The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024883	Klebsiella aerogenes strain AR_0007 chromosome, complete genome	5118619	2353211	2405379	5118619	integrase,tail,coat,terminase,portal,tRNA,holin	Salmonella_phage(21.62%)	58	2364951:2364966	2416664:2416679
WP_015703188.1|2353211_2354282_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_020078167.1|2354337_2355027_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	4.9e-57
WP_002914084.1|2355339_2355723_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_015370281.1|2355768_2357100_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.1	1.5e-46
WP_045386924.1|2357230_2357968_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_045386927.1|2357952_2359572_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_157797648.1|2359896_2359998_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_002914074.1|2359994_2360570_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_015370285.1|2360602_2361253_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_020078169.1|2361252_2362209_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_042893105.1|2362205_2362685_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_015370288.1|2362869_2364669_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_100279529.1|2364683_2365658_+	signal peptidase I	NA	NA	NA	NA	NA
2364951:2364966	attL	GGTTCGATGATGCCGA	NA	NA	NA	NA
WP_020078171.1|2365911_2366592_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.3e-20
WP_015370290.1|2366588_2367494_+	GTPase Era	NA	NA	NA	NA	NA
WP_015370291.1|2367505_2368243_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_100279530.1|2368254_2368986_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_015370293.1|2368985_2369366_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_032707225.1|2369374_2369635_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	55.8	1.0e-18
WP_100279531.1|2369849_2371247_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024154042.1|2371243_2371444_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100279532.1|2371440_2372844_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.6	7.1e-212
WP_100279533.1|2372899_2373613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047740568.1|2373605_2373875_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	8.7e-26
WP_100279534.1|2373950_2374178_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100279535.1|2374244_2375003_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_100279536.1|2375059_2377123_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.5	5.7e-274
WP_157797649.1|2377150_2377675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279538.1|2377715_2378264_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	64.8	6.0e-66
WP_100279539.1|2378280_2379522_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.6	1.5e-133
WP_100279540.1|2379525_2380422_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	51.6	1.8e-06
WP_157797650.1|2380727_2380898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100279542.1|2381182_2381806_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	48.5	2.2e-35
WP_004141056.1|2381926_2382139_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	43.8	2.4e-07
WP_100279543.1|2382142_2384311_+	replication protein	NA	B6SCY1	Bacteriophage	72.2	1.2e-173
WP_032707206.1|2384616_2385051_+	antitermination protein Q	NA	B6SD39	Bacteriophage	59.3	1.4e-41
WP_020947700.1|2385389_2385731_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	67.9	5.3e-28
WP_032707202.1|2385717_2386197_+	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	79.1	2.1e-67
WP_100280067.1|2386274_2386604_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.9	3.3e-19
WP_100279544.1|2386759_2387140_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	63.5	1.8e-40
WP_087867809.1|2387205_2387448_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	68.5	6.0e-18
WP_100279545.1|2387456_2387990_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	32.8	1.6e-10
WP_032707197.1|2388021_2388582_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	68.4	2.0e-56
WP_100279546.1|2388562_2390068_+|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	84.5	1.9e-263
WP_032707369.1|2390071_2392249_+|portal	portal protein	portal	G5DA97	Enterobacteria_phage	75.8	4.4e-301
WP_087867812.1|2392263_2393175_+	scaffolding protein	NA	A0A0M3ULI9	Salmonella_phage	71.9	5.3e-115
WP_100279547.1|2393174_2394464_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	74.7	3.9e-188
WP_032707191.1|2394513_2394732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087867813.1|2394750_2395254_+	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	64.2	5.6e-50
WP_080687406.1|2395231_2396653_+	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	70.2	1.1e-204
WP_100279548.1|2396652_2397483_+|tail	phage tail protein	tail	A0A192Y6T9	Salmonella_phage	65.6	6.2e-46
WP_100279549.1|2397482_2397962_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	2.9e-64
WP_100279550.1|2397936_2398587_+	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	49.3	4.5e-28
WP_100279551.1|2398596_2399940_+	DNA injection protein	NA	Q716G3	Shigella_phage	51.5	1.2e-62
WP_100279552.1|2399939_2402660_+	transglycosylase SLT domain-containing protein	NA	A0A2D1GLK8	Escherichia_phage	30.6	1.1e-99
WP_100279553.1|2402732_2403020_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	51.5	9.9e-20
WP_049029804.1|2403046_2403295_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	54.5	1.5e-16
