The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024834	Klebsiella pneumoniae strain CRKP-2297 chromosome, complete genome	5429958	180126	220100	5429958	terminase,portal,head,plate,tail,holin,tRNA,capsid,lysis,integrase	Escherichia_phage(25.0%)	48	179575:179590	210594:210609
179575:179590	attL	GCAATGATGGCATTTA	NA	NA	NA	NA
WP_032433590.1|180126_181125_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	4.5e-192
WP_032433588.1|181124_181700_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_001630878.1|181829_182093_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_039818858.1|182123_182633_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	8.9e-88
WP_023343330.1|182640_182841_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
WP_032433585.1|182804_183143_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_032433580.1|183210_183438_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
WP_032433578.1|183437_183659_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
WP_032433576.1|183660_185877_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.2	0.0e+00
WP_048292468.1|185995_186436_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
WP_071557792.1|187056_187365_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
WP_032433573.1|187342_188293_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
WP_032433571.1|188431_188863_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
WP_032433569.1|188861_189056_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
WP_032433567.1|189568_190612_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
WP_009309687.1|190611_192381_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
WP_032433566.1|192546_193401_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	9.6e-127
WP_025710540.1|193474_194533_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_032433565.1|194536_195280_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.9	9.6e-99
WP_009309691.1|195376_195883_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|195882_196086_+|tail	tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_032433564.1|196090_196381_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
WP_032433563.1|196367_196865_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
WP_032433560.1|196861_197293_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	1.1e-41
WP_032433558.1|197388_197856_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
WP_032433555.1|197848_198298_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
WP_045326985.1|198626_199670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015959011.1|200012_200654_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_014343405.1|200650_200998_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_032433553.1|201002_201911_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_023322996.1|201903_202506_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	57.6	1.0e-53
WP_125116968.1|202441_204772_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.2e-108
WP_032433551.1|204777_205506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433550.1|205517_206597_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
WP_019724797.1|206706_207888_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_032433549.1|207901_208417_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
WP_004195711.1|208477_208753_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_015959005.1|208767_208905_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_032433547.1|208897_211336_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
210594:210609	attR	TAAATGCCATCATTGC	NA	NA	NA	NA
WP_023343304.1|211352_211832_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
WP_032433545.1|211831_212992_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
WP_032433542.1|213032_213440_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
WP_023343301.1|213533_213752_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|214110_214617_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|214716_216558_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917631.1|216776_218522_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|218633_218849_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002916879.1|219086_220100_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 2
NZ_CP024834	Klebsiella pneumoniae strain CRKP-2297 chromosome, complete genome	5429958	772955	826615	5429958	terminase,protease,portal,tail,holin,tRNA,integrase	Klebsiella_phage(25.58%)	66	775843:775859	828688:828704
WP_004174810.1|772955_774041_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914088.1|774098_774788_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914084.1|775100_775484_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_004174811.1|775529_776855_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
775843:775859	attL	CGACCGATACGGTGCAG	NA	NA	NA	NA
WP_002914079.1|776986_777724_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004144357.1|777708_779328_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_121980491.1|779656_779752_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_002914074.1|779748_780324_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_002914072.1|780356_781007_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_002914070.1|781006_781963_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_004144354.1|781959_782439_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_002914069.1|782624_784424_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
WP_002914067.1|784439_785414_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002914065.1|785663_786344_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914063.1|786340_787246_+	GTPase Era	NA	NA	NA	NA	NA
WP_002914062.1|787257_787995_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004180923.1|788006_788738_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004144351.1|788737_789118_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_060591498.1|789130_789391_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	55.8	7.6e-19
WP_042921081.1|789605_791003_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071839937.1|790999_791200_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_060591521.1|791219_791777_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	63.6	1.8e-65
WP_060591495.1|792080_792332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060591492.1|792978_793359_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	93.6	3.9e-64
WP_077265949.1|793723_793948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060591480.1|794262_795123_-	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	54.7	2.3e-72
WP_060591477.1|795204_796017_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_060591474.1|796060_796420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060591471.1|796868_797381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048333910.1|798136_798343_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	56.7	5.1e-10
