The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024880	Klebsiella aerogenes strain AR_0018 chromosome, complete genome	5087312	333822	426238	5087312	capsid,lysis,holin,head,protease,tRNA,tail,plate,terminase,portal,integrase	Escherichia_phage(34.09%)	98	361829:361871	392876:392918
WP_015368967.1|333822_334260_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_015368966.1|334304_335246_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_032715400.1|335277_336180_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	55.8	3.6e-07
WP_015368963.1|336429_337359_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_015368962.1|337364_337991_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_015368961.1|337987_338890_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_086538089.1|338902_341953_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_032713191.1|342110_342947_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_015368957.1|343075_343288_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_045412807.1|343332_343656_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_015368955.1|343655_344315_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_015368954.1|344415_344964_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020077573.1|345164_346376_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020077574.1|346391_347315_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_032715401.1|347328_347820_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_015368950.1|347816_349088_+	MFS transporter	NA	NA	NA	NA	NA
WP_015368949.1|349133_349448_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_015368948.1|349444_350593_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_015703941.1|350623_351448_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_042894743.1|351529_352789_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_100278835.1|352785_354252_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_015703944.1|354411_354513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015368943.1|354563_355400_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_072255045.1|355445_356321_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_032706783.1|356328_357363_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_015368940.1|357653_358274_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	1.2e-62
WP_015368939.1|358346_359021_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_015368938.1|359083_360457_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_015368937.1|360453_361152_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_048231474.1|361301_361805_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
361829:361871	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTT	NA	NA	NA	NA
WP_100278836.1|361990_362971_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	95.4	1.6e-178
WP_032413147.1|363040_363334_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	71.1	7.2e-34
WP_032413148.1|363481_363754_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	83.3	1.1e-39
WP_032413149.1|363923_364424_+	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	5.3e-85
WP_100278837.1|364487_364712_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	79.7	1.2e-23
WP_045367651.1|364711_365008_+	hypothetical protein	NA	M1RZ07	Escherichia_phage	68.5	7.3e-26
WP_072269027.1|365012_365237_+	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	74.3	8.8e-24
WP_045367658.1|365233_365509_+	hypothetical protein	NA	M1TAP2	Escherichia_phage	74.4	4.1e-31
WP_100278838.1|365498_367772_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	78.7	0.0e+00
WP_100278839.1|368065_368536_+	SocA family protein	NA	I6R0L8	Salmonella_phage	37.4	6.0e-14
WP_100278840.1|368576_369149_+	DUF2975 domain-containing protein	NA	S5M7T3	Escherichia_phage	44.7	1.0e-15
WP_100278841.1|369212_371696_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_059304586.1|372071_373118_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	94.3	6.3e-189
WP_100278842.1|373119_374889_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	97.3	0.0e+00
WP_100278843.1|375054_375909_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	93.7	7.3e-151
WP_032413160.1|375985_377053_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	97.2	7.9e-195
WP_032413161.1|377057_377807_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	91.2	2.6e-112
WP_032413162.1|377900_378410_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	95.3	3.1e-88
WP_100278844.1|378409_378613_+|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	89.6	2.4e-28
WP_100278845.1|378615_378912_+|holin	holin	holin	S4TP56	Salmonella_phage	95.9	1.4e-45
WP_032413164.1|378898_379396_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	93.3	3.9e-88
WP_032413165.1|379392_379806_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	93.4	6.2e-63
WP_047045389.1|379913_380381_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	4.2e-84
WP_032723326.1|380373_380823_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	94.6	1.4e-68
WP_100278847.1|380891_381533_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	93.4	5.7e-108
WP_032413170.1|381529_381877_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	93.9	2.2e-53
WP_032413171.1|381883_382792_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	96.7	2.0e-154
