The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024815	Escherichia coli strain CREC-629 chromosome, complete genome	4938993	1804205	1817388	4938993		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1804205_1804967_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1804960_1805587_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1805726_1806866_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1806928_1807921_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1808014_1809379_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1809467_1810244_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1810248_1810887_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_100183824.1|1810883_1812146_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	7.5e-136
WP_000847984.1|1812142_1813051_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1813246_1814014_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1814064_1814721_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1814826_1817388_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP024815	Escherichia coli strain CREC-629 chromosome, complete genome	4938993	2420470	2429911	4938993		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|2420470_2421397_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|2421401_2422133_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2422113_2422221_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2422280_2423012_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2423233_2424919_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2424915_2425635_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|2425681_2426152_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|2426191_2426653_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|2426777_2428778_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|2428774_2429911_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
NZ_CP024815	Escherichia coli strain CREC-629 chromosome, complete genome	4938993	2996527	3044649	4938993	protease,transposase,tail,lysis,integrase	Escherichia_phage(26.47%)	60	2990878:2990893	3021109:3021124
2990878:2990893	attL	TTCATAAAAATAATCC	NA	NA	NA	NA
WP_001260865.1|2996527_2997349_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2997448_2997532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2997624_2997960_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2998356_2999610_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2999716_3000610_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|3000744_3001965_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|3002089_3002785_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|3002737_3004030_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|3004188_3004803_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_049254808.1|3004845_3005700_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
WP_000213028.1|3005701_3006319_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|3006329_3008753_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041675.1|3008813_3011240_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|3011438_3011744_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3011851_3012562_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3012564_3013125_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3013159_3013501_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3013635_3013962_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3014167_3015382_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|3015393_3016413_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|3016470_3016581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|3016600_3017881_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|3017915_3018152_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001151262.1|3020234_3020657_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|3020653_3021010_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001333339.1|3021529_3023065_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
3021109:3021124	attR	GGATTATTTTTATGAA	NA	NA	NA	NA
WP_001341330.1|3023113_3023347_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	7.8e-39
WP_000955178.1|3024410_3024593_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|3024770_3026084_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|3026520_3026853_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|3027055_3027361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|3027385_3027625_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|3027624_3027912_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|3027983_3028139_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|3028355_3028607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|3028673_3028952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|3028953_3030003_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|3030016_3030769_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|3031046_3031136_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|3031190_3031403_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|3031703_3031919_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|3032672_3032888_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|3032892_3033204_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|3033200_3033734_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|3033730_3034228_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|3034590_3034803_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|3034813_3035002_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|3035004_3035070_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|3035149_3035305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|3035476_3035650_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|3035801_3036212_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|3036269_3036503_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|3036891_3037437_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_049254577.1|3037411_3039217_+	hypothetical protein	NA	A0A0K2FJ14	Enterobacteria_phage	99.1	1.3e-213
WP_000885611.1|3039216_3039792_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|3039889_3040480_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|3040796_3041030_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3041098_3041212_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|3041816_3043100_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527809.1|3043188_3044649_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 4
NZ_CP024815	Escherichia coli strain CREC-629 chromosome, complete genome	4938993	3426000	3505583	4938993	terminase,transposase,tRNA,tail,capsid,holin,integrase,portal,head	Escherichia_phage(41.18%)	88	3457733:3457747	3505685:3505699
WP_012579081.1|3426000_3426924_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001617865.1|3427003_3427879_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_001339197.1|3428123_3429332_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000608644.1|3429466_3430729_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000695215.1|3431046_3431448_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_001056840.1|3431550_3431919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301105.1|3432438_3433134_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3433157_3433970_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3433973_3434240_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|3434989_3435109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325005.1|3435069_3435255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3435355_3435529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|3435530_3435875_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001065861.1|3439317_3439536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246498.1|3439667_3441191_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|3441522_3441771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|3441883_3442150_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|3442178_3442451_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554140.1|3442493_3442730_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001299269.1|3443043_3444255_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332303.1|3444459_3445191_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3445411_3445816_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|3445868_3445979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|3446515_3446839_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000444488.1|3446941_3448192_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001248681.1|3448363_3449017_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3449026_3449488_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|3449541_3450648_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3450683_3451325_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|3451328_3452699_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|3452867_3453539_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3453538_3454999_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|3455074_3456196_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|3456244_3457471_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3457720_3458857_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