WP_048333909.1|798380_799415_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	43.2	3.9e-74
WP_048333964.1|799472_800177_-	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	60.1	3.7e-68
WP_048333908.1|800282_800543_+	hypothetical protein	NA	A0A1B5FPK9	Escherichia_phage	42.0	1.2e-08
WP_048333906.1|800571_801102_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	61.8	7.9e-55
WP_004104272.1|801584_801860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060591468.1|801852_803382_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
WP_029498819.1|803378_804350_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.7	7.8e-109
WP_060591465.1|804319_804964_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_060591454.1|804960_805605_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.2	3.4e-84
WP_060591437.1|805594_805999_+	antitermination protein	NA	S5M7R9	Escherichia_phage	53.2	1.6e-31
WP_060591433.1|806177_806369_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	87.3	5.8e-24
WP_060591432.1|806519_807572_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.1	7.8e-171
WP_060591429.1|807716_808064_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	71.0	1.5e-38
WP_004884314.1|808066_808606_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
WP_040241913.1|808602_808947_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	1.8e-39
WP_060591427.1|808943_809219_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	91.0	2.4e-07
WP_060591425.1|809169_809361_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	2.6e-24
WP_048985255.1|809441_809741_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_048985257.1|809811_810057_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	58.0	8.8e-17
WP_014228567.1|810374_810866_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_060591422.1|810865_812974_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.0	0.0e+00
WP_020317294.1|812970_813186_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_060591419.1|813182_814682_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.2	1.2e-246
WP_040164891.1|814626_816642_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.6	0.0e+00
WP_014228572.1|816722_817049_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.4e-33
WP_060591414.1|817041_817335_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_048291628.1|817324_817876_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_020804325.1|817872_818271_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_023304948.1|818278_818761_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_025714420.1|818803_819199_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_040190022.1|819219_819537_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_060591412.1|819517_822214_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.1	3.0e-198
WP_071839934.1|822213_822687_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.8	6.6e-53
WP_038433285.1|822673_823156_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_048291625.1|823163_823550_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
WP_060591409.1|823546_826615_+	kinase	NA	A0A286S259	Klebsiella_phage	65.7	0.0e+00
828688:828704	attR	CGACCGATACGGTGCAG	NA	NA	NA	NA
>prophage 3
NZ_CP024834	Klebsiella pneumoniae strain CRKP-2297 chromosome, complete genome	5429958	1277075	1283980	5429958	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1277075_1277939_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_039819854.1|1277949_1278723_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_002912636.1|1278963_1279857_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819857.1|1280102_1281464_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004175198.1|1281782_1282505_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1282501_1283980_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP024834	Klebsiella pneumoniae strain CRKP-2297 chromosome, complete genome	5429958	1327315	1340632	5429958	transposase	Enterobacteria_phage(22.22%)	12	NA	NA
WP_000043543.1|1327315_1328722_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1328948_1330364_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1330385_1331756_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1331910_1332975_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819507.1|1332988_1333858_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_004175259.1|1333889_1334780_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1334794_1335349_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_039819510.1|1335528_1336695_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_039819538.1|1337087_1338095_+	acyltransferase	NA	NA	NA	NA	NA
WP_077255456.1|1338309_1338414_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004144151.1|1339105_1339228_-	small membrane protein	NA	NA	NA	NA	NA
WP_039819511.1|1339627_1340632_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 5
NZ_CP024834	Klebsiella pneumoniae strain CRKP-2297 chromosome, complete genome	5429958	1452912	1498235	5429958	terminase,protease,portal,head,tail,capsid,transposase,lysis,integrase	Enterobacteria_phage(28.21%)	50	1460673:1460732	1501940:1502003
WP_000059620.1|1452912_1454175_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	1.1e-73
WP_002911729.1|1454742_1455660_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_004180456.1|1455766_1456717_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_023286672.1|1456795_1457737_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004212965.1|1457935_1458172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020477091.1|1458472_1459168_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002911599.1|1459753_1460551_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1460673:1460732	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_023317562.1|1460846_1461839_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	86.9	1.1e-174
WP_004184757.1|1461840_1462068_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_023317564.1|1463254_1463410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039817954.1|1463537_1464323_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.1e-60
WP_039817952.1|1464322_1464622_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	7.2e-13
WP_039817950.1|1464711_1465629_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.5	1.5e-45
WP_023317570.1|1466342_1467038_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_001191665.1|1467135_1467378_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_039817948.1|1467412_1467874_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	6.4e-69
WP_071557781.1|1468111_1468324_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_039817942.1|1468280_1469195_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
WP_039817939.1|1469191_1470001_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	3.5e-110
WP_039817937.1|1470010_1470388_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
WP_039817935.1|1470400_1471381_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	6.4e-135