WP_100279554.1|2403432_2405379_+	hypothetical protein	NA	Q716G1	Shigella_phage	45.6	2.8e-33
2416664:2416679	attR	GGTTCGATGATGCCGA	NA	NA	NA	NA
>prophage 2
NZ_CP024883	Klebsiella aerogenes strain AR_0007 chromosome, complete genome	5118619	2538597	2625238	5118619	integrase,tail,capsid,head,terminase,portal,tRNA,holin,protease	Klebsiella_phage(30.36%)	97	2561649:2561673	2602612:2602636
WP_020078209.1|2538597_2540016_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015365514.1|2540071_2540467_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013878158.1|2540474_2540828_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_100279573.1|2541450_2543634_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013878156.1|2543689_2544892_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_032715060.1|2545237_2546473_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_013878154.1|2546512_2546869_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_032715058.1|2546996_2547989_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_100279574.1|2548165_2549827_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_015365522.1|2551323_2552289_+	glucokinase	NA	NA	NA	NA	NA
WP_013878149.1|2552332_2553076_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.8	5.6e-14
WP_013878148.1|2553087_2554785_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.8	1.5e-46
WP_013878147.1|2555166_2556405_+	alanine transaminase	NA	NA	NA	NA	NA
WP_077777854.1|2556449_2556521_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_015365525.1|2556887_2558084_-	MFS transporter	NA	NA	NA	NA	NA
WP_015365526.1|2558083_2558539_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.8	2.4e-12
WP_032715055.1|2558697_2559375_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_015365529.1|2559723_2560557_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	20.8	9.1e-05
WP_015365531.1|2560936_2561428_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
2561649:2561673	attL	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_100279575.1|2561867_2563043_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	84.0	2.9e-198
WP_100279576.1|2563171_2563492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279577.1|2563484_2563844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074195452.1|2563940_2564126_-	hypothetical protein	NA	A0A2R2Z2X2	Escherichia_phage	61.1	2.6e-13
WP_100279578.1|2564147_2564705_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	64.9	4.3e-67
WP_100279579.1|2565700_2566054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280070.1|2566493_2567030_-	hypothetical protein	NA	J9Q748	Salmonella_phage	76.6	2.4e-75
WP_100279580.1|2567032_2567461_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	46.0	5.0e-07
WP_058649498.1|2567457_2567712_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	52.1	3.1e-09
WP_020804603.1|2567704_2567908_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_100279581.1|2567904_2568690_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	49.4	7.9e-59
WP_087796267.1|2568689_2568989_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	6.5e-14
WP_100280071.1|2569555_2570203_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.0	1.0e-72
WP_047047442.1|2570307_2570505_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	3.5e-16
WP_047047439.1|2570530_2570992_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.5	2.1e-67
WP_072056998.1|2571229_2571442_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	1.9e-15
WP_100279582.1|2571398_2572313_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	55.5	6.8e-30
WP_100279583.1|2572309_2573119_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	1.3e-109
WP_032737684.1|2573128_2573506_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	1.8e-48
WP_100279584.1|2573518_2574499_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	6.4e-135
WP_040088784.1|2574513_2574876_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	95.0	9.5e-60
WP_040088785.1|2574898_2575342_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	70.1	4.6e-48
WP_077268298.1|2575345_2576059_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	91.1	2.7e-122
WP_024176410.1|2576609_2576909_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_004184488.1|2576905_2577445_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_070585058.1|2577441_2577789_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	2.2e-37
WP_100279585.1|2577785_2578061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279586.1|2578011_2578200_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	2.8e-23
WP_100279587.1|2578462_2578720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279588.1|2578849_2579095_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	90.1	4.8e-31
WP_100279589.1|2579164_2579392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040177136.1|2579559_2579742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054628610.1|2579749_2579977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279590.1|2579994_2581452_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.3	1.5e-268
WP_100279591.1|2581433_2582024_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	78.1	1.0e-87
WP_100279592.1|2582023_2582374_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	6.0e-51
WP_045326830.1|2582531_2583029_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	84.8	5.5e-74
WP_047047382.1|2583028_2584765_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.3	0.0e+00