3457733:3457747	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|3458840_3459704_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|3460258_3460927_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|3461164_3461695_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|3462428_3462800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|3463108_3464617_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|3468570_3469170_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|3469237_3472717_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|3472777_3473386_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|3473322_3474066_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|3474071_3474770_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|3474769_3475126_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|3475103_3478331_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|3478377_3478638_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|3478679_3479066_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_100183844.1|3479065_3479770_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.3	1.2e-111
WP_001206700.1|3479830_3480175_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|3480171_3480621_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|3480617_3480956_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|3480964_3481282_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_100183845.1|3481358_3482576_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	7.7e-162
WP_000923134.1|3483181_3484408_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|3484555_3486313_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|3486312_3486795_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|3486942_3487293_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|3487818_3488112_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|3488202_3488385_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|3488601_3489135_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|3489198_3489549_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|3489553_3489769_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|3490076_3490265_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|3490525_3490861_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|3490931_3491144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|3491632_3491719_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000762879.1|3492113_3492935_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|3492931_3493312_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|3493312_3494371_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|3494372_3494651_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|3494818_3495031_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001224662.1|3496065_3496248_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|3496341_3496698_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|3496755_3497178_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|3497218_3498289_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|3498360_3498786_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|3498769_3499012_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|3499403_3499742_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|3500173_3500374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|3500466_3500685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|3500649_3500853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|3501253_3501442_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|3501438_3501630_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|3501723_3504165_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|3504226_3504496_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|3504464_3505583_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
3505685:3505699	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP024815	Escherichia coli strain CREC-629 chromosome, complete genome	4938993	3714869	3831975	4938993	terminase,protease,tRNA,capsid,integrase,head	uncultured_Caudovirales_phage(23.08%)	130	3771268:3771290	3829824:3829837
WP_001298300.1|3714869_3715655_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3715790_3716570_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436932.1|3716546_3717440_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011620.1|3717593_3718340_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3718336_3718519_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056538.1|3718570_3719803_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000570539.1|3719839_3720826_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3720822_3722571_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|3722607_3724872_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3725079_3725364_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3725523_3727197_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3727307_3727991_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|3728163_3728928_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445231.1|3729096_3730380_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057138.1|3730450_3731539_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|3731737_3732430_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|3732559_3734320_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3734725_3735583_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3735637_3737920_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3738111_3738852_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001190363.1|3738933_3739524_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242684.1|3739623_3740532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|3740532_3741963_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109259.1|3742172_3743321_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|3743634_3744261_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|3744295_3745159_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|3745160_3745778_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|3745788_3748233_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3748471_3749764_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3749854_3751198_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3751208_3751820_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3751978_3755968_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3756102_3756597_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3757141_3758107_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043592.1|3758229_3759996_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_001202175.1|3759996_3761718_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|3761759_3762464_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3762748_3762967_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3763651_3765928_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3765958_3766279_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_001595598.1|3767065_3767356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047634587.1|3767601_3768144_-|terminase	terminase	terminase	O64316	Escherichia_phage	45.7	3.5e-34
WP_085693326.1|3768345_3768729_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190771.1|3768740_3769082_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|3769091_3770132_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_069723201.1|3770349_3770772_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|3770768_3771014_-	hypothetical protein	NA	NA	NA	NA	NA
3771268:3771290	attL	AGGGTGAACAGTGGTGAACAGTT	NA	NA	NA	NA
WP_085693328.1|3771301_3773119_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	6.3e-128
3771268:3771290	attL	AGGGTGAACAGTGGTGAACAGTT	NA	NA	NA	NA
WP_085693330.1|3773115_3773409_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_085693332.1|3773415_3773736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890993.1|3773728_3774268_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	69.9	1.4e-27
WP_000201462.1|3774467_3774647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039771.1|3774704_3774914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206971.1|3775028_3775238_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
