	NA	NA	NA	NA	NA
WP_100272327.1|3260884_3262078_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	84.1	2.6e-202
WP_008322518.1|3262070_3262271_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
WP_008322517.1|3262316_3262559_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	82.3	2.6e-29
WP_100272328.1|3262598_3263639_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	75.9	2.0e-155
WP_100272329.1|3263653_3266503_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	60.9	4.4e-293
WP_170975043.1|3266642_3266801_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	92.3	1.3e-21
WP_100272330.1|3266811_3267009_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097728169.1|3267008_3267209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191553936.1|3267205_3267364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049041823.1|3267484_3267778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191553937.1|3267758_3268028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040230817.1|3268247_3268472_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	63.2	5.7e-15
WP_019076926.1|3268503_3268884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040230821.1|3268973_3269882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322488.1|3270077_3270776_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.3	1.0e-102
WP_100272333.1|3270886_3271108_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	67.6	8.2e-22
WP_100272334.1|3271133_3271673_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	86.0	8.5e-81
WP_100272335.1|3271840_3272788_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	33.0	1.8e-25
WP_100272336.1|3272790_3273540_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	87.1	5.3e-121
WP_100272337.1|3273558_3273870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272338.1|3273866_3274352_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	8.8e-69
WP_100272339.1|3274884_3275652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272340.1|3275648_3276047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272341.1|3276751_3277009_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	77.3	4.6e-24
WP_100272342.1|3277008_3277263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064545070.1|3277364_3277964_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	97.0	2.9e-106
WP_100272343.1|3277963_3278170_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	72.1	1.8e-23
WP_100272344.1|3278172_3278781_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	61.8	7.0e-47
WP_100272345.1|3278777_3278915_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	88.4	1.2e-15
WP_100272346.1|3278911_3279601_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.2	3.3e-61
WP_100272347.1|3280593_3280782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003826170.1|3281128_3281407_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	97.8	3.3e-44
WP_100272348.1|3281378_3281927_+	lysozyme	NA	K7PM52	Enterobacteria_phage	94.5	3.2e-99
WP_100272349.1|3281923_3282457_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	3.0e-09
WP_071891841.1|3282460_3282676_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_191238446.1|3282654_3282825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272350.1|3282915_3283302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172960224.1|3283378_3284020_+	hypothetical protein	NA	I6S676	Salmonella_phage	89.5	2.1e-110
WP_100272351.1|3284051_3284540_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	75.6	2.5e-47
WP_100272352.1|3284536_3286084_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.9	2.5e-282
WP_100272353.1|3286095_3287547_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	67.0	2.6e-177
WP_191553938.1|3287494_3288481_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.1	5.7e-107
WP_100272355.1|3288498_3289887_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	69.4	2.6e-166
WP_100272356.1|3289890_3290331_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	65.1	2.0e-43
WP_100272357.1|3290341_3291418_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	75.1	3.4e-153
3291030:3291044	attR	TTCGTGCGCAGGCAA	NA	NA	NA	NA
WP_100272358.1|3291427_3291793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272359.1|3291795_3292176_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	7.5e-31
WP_100272360.1|3292175_3292346_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_100272361.1|3292349_3292712_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	61.7	5.1e-37
WP_100272362.1|3292701_3293070_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	75.4	1.8e-45
WP_100272363.1|3293066_3293450_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	7.5e-39
WP_100272364.1|3293512_3294256_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	82.9	1.2e-72
WP_100272365.1|3294314_3295007_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	60.8	1.9e-72
WP_100272366.1|3295148_3295424_+	cor protein	NA	Q5G8V7	Enterobacteria_phage	67.5	1.2e-22
WP_100272367.1|3295557_3296229_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	48.5	1.3e-46
WP_100272368.1|3296294_3299627_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	85.4	0.0e+00
WP_100272369.1|3299629_3299980_+|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	87.1	2.6e-54
WP_080192186.1|3299976_3300264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031608852.1|3300306_3301011_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.4	6.0e-135
WP_100272370.1|3301010_3301730_+	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	83.7	5.8e-125
WP_100272371.1|3301672_3302200_+|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	78.1	2.4e-56
WP_100272372.1|3302209_3305392_+	host specificity protein J	NA	A0A1V0E5M1	Salmonella_phage	91.7	0.0e+00
WP_100272373.1|3305391_3306336_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	68.0	6.7e-121
WP_100272374.1|3306345_3307710_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.5	6.7e-114
WP_008322426.1|3307844_3308087_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_003826234.1|3308165_3308555_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.0e-51
WP_100272375.1|3309248_3309569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100272376.1|3309823_3310495_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
>prophage 6
NZ_CP024898	UNVERIFIED_ORG: Citrobacter freundii strain AR_0021 chromosome, complete genome	4784670	3385289	3393489	4784670	tRNA	uncultured_Caudovirales_phage(16.67%)	9	NA	NA
WP_100272394.1|3385289_3386399_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.9	1.6e-09
WP_032943570.1|3386553_3387537_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_191553967.1|3387812_3387980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008784890.1|3388008_3389382_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.3e-52
WP_032943567.1|3389460_3390396_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	9.8e-141
WP_100272395.1|3391030_3391273_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	3.4e-29
WP_003833207.1|3391458_3391893_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
WP_003833205.1|3391974_3392187_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_100272396.1|3392334_3393489_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.0	7.4e-114
>prophage 7
NZ_CP024898	UNVERIFIED_ORG: Citrobacter freundii strain AR_0021 chromosome, complete genome	4784670	3810706	3820714	4784670	tRNA	Brazilian_cedratvirus(28.57%)	10	NA	NA
WP_100272565.1|3810706_3811486_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.3e-10
WP_100272566.1|3811482_3812925_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	1.3e-51
WP_048214327.1|3812986_3813700_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|3814018_3814483_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_008784579.1|3814560_3815310_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_048226751.1|3815309_3815861_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_048214330.1|3815921_3816902_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.2	8.7e-15
WP_003030571.1|3817023_3817323_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_032943162.1|3817327_3819715_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|3819730_3820714_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 8
NZ_CP024898	UNVERIFIED_ORG: Citrobacter freundii strain AR_0021 chromosome, complete genome	4784670	4479187	4487317	4784670		Escherichia_phage(50.0%)	8	NA	NA
WP_048235896.1|4479187_4480018_-	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	6.0e-17
WP_003831264.1|4480293_4480704_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_003022101.1|4480887_4481316_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_100272780.1|4481385_4482153_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_008784074.1|4482152_4482710_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_048235898.1|4482706_4484977_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.0	2.6e-46
WP_008784072.1|4484973_4485528_-	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	29.0	7.6e-08
WP_020996553.1|4485751_4487317_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