WP_039817933.1|1471394_1471973_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_004151282.1|1472680_1472929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039817927.1|1472931_1473462_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	80.0	3.2e-80
WP_039817926.1|1473458_1473923_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	62.9	1.6e-43
WP_039817923.1|1473997_1474336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039817921.1|1475125_1475521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039817920.1|1475720_1475966_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	65.4	1.2e-18
WP_039817918.1|1476021_1476363_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
WP_039817917.1|1476545_1477010_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	6.3e-48
WP_039817916.1|1476963_1478706_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	2.0e-139
WP_039817913.1|1478705_1480013_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.4	4.3e-211
WP_039817990.1|1480025_1480874_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	1.0e-128
WP_004886697.1|1480883_1482101_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.4	3.9e-182
WP_039817908.1|1482439_1482766_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	68.5	1.2e-40
WP_004884319.1|1482777_1483116_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
WP_039817904.1|1483112_1483562_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	1.9e-62
WP_039817902.1|1483558_1483906_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.1	4.0e-31
WP_039817900.1|1483962_1484667_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	7.2e-80
WP_039817897.1|1484697_1485102_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	1.7e-33
WP_039817895.1|1485104_1485410_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	8.1e-28
WP_039817893.1|1485514_1486270_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.9e-34
WP_039817891.1|1486266_1487766_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_039817888.1|1487899_1488133_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	45.8	3.2e-08
WP_039817884.1|1488193_1491583_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	1.5e-303
WP_004177132.1|1491603_1492077_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|1492063_1492540_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_039817877.1|1492552_1492933_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	3.6e-57
WP_039817875.1|1492929_1496007_+	kinase	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
WP_001118616.1|1497311_1498235_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
1501940:1502003	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 6
NZ_CP024834	Klebsiella pneumoniae strain CRKP-2297 chromosome, complete genome	5429958	2367573	2378460	5429958		Escherichia_phage(87.5%)	9	NA	NA
WP_032433071.1|2367573_2370681_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_060591377.1|2370735_2372001_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2372031_2373120_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2373206_2373467_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2373764_2374625_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2374645_2375407_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2375667_2376570_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2376581_2377847_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2377839_2378460_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP024834	Klebsiella pneumoniae strain CRKP-2297 chromosome, complete genome	5429958	2649221	2704532	5429958	holin,tail,terminase,integrase	Klebsiella_phage(22.64%)	66	2646553:2646568	2701838:2701853
2646553:2646568	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_039110604.1|2649221_2650487_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.0	7.6e-205
WP_002901812.1|2650488_2650908_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_039110600.1|2651957_2652506_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.6	6.0e-90
WP_087831371.1|2652615_2655750_+	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.3	1.7e-104
WP_039110597.1|2655836_2656583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039110598.1|2656593_2658357_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	85.0	6.1e-51
WP_039110596.1|2658434_2661503_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_004152651.1|2661499_2661880_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_039110595.1|2661889_2662372_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.6	4.1e-82
WP_039110593.1|2662552_2663017_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	1.5e-57
WP_039110591.1|2663016_2665899_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	1.7e-98
WP_032416607.1|2665972_2666341_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
WP_004217333.1|2666451_2666808_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_008807842.1|2666884_2667091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807841.1|2667228_2667711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591823.1|2667764_2668937_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_004190640.1|2668960_2669353_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_039110587.1|2669349_2669901_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.3e-28
WP_004217344.1|2669902_2670286_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_040246471.1|2670272_2670506_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	4.4e-10
WP_004190649.1|2670515_2670770_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_023300922.1|2670771_2671167_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_004190653.1|2671488_2672442_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_032423789.1|2672452_2673238_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.7e-66
WP_039110586.1|2673768_2674881_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	2.5e-111
WP_008807834.1|2674864_2676265_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_004190663.1|2676264_2677572_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_008807832.1|2677549_2678542_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	35.3	1.3e-29
WP_004218558.1|2679404_2679650_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_023313108.1|2680608_2680884_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	4.7e-11
WP_039110584.1|2680880_2681228_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	69.6	1.6e-35
WP_023301209.1|2681224_2681764_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_031281240.1|2681760_2682060_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_049001106.1|2682672_2683119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805457.1|2683024_2683282_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	96.5	5.4e-41
WP_039110580.1|2683616_2684438_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.1	9.0e-98
WP_020804605.1|2684553_2684910_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_020804598.1|2684906_2685203_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_020804595.1|2685411_2686008_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	2.2e-90