WP_072652362.1|3775657_3776896_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	6.9e-126
WP_001595598.1|3777552_3777843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047634587.1|3778088_3778631_-|terminase	terminase	terminase	O64316	Escherichia_phage	45.7	3.5e-34
WP_085693326.1|3778832_3779216_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069723201.1|3780832_3781255_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|3781251_3781497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085693328.1|3781784_3783602_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	6.3e-128
3781623:3781645	attR	AACTGTTCACCACTGTTCACCCT	NA	NA	NA	NA
WP_085693330.1|3783598_3783892_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
3781623:3781645	attR	AACTGTTCACCACTGTTCACCCT	NA	NA	NA	NA
WP_085693332.1|3783898_3784219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890993.1|3784211_3784751_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	69.9	1.4e-27
WP_000201462.1|3784950_3785130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039771.1|3785187_3785397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206971.1|3785511_3785721_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
WP_072652362.1|3786140_3787379_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	6.9e-126
WP_001595598.1|3788035_3788326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047634587.1|3788571_3789114_-|terminase	terminase	terminase	O64316	Escherichia_phage	45.7	3.5e-34
WP_085693326.1|3789315_3789699_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190771.1|3789710_3790052_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|3790061_3791102_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_069723201.1|3791319_3791742_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|3791738_3791984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085693328.1|3792271_3794089_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	6.3e-128
WP_085693330.1|3794085_3794379_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_085693332.1|3794385_3794706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890993.1|3794698_3795238_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	69.9	1.4e-27
WP_000201462.1|3795437_3795617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039771.1|3795674_3795884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206971.1|3795998_3796208_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
WP_072652362.1|3796627_3797866_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	6.9e-126
WP_001595598.1|3798522_3798813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047634587.1|3799058_3799601_-|terminase	terminase	terminase	O64316	Escherichia_phage	45.7	3.5e-34
WP_085693326.1|3799802_3800186_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190771.1|3800197_3800539_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|3800548_3801589_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_069723201.1|3801806_3802229_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|3802225_3802471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085693328.1|3802759_3804577_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	6.3e-128
WP_085693330.1|3804573_3804867_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_085693332.1|3804873_3805194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890993.1|3805186_3805726_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	69.9	1.4e-27
WP_000201462.1|3805925_3806105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039771.1|3806162_3806372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206971.1|3806485_3806695_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
WP_072652362.1|3807114_3808353_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	6.9e-126
WP_001595598.1|3809009_3809300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047634587.1|3809545_3810088_-|terminase	terminase	terminase	O64316	Escherichia_phage	45.7	3.5e-34
WP_085693326.1|3810289_3810673_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190771.1|3810684_3811026_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|3811035_3812076_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_069723201.1|3812293_3812716_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|3812712_3812958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085693328.1|3813245_3815063_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	6.3e-128
WP_085693330.1|3815059_3815353_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_085693332.1|3815359_3815680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890993.1|3815672_3816212_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	69.9	1.4e-27
WP_000201462.1|3816411_3816591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039771.1|3816648_3816858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206971.1|3816972_3817182_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
WP_072652362.1|3817601_3818840_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	6.9e-126
WP_001595598.1|3819496_3819787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047634587.1|3820032_3820575_-|terminase	terminase	terminase	O64316	Escherichia_phage	45.7	3.5e-34
WP_085693326.1|3820776_3821160_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190771.1|3821171_3821513_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|3821522_3822563_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_069723201.1|3822780_3823203_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|3823199_3823445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085693328.1|3823732_3825550_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	6.3e-128
WP_085693330.1|3825546_3825840_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_085693332.1|3825846_3826167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890993.1|3826159_3826699_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	69.9	1.4e-27
WP_000201462.1|3826898_3827078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039771.1|3827135_3827345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206971.1|3827459_3827669_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
WP_072652362.1|3828088_3829327_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	6.9e-126
WP_000410785.1|3829731_3829956_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188144.1|3830028_3831975_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 6
NZ_CP024815	Escherichia coli strain CREC-629 chromosome, complete genome	4938993	4422850	4557970	4938993	terminase,head,transposase,tail,capsid,lysis,integrase,portal	Enterobacteria_phage(32.79%)	119	4497165:4497224	4543424:4543483
WP_000019473.1|4422850_4423831_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000370307.1|4424298_4424994_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|4424986_4426414_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|4426424_4427144_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4427670_4428525_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|4428750_4430076_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|4430184_4430421_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4430432_4431026_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|4431615_4432467_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000020221.1|4432606_4436863_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|4437977_4438079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|4438442_4438706_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4438705_4438846_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|4438880_4439108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|4439717_4440734_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001301257.1|4441129_4441672_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4441746_4442334_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4442391_4443060_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|4443085_4445611_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|4445600_4447244_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|4447212_4447923_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4448235_4448565_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4448812_4449427_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|4449844_4450534_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|4450530_4451487_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|4451483_4453682_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|4453691_4454648_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|4454626_4455037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001094398.1|4455357_4455726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249034.1|4455746_4456052_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086755.1|4456155_4456800_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.0	5.2e-24