WP_100278848.1|382784_383393_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	93.1	1.6e-107
WP_100278849.1|383389_384865_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.0	1.2e-108
WP_100278850.1|384864_385482_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	55.2	1.0e-53
WP_100278851.1|385613_386792_+|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	94.9	1.9e-213
WP_015370162.1|386807_387326_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	9.4e-93
WP_064397113.1|387388_387724_+|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	91.9	5.9e-48
WP_071647614.1|387720_387876_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	94.1	4.8e-21
WP_100278852.1|387868_390310_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	86.8	0.0e+00
WP_063411191.1|390324_390810_+|tail	phage tail protein	tail	O80317	Escherichia_phage	94.3	5.0e-80
WP_100278853.1|390806_391964_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.3	1.2e-204
WP_032413178.1|392043_392262_+	prophage transcriptional regulator OgrK	NA	S4TNZ3	Salmonella_phage	98.6	1.4e-37
WP_045367712.1|392297_392714_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	51.5	5.7e-32
WP_015368935.1|393009_393906_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
392876:392918	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTT	NA	NA	NA	NA
WP_015368934.1|394109_395072_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_015703948.1|395138_395624_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_048231479.1|395716_396643_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_015368931.1|396710_398045_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.9	2.1e-43
WP_015368930.1|398054_398585_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_072059865.1|398676_399645_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_015368928.1|399738_400767_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_015703950.1|400916_403112_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_015368925.1|403372_403585_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004107547.1|403686_404004_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_015368924.1|404269_405430_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_048231472.1|405432_407865_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_015368922.1|408166_409054_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_015368920.1|409205_410120_+	DMT family transporter	NA	NA	NA	NA	NA
WP_045412819.1|410157_411261_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_045412822.1|411315_411978_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.4	3.5e-28
WP_048231471.1|412183_413041_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015368916.1|413187_413838_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_045412825.1|413884_416536_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_015368914.1|416793_417945_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_047056652.1|418058_419063_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_015368912.1|419072_419849_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_015368911.1|419950_421324_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_015368909.1|421577_422495_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_015368908.1|422477_423878_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_015368907.1|424074_424710_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_015368906.1|424725_425085_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_020077583.1|425137_426238_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP024880	Klebsiella aerogenes strain AR_0018 chromosome, complete genome	5087312	1286104	1292918	5087312		Erwinia_phage(42.86%)	8	NA	NA
WP_048230646.1|1286104_1286455_-	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	42.4	2.3e-10
WP_047076160.1|1286448_1286895_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	36.6	1.2e-19
WP_047077084.1|1287175_1287814_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032712691.1|1287922_1288237_-	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	66.7	9.5e-32
WP_047077085.1|1288578_1289832_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.6	5.6e-91
WP_015368077.1|1289842_1290946_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.7	9.7e-63
WP_100278884.1|1291235_1292288_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-113
WP_026612390.1|1292351_1292918_-	hypothetical protein	NA	S5MM68	Bacillus_phage	38.9	2.2e-10
>prophage 3
NZ_CP024880	Klebsiella aerogenes strain AR_0018 chromosome, complete genome	5087312	3047627	3052987	5087312	tRNA	Escherichia_phage(50.0%)	6	NA	NA
WP_032714650.1|3047627_3048773_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.9	1.4e-120
WP_015705624.1|3048926_3049352_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.0e-28
WP_042894575.1|3049588_3049885_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	77.9	4.0e-40
WP_032711784.1|3049942_3050278_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	76.8	2.4e-41
WP_032711785.1|3050630_3051566_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_048231211.1|3051613_3052987_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
>prophage 4
NZ_CP024880	Klebsiella aerogenes strain AR_0018 chromosome, complete genome	5087312	3111400	3141969	5087312	terminase,holin,head,tail	Cronobacter_phage(44.12%)	45	NA	NA