WP_047047380.1|2584764_2586069_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	94.0	5.6e-235
WP_100279593.1|2586082_2586931_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.4	5.0e-136
WP_100279594.1|2586940_2588149_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.9	4.4e-194
WP_100279595.1|2588201_2588528_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	78.7	1.6e-45
WP_100279596.1|2588591_2588804_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	65.7	2.5e-12
WP_100279597.1|2588805_2589138_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	91.8	1.0e-52
WP_100279598.1|2589130_2589670_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	93.9	8.5e-89
WP_100279599.1|2589666_2590032_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	81.8	2.7e-54
WP_100279600.1|2590090_2590573_+|tail	phage tail protein	tail	Q9MCU9	Escherichia_phage	58.6	5.7e-52
WP_100279601.1|2590615_2590969_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	94.0	1.3e-56
WP_100279602.1|2591001_2591265_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	93.1	3.2e-41
WP_157797651.1|2591328_2591721_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	41.4	3.6e-20
WP_100279603.1|2591782_2594215_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.8	0.0e+00
WP_100279604.1|2594214_2594694_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.5	3.9e-61
WP_100279022.1|2594680_2595163_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	73.8	6.1e-62
WP_032712197.1|2595172_2595553_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.0	1.3e-59
WP_100279605.1|2600585_2601338_+	hypothetical protein	NA	A0A286S1R5	Klebsiella_phage	44.5	3.0e-47
WP_100279606.1|2601868_2602108_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	83.5	5.2e-30
WP_100279607.1|2602181_2602508_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.8	3.1e-25
WP_047045003.1|2602709_2603621_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	76.5	6.4e-121
2602612:2602636	attR	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_015365533.1|2603868_2604630_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_072201312.1|2604695_2606024_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_015706185.1|2606389_2606674_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_100279608.1|2606833_2608144_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_032715051.1|2608143_2610288_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_015365538.1|2610498_2610984_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_015365539.1|2611009_2611561_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_032706267.1|2611727_2612660_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015365541.1|2612701_2613787_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	1.7e-88
WP_015706180.1|2613790_2614615_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_015365543.1|2614614_2615424_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_042893869.1|2615423_2615972_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_100279609.1|2616004_2616286_+	YfcL family protein	NA	NA	NA	NA	NA
WP_032715049.1|2616396_2618385_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_015706178.1|2618543_2619764_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_032715048.1|2619902_2621078_+	MFS transporter	NA	NA	NA	NA	NA
WP_072255026.1|2621120_2622083_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_032715047.1|2622213_2623350_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	1.2e-20
WP_015365551.1|2623412_2624426_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032708800.1|2624425_2625238_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP024883	Klebsiella aerogenes strain AR_0007 chromosome, complete genome	5118619	3255137	3306074	5118619	integrase,tail,bacteriocin,coat,terminase,holin	Escherichia_phage(20.0%)	69	3257817:3257832	3320850:3320865
WP_032714707.1|3255137_3255947_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-13
WP_100279717.1|3255948_3256941_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	1.6e-08
WP_015366244.1|3256940_3257831_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3257817:3257832	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
WP_072383731.1|3258007_3259195_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.6e-119
WP_072383728.1|3259494_3259725_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	84.2	1.9e-29
WP_072383725.1|3259726_3259948_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	54.3	7.4e-15
WP_072383723.1|3259944_3260136_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	1.6e-13
WP_072383721.1|3260132_3260669_-	hypothetical protein	NA	J9Q748	Salmonella_phage	78.9	5.2e-78
WP_072383719.1|3260665_3260884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100279718.1|3260880_3262050_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	65.7	6.9e-144
WP_072383716.1|3262046_3262706_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.6	2.6e-116
WP_072383714.1|3262719_3263004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072383711.1|3263018_3263486_-	single-stranded DNA-binding protein	NA	A0A2H4JHK3	uncultured_Caudovirales_phage	67.9	1.7e-45
WP_072383709.1|3263486_3264110_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	70.0	5.3e-74
WP_157797653.1|3264106_3264265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705909.1|3264517_3264724_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	76.5	2.5e-25
WP_157797654.1|3264722_3264947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072383707.1|3265502_3265874_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	9.5e-31