WP_004184503.1|2686386_2686620_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_032413665.1|2687370_2687670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804596.1|2687765_2688194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804600.1|2688197_2688419_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804604.1|2688415_2688670_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804603.1|2688662_2688866_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_039110576.1|2688862_2689648_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	4.8e-64
WP_032417027.1|2689640_2689976_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
WP_032417026.1|2689983_2690733_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_023286278.1|2690735_2691644_-	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_020804480.1|2691658_2691847_-	ClpX C4-type zinc finger	NA	NA	NA	NA	NA
WP_023287506.1|2691934_2692471_-	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_029503646.1|2692473_2692707_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_039110572.1|2692811_2693207_+	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	1.4e-48
WP_136085610.1|2693224_2693323_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_016831735.1|2693428_2693548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631177.1|2694715_2695024_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_022631176.1|2695115_2695214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|2695320_2695512_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|2695520_2695676_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_039110567.1|2695813_2698852_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.0	3.0e-292
WP_039110565.1|2698864_2699974_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.2	1.1e-183
WP_071836884.1|2700014_2700254_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	8.8e-22
WP_085768496.1|2700474_2701662_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	4.6e-119
WP_004151901.1|2701838_2702729_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
2701838:2701853	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|2702728_2703721_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|2703722_2704532_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 8
NZ_CP024834	Klebsiella pneumoniae strain CRKP-2297 chromosome, complete genome	5429958	3097833	3107298	5429958	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_032432850.1|3097833_3099555_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3099599_3100301_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3100654_3100873_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3100994_3103274_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3103304_3103622_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3103947_3104169_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004209695.1|3104245_3106186_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3106182_3107298_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP024835	Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence	112150	414	46823	112150	integrase,transposase	Stx2-converting_phage(26.32%)	53	20509:20525	41997:42013
WP_001567368.1|414_1818_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567367.1|2088_2523_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001567366.1|2569_3118_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001568014.1|3611_3920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568016.1|4152_4647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632385.1|4677_5250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568018.1|5246_5495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568019.1|5940_7668_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_032441952.1|8697_9720_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_001531258.1|9716_10499_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_015632382.1|11179_11620_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004189161.1|11616_11967_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_014839879.1|11997_13590_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
WP_001568022.1|14174_16979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568023.1|17123_18152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162066.1|18292_18862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632378.1|19417_19732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191724.1|19780_20092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162067.1|20156_21161_+	hypothetical protein	NA	NA	NA	NA	NA
20509:20525	attL	CGCCGGAAACGCTGGTC	NA	NA	NA	NA
WP_015632375.1|21358_22153_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|22600_22780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|22899_23526_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|24158_25034_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_016162068.1|25445_26717_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
WP_015632467.1|26716_27148_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_015632466.1|28091_29117_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015632465.1|29302_29521_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_015632464.1|29520_29826_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015632463.1|29970_30315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632462.1|30356_30923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162071.1|31126_31384_-	helix-turn-helix transcriptional regulator	NA	H2DE32	Erwinia_phage	56.4	5.1e-07
WP_016162072.1|31813_32041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632459.1|32382_32826_-	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	33.8	4.6e-16
WP_015632458.1|32851_33034_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	48.3	2.0e-05
WP_015632457.1|33394_34375_+	partitioning protein	NA	A0A0A7NPX4	Enterobacteria_phage	49.4	2.3e-76
WP_015632456.1|34367_34796_+	partitioning protein	NA	NA	NA	NA	NA
WP_015632455.1|34948_35407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632454.1|35403_35892_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015632453.1|36019_36457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162075.1|37050_37410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441934.1|37553_37733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632451.1|37806_38667_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.6	2.8e-17
WP_015632450.1|38836_39274_+	antirestriction protein	NA	NA	NA	NA	NA
WP_016162076.1|39965_40199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632449.1|40252_40573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632448.1|40843_41176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162079.1|41571_41883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632446.1|41885_43814_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
41997:42013	attR	GACCAGCGTTTCCGGCG	NA	NA	NA	NA