WP_100278941.1|3111400_3112078_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	6.3e-81
WP_100278942.1|3112410_3113013_+	hypothetical protein	NA	U5U717	Lactobacillus_phage	34.0	4.5e-06
WP_100278943.1|3113241_3114507_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.5	1.9e-203
WP_100278944.1|3114506_3114797_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	42.4	1.5e-10
WP_064743295.1|3115220_3115565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100278945.1|3115623_3115881_-	hypothetical protein	NA	L0ARW5	Klebsiella_phage	51.8	8.3e-18
WP_100278946.1|3115884_3118017_-|tail	phage tail protein	tail	R9TMK5	Aeromonas_phage	40.0	3.9e-100
WP_100278947.1|3118074_3120552_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	91.6	0.0e+00
WP_100278948.1|3120538_3120955_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	87.5	2.0e-69
WP_045363946.1|3120917_3121388_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	89.7	2.5e-76
WP_045363943.1|3121387_3121885_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.1	5.1e-88
WP_100278949.1|3121884_3124815_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	43.8	7.8e-144
WP_100278950.1|3124874_3125240_-	hypothetical protein	NA	A0A0P0IE45	Acinetobacter_phage	39.1	2.7e-14
WP_100278951.1|3125236_3125611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100278952.1|3125678_3126365_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.1	1.4e-51
WP_100278953.1|3126422_3127166_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	84.8	1.3e-74
WP_100278954.1|3127229_3127613_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	3.4e-39
WP_100278955.1|3127609_3128074_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	48.7	2.9e-29
WP_100278956.1|3128076_3128427_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	3.1e-39
WP_100278957.1|3128423_3128657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100278958.1|3128649_3128823_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	57.9	7.6e-15
WP_100278959.1|3128819_3129224_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	74.6	1.6e-52
WP_100278960.1|3129284_3129569_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	73.2	7.3e-31
WP_100278961.1|3129579_3130683_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	74.1	2.3e-157
WP_100278962.1|3130696_3131155_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	78.6	6.0e-59
WP_100278963.1|3131167_3132433_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	90.0	4.3e-216
WP_100278964.1|3132435_3133362_-|head	phage head morphogenesis protein	head	A0A1V0E5Q2	Salmonella_phage	92.2	5.8e-162
WP_100278965.1|3133321_3134671_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	85.7	8.9e-228
WP_100278966.1|3134689_3136174_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.0	1.2e-257
WP_100278967.1|3136160_3136733_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.1	2.2e-71
WP_100278968.1|3136756_3137044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100278969.1|3137150_3137339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100278970.1|3137432_3137690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705886.1|3137839_3137932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015705887.1|3137931_3138045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100278972.1|3138164_3138560_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_100278973.1|3138556_3139033_-	glycoside hydrolase family 104 protein	NA	A5VW81	Enterobacteria_phage	89.0	2.3e-77
WP_152906376.1|3139019_3139325_-|holin	holin	holin	E7C9S8	Salmonella_phage	85.0	5.2e-43
WP_100278974.1|3139476_3139665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100278975.1|3139878_3140568_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	1.1e-59
WP_157798448.1|3140564_3140705_-	YlcG family protein	NA	NA	NA	NA	NA
WP_100278976.1|3140701_3141064_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.2	3.3e-52
WP_100278977.1|3141060_3141351_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.5	3.4e-44
WP_100278978.1|3141343_3141514_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	92.5	1.3e-19
WP_100278979.1|3141513_3141969_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	1.8e-60
>prophage 5
NZ_CP024880	Klebsiella aerogenes strain AR_0018 chromosome, complete genome	5087312	3146313	3162670	5087312	integrase	Enterobacteria_phage(28.57%)	25	3148840:3148854	3165130:3165144
WP_100278983.1|3146313_3147048_-	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	52.7	6.0e-61
WP_100278984.1|3147040_3147478_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	45.6	8.6e-07
WP_100278985.1|3147474_3147768_-	protein ren	NA	M1FPD5	Enterobacteria_phage	60.2	3.4e-23
WP_100278986.1|3147764_3148466_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	78.7	2.0e-101
WP_100279138.1|3148462_3149395_-	replication protein	NA	A0A077KB11	Edwardsiella_phage	79.5	2.2e-55
3148840:3148854	attL	GGGTTTTCTTTCCGG	NA	NA	NA	NA
WP_063410412.1|3149580_3150123_-	regulator	NA	M9NZI6	Enterobacteria_phage	86.7	6.0e-82
WP_015705907.1|3150139_3150373_-	antirepressor	NA	A0A0P0ZDD7	Stx2-converting_phage	61.0	1.3e-17
WP_032709994.1|3150414_3151167_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	63.1	4.5e-72
WP_063410411.1|3151781_3152105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705909.1|3152103_3152310_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	76.5	2.5e-25