WP_072383706.1|3265851_3266913_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_072383705.1|3267023_3267143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072383704.1|3267191_3267887_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	67.0	6.9e-83
WP_015705720.1|3267991_3268222_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.9	4.5e-23
WP_072383703.1|3268316_3268859_+	regulator	NA	M9NZI6	Enterobacteria_phage	73.3	3.2e-67
WP_072383781.1|3269043_3269976_+	replication protein	NA	A0A077KB11	Edwardsiella_phage	77.2	1.3e-55
WP_072383702.1|3269972_3270674_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	80.4	3.6e-103
WP_072383701.1|3270670_3270964_+	protein ren	NA	M1FPD5	Enterobacteria_phage	60.2	3.4e-23
WP_072383779.1|3271388_3271925_+	hypothetical protein	NA	J9Q748	Salmonella_phage	77.2	4.8e-76
WP_081366158.1|3271921_3272164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072383700.1|3272361_3273501_+|tail	tail fiber domain-containing protein	tail	A0A1Z1LXX7	Serratia_phage	28.5	5.2e-19
WP_100280079.1|3273944_3275498_+	klebicin D activity protein	NA	NA	NA	NA	NA
WP_045364017.1|3275497_3275761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072383698.1|3275871_3276129_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_072383694.1|3277068_3277719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279719.1|3277895_3278351_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	7.8e-59
WP_072383690.1|3278350_3278521_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	90.6	2.9e-19
WP_072383688.1|3278513_3278804_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	4.1e-45
WP_072383686.1|3278800_3279163_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.2	4.3e-52
WP_072383684.1|3279159_3279300_+	YlcG family protein	NA	NA	NA	NA	NA
WP_100279720.1|3279296_3279986_+	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	1.3e-62
WP_047075687.1|3280059_3280347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131645981.1|3280776_3281076_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	88.9	6.7e-43
WP_045419413.1|3281072_3281615_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	70.2	3.1e-70
WP_045419410.1|3281611_3281953_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	72.6	7.6e-35
WP_047075689.1|3281955_3282231_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	50.0	4.1e-15
WP_072383680.1|3282220_3282376_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	84.3	8.5e-18
WP_045419402.1|3283175_3283421_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	91.0	6.3e-31
WP_045419398.1|3283506_3283764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047075691.1|3283858_3284851_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.5	6.3e-29
WP_045419394.1|3284828_3286133_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	2.7e-144
WP_045419392.1|3286137_3287562_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.7	3.4e-193
WP_100279721.1|3287545_3288658_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.6	1.5e-108
WP_045419387.1|3288763_3289528_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	58.7	9.9e-75
WP_045419385.1|3289615_3290752_+|coat	coat protein	coat	G8C7P7	Escherichia_phage	75.9	5.7e-159
WP_100279722.1|3290791_3291004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045419381.1|3291007_3291418_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	39.7	2.3e-09
WP_048228844.1|3291419_3291653_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	50.8	5.8e-10
WP_045419377.1|3291639_3292023_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	6.0e-20
WP_045419374.1|3292024_3292576_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.8	1.1e-27
WP_015705691.1|3292572_3292965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042896383.1|3292988_3294161_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.9	6.5e-25
WP_100279723.1|3294215_3294698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123273243.1|3294835_3295033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279724.1|3295099_3295432_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	65.3	8.5e-31
WP_100279725.1|3295551_3298959_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.1	5.4e-96
WP_032712199.1|3298958_3299432_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.1	3.1e-58
WP_045419358.1|3299418_3299901_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	73.8	7.9e-62
WP_045419356.1|3299910_3300291_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	8.5e-59
WP_072383777.1|3300776_3303323_+	kinase	NA	A0A286S259	Klebsiella_phage	70.4	0.0e+00
WP_100279726.1|3305321_3306074_+	hypothetical protein	NA	A0A286S1R5	Klebsiella_phage	45.7	9.2e-49
3320850:3320865	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 4
NZ_CP024883	Klebsiella aerogenes strain AR_0007 chromosome, complete genome	5118619	3378145	3383500	5118619	tRNA	Escherichia_phage(50.0%)	6	NA	NA
WP_100280081.1|3378145_3379519_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	3.9e-53
WP_032711785.1|3379566_3380502_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_032711784.1|3380852_3381188_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	76.8	2.4e-41
WP_042894575.1|3381245_3381542_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	77.9	4.0e-40
WP_015705624.1|3381778_3382204_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.0e-28
WP_100279741.1|3382357_3383500_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	6.2e-113