WP_016162080.1|43854_44106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162081.1|44117_44375_-	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	41.5	1.2e-05
WP_015632445.1|44450_44858_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_032495749.1|44854_45193_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.8	7.6e-27
WP_015632444.1|45233_46823_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
>prophage 1
NZ_CP024836	Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence	96185	41239	62851	96185	transposase,integrase	Escherichia_phage(40.0%)	23	41176:41235	62856:63656
41176:41235	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|41239_41944_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_060591625.1|41977_42865_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
WP_001083725.1|43009_43507_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|43618_43909_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|43914_44706_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_022631163.1|44781_46035_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
WP_000679427.1|46839_47187_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|47180_48020_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|48424_49966_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201169.1|50278_51310_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|51320_51959_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|51963_52329_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_023408309.1|52332_53145_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_001067855.1|53703_54408_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342204.1|54578_55127_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_012372818.1|55207_55963_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|56132_56993_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|57175_57733_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001389365.1|58034_58799_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|59291_59876_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|59875_61114_-	MFS transporter	NA	NA	NA	NA	NA
WP_023063803.1|61110_62025_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|62146_62851_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
62856:63656	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAAATTTTGTATAATAGGAATTGAAGTTAAATTAGATGCTAAAAATTTGTAATTAAGAAGGAGGGATTCGTCATGTTGGTATTCCAAATGCGTTATCAAATGCGTTATGTAGATAAAACATCTACTGTTTTGAAACAGACTAAAAAAAGTGATTACGCAGATAAATAAATACGTTAGATTAATTCCTACCAGTGACTAATCTTATGACTTTTTAAACAGATAACTAAAATTACAAACAAATCGTTTAACTTCTGTATTTGTTTATAGATGTAATCACTTCAGGAGTAAATTACATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAACAATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACTGGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAATTAAAACTGAATACTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGAGGTATAAAATTGTTGGGAATATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAGCCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACACTAGGGTTGCTCTTGCACACTCAAGTCTCG	NA	NA	NA	NA
>prophage 1
NZ_CP024837	Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_3, complete sequence	69628	16398	50323	69628	capsid,portal,head,terminase,tail	Klebsiella_phage(83.33%)	45	NA	NA
WP_032413547.1|16398_16563_-	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
WP_077254209.1|17091_18225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413545.1|18251_18776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413544.1|18875_19211_-	hypothetical protein	NA	O64345	Escherichia_phage	66.4	1.5e-38
WP_057171984.1|19197_19404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048993237.1|19396_23401_-	hypothetical protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
WP_048292304.1|23651_24260_-	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.6	1.3e-104
WP_032408972.1|24340_24550_+	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_032408971.1|24539_25277_+	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
WP_048292305.1|25688_26297_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	3.0e-98
WP_023339397.1|26897_27143_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_048292306.1|27135_27462_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	1.1e-51
WP_023339395.1|27482_27710_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_023339393.1|28061_28349_-	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339392.1|28348_28657_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339391.1|28827_29049_+	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
WP_032408967.1|29060_29288_+	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_048292307.1|29605_30667_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	92.9	1.0e-170
WP_023339388.1|30725_31037_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
WP_048292308.1|31033_31525_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	4.1e-82
WP_040118545.1|31541_32018_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
WP_117037470.1|31965_32160_+	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
WP_032408961.1|32271_32571_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_053090680.1|32740_33802_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	38.3	8.8e-37
WP_072072213.1|33785_34148_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	94.2	2.4e-63
WP_032408958.1|34144_34429_+	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
WP_077256079.1|34425_34857_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	7.6e-40
WP_032408957.1|35273_35708_+|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
WP_032408956.1|35742_37452_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
WP_087924374.1|37624_38884_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.5	1.2e-221
WP_048276846.1|38920_39841_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	1.6e-148
WP_043519468.1|39918_41205_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	83.9	5.9e-205
WP_087924375.1|41264_41552_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	4.2e-18
WP_087924376.1|41532_41850_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	4.4e-45
WP_014228910.1|41846_42185_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_014228911.1|42165_42555_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	84.5	4.0e-56
WP_021462608.1|42551_42953_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	1.1e-61
WP_014228913.1|42984_43446_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|43503_43869_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_032422481.1|44101_47437_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.5	0.0e+00
WP_014228916.1|47436_47775_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
WP_014907809.1|47771_48527_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
WP_032439857.1|48528_49239_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	91.1	3.8e-137
WP_087924373.1|49280_49703_+	hypothetical protein	NA	A0A1B0VMH3	Pseudomonas_phage	37.9	9.8e-16
WP_032439859.1|49729_50323_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.2	6.1e-80