WP_071647688.1|3152314_3152629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063410410.1|3152763_3153048_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	86.2	1.7e-43
WP_100278987.1|3153066_3153912_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	4.5e-68
WP_063410408.1|3153908_3154589_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.6	3.9e-123
WP_058674594.1|3154585_3155014_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.7	7.5e-64
WP_100278988.1|3155010_3155667_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	1.9e-111
WP_047076779.1|3155663_3156629_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	68.7	2.4e-142
WP_047076778.1|3156625_3156844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047076777.1|3156840_3157530_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.9	1.8e-43
WP_047076775.1|3157747_3157969_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	46.8	3.9e-08
WP_047076774.1|3157971_3158313_+	hypothetical protein	NA	I3PV00	Vibrio_phage	50.9	2.2e-21
WP_080957143.1|3158612_3159800_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	3.5e-119
WP_015366244.1|3159976_3160867_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_015366243.1|3160866_3161859_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	1.6e-08
WP_032714707.1|3161860_3162670_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-13
3165130:3165144	attR	GGGTTTTCTTTCCGG	NA	NA	NA	NA
>prophage 6
NZ_CP024880	Klebsiella aerogenes strain AR_0018 chromosome, complete genome	5087312	3987328	4087908	5087312	capsid,transposase,holin,head,tRNA,tail,terminase,portal	Salmonella_phage(25.86%)	103	NA	NA
WP_020078168.1|3987328_3988066_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_015370281.1|3988196_3989528_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.1	1.5e-46
WP_002914084.1|3989573_3989957_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_020078167.1|3990268_3990958_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	4.9e-57
WP_048231157.1|3991013_3992084_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_015370277.1|3992288_3992714_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	3.5e-13
WP_048231158.1|3992783_3993482_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_047053895.1|3993517_3996193_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_015370274.1|3996289_3997645_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_015370273.1|3997687_3998011_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_032708912.1|3998013_3999312_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	9.1e-44
WP_015703191.1|4005182_4007756_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	3.4e-127
WP_048231237.1|4007885_4008617_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_015370269.1|4008613_4009594_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_015370268.1|4009725_4010463_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4010735_4011071_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100279143.1|4011185_4011233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048231238.1|4011334_4012495_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_048231239.1|4012491_4013364_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_015703194.1|4013432_4014554_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_015370264.1|4014563_4015634_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	5.3e-90
WP_020078162.1|4015800_4016487_+	YfiR family protein	NA	NA	NA	NA	NA
WP_047062001.1|4016479_4017703_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_015370261.1|4017715_4018195_+	OmpA family protein	NA	NA	NA	NA	NA
WP_015703197.1|4018200_4019571_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_048231240.1|4019627_4020077_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4020197_4020545_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_008806092.1|4020584_4021352_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015703198.1|4021383_4021932_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_015370257.1|4021950_4022199_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_020078159.1|4022469_4023834_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015703199.1|4024000_4024792_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026612238.1|4024809_4026096_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015370253.1|4026199_4026790_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_015370252.1|4026913_4027792_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_045366812.1|4027878_4029540_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015703201.1|4029687_4030026_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_015370249.1|4030089_4030380_-	RnfH family protein	NA	NA	NA	NA	NA
WP_026612237.1|4030369_4030846_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_020078156.1|4030960_4031443_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	3.0e-29
WP_100279016.1|4032120_4033041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279017.1|4033266_4033938_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	1.6e-81
WP_100279018.1|4033930_4035196_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.8	5.8e-205
WP_100279019.1|4035195_4035486_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.5	1.7e-11
WP_100279021.1|4035953_4036706_-	hypothetical protein	NA	A0A286S1R5	Klebsiella_phage	44.5	2.3e-47
WP_100279144.1|4038704_4041251_-	kinase	NA	A0A286S259	Klebsiella_phage	69.8	0.0e+00
WP_032712197.1|4041736_4042117_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.0	1.3e-59
WP_100279022.1|4042126_4042609_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	73.8	6.1e-62
WP_100279023.1|4042595_4043075_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.5	3.9e-61
WP_100279024.1|4043074_4045618_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	65.1	4.8e-275
WP_100279025.1|4045678_4046056_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_100279026.1|4046119_4046383_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	88.5	3.9e-39
WP_100279027.1|4046415_4046769_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	84.6	1.2e-51
WP_100279028.1|4046811_4047294_-|tail	phage tail protein	tail	Q9MCU9	Escherichia_phage	57.7	1.3e-51
WP_100279029.1|4047351_4047717_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	80.2	1.8e-53
WP_100279030.1|4047713_4048253_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	81.9	1.8e-78
WP_100279031.1|4048245_4048578_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	83.6	2.5e-46
WP_100279032.1|4048579_4048777_-	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	75.4	1.1e-17
WP_100279033.1|4048847_4049174_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	59.3	2.8e-26
WP_100279034.1|4049170_4050214_-|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	80.7	2.6e-102
WP_100279035.1|4050210_4051566_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	95.6	9.8e-251
WP_100279036.1|4051771_4053706_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	95.0	0.0e+00
WP_100279037.1|4053763_4055422_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	72.8	4.0e-238
WP_100279038.1|4055425_4055935_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	68.0	1.3e-51
WP_100279039.1|4056116_4056485_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	81.7	3.3e-52
WP_100279040.1|4056477_4057071_-	hypothetical protein	NA	S4TR53	Salmonella_phage	71.6	4.7e-80
WP_100279041.1|4057052_4058510_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	71.5	6.3e-211
WP_100279042.1|4058981_4059407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722525.1|4059662_4059908_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	88.9	1.1e-30
WP_100279043.1|4059972_4060173_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	68.3	1.4e-17
WP_100279044.1|4060183_4060336_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	86.4	6.0e-16
WP_100279045.1|4060325_4060601_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	64.4	4.9e-24
WP_100279046.1|4060603_4061233_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.3	1.4e-87
WP_100279047.1|4061232_4061514_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	51.6	8.0e-22
WP_100279048.1|4061500_4061887_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	93.8	1.2e-57
WP_049106554.1|4061993_4062149_-	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	70.8	1.9e-09
WP_100279049.1|4062145_4062568_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	78.5	2.2e-52
WP_100279050.1|4062943_4063993_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	76.1	2.6e-166
WP_100279051.1|4064141_4064336_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	83.1	5.0e-23
WP_100279052.1|4064529_4065228_-	antitermination protein	NA	NA	NA	NA	NA
WP_100279053.1|4065249_4066308_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.3	9.1e-111
WP_047050083.1|4066304_4068152_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.4	1.0e-202
WP_100279054.1|4068144_4069035_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	73.2	3.8e-126
WP_100279055.1|4069031_4069913_-	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	54.8	2.0e-34
WP_100279056.1|4069909_4070089_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_100279145.1|4070090_4070786_-	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	51.4	7.2e-48
WP_100279058.1|4070984_4071542_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.2	3.6e-66
WP_075210621.1|4071570_4071780_-	cell division protein	NA	NA	NA	NA	NA
WP_100279059.1|4071874_4072519_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.2	5.3e-37
WP_100279060.1|4072720_4073311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123907141.1|4074281_4074467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279061.1|4075098_4075626_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	68.6	1.8e-62
WP_100279062.1|4075625_4075823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279063.1|4075944_4076514_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	73.3	2.2e-18
WP_100279064.1|4076510_4076855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279065.1|4076847_4077549_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	50.2	3.3e-56
WP_100279067.1|4078312_4078540_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	73.3	1.3e-09
WP_100279068.1|4078536_4079121_+	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	53.4	2.6e-14
WP_100279069.1|4079327_4080518_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.9	4.9e-145
WP_001738700.1|4081935_4082025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020078154.1|4082026_4082674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100279070.1|4082862_4086666_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_100279071.1|4086797_4087908_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	31.2	1.3e-06