WP_000692345.1|4456818_4457040_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001424026.1|4457108_4457585_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|4457600_4458074_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001234565.1|4458415_4459237_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	4.0e-45
WP_000581506.1|4459646_4460102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023149781.1|4460177_4462694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070751363.1|4466033_4466906_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000200813.1|4467169_4468726_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	2.2e-105
WP_050019106.1|4468722_4469949_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000149676.1|4470070_4473187_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_000443938.1|4475813_4477265_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000995975.1|4477257_4479300_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000108720.1|4479486_4485222_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_032142224.1|4487752_4488124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282095.1|4490086_4490650_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335705.1|4491615_4493049_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000120391.1|4493297_4493525_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000266638.1|4493630_4493858_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_070749884.1|4494548_4496180_+	hypothetical protein	NA	NA	NA	NA	NA
4497165:4497224	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_023150042.1|4497763_4499134_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_032336984.1|4499386_4500328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023150044.1|4500804_4501620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024176455.1|4502603_4503431_-	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	52.3	3.1e-74
WP_097474846.1|4506670_4507270_-	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	99.0	5.7e-110
WP_100183861.1|4507340_4510754_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.5	0.0e+00
WP_000090891.1|4510814_4511447_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_097474844.1|4511383_4512127_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	9.5e-147
WP_069903524.1|4512131_4512830_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_023149683.1|4512829_4513159_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	95.4	1.7e-55
WP_023149684.1|4513155_4515735_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.0	0.0e+00
WP_000459457.1|4515727_4516162_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479155.1|4516143_4516566_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_024176375.1|4516581_4517322_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	2.8e-130
WP_000683106.1|4517329_4517725_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_000975067.1|4517721_4518300_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000753001.1|4518311_4518665_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_024176376.1|4518676_4519072_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.1e-52
WP_000063273.1|4519113_4520139_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_012304872.1|4520194_4520527_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_000123234.1|4520536_4521856_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.1e-233
WP_100183862.1|4521836_4523438_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	6.1e-308
WP_000198149.1|4523434_4523641_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_023149688.1|4523637_4525563_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453611.1|4525537_4526083_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_032336848.1|4526471_4526705_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.1	1.5e-21
WP_024176377.1|4526761_4527172_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.3	1.2e-55
WP_001139681.1|4527523_4527676_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_089590786.1|4527663_4528131_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	99.4	1.1e-76
WP_000992100.1|4528127_4528661_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193264.1|4528724_4529075_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000839596.1|4529079_4529295_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4529365_4530418_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917730.1|4530568_4530772_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_000750482.1|4531172_4532036_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	40.8	2.4e-40
WP_077908626.1|4532048_4532414_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.4e-56
WP_001420253.1|4532429_4533419_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_023149744.1|4533426_4534224_-	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	98.1	3.2e-148
WP_000767111.1|4534243_4534633_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_000210173.1|4534629_4534956_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_001407082.1|4534955_4535450_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	100.0	2.7e-89
WP_023149745.1|4535446_4536388_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
WP_001250269.1|4536377_4536557_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_100183866.1|4536732_4537284_-	hypothetical protein	NA	U5P4K1	Shigella_phage	97.8	3.8e-100
WP_000205494.1|4537321_4537522_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|4537619_4538246_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559922.1|4538473_4538989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|4539458_4539821_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|4539886_4540711_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|4540838_4541375_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|4541365_4541728_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_023149750.1|4541727_4542033_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_077873866.1|4541948_4542383_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_023149751.1|4542259_4543423_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	7.7e-228
WP_000893278.1|4543627_4544881_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
4543424:4543483	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4544892_4545996_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|4546283_4547339_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|4547377_4547779_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|4547836_4549081_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4549172_4549631_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|4549891_4551349_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|4551405_4551942_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_100183863.1|4551874_4552141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|4552446_4552899_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|4552908_4553307_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554758.1|4553309_4553603_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001333407.1|4554779_4555550_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|4555509_4557249_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|4557472_4557970_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP024815	Escherichia coli strain CREC-629 chromosome, complete genome	4938993	4566228	4639071	4938993	plate,tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420818.1|4566228_4567365_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|4567795_4568188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|4568165_4572398_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|4572473_4574615_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|4574824_4575343_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4576037_4576538_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4576572_4576797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|4576847_4578323_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|4578329_4578743_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|4578746_4580597_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4580560_4581643_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|4581667_4582948_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4582944_4583469_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|4583471_4584803_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|4584807_4585569_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|4585577_4588343_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|4588339_4589083_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|4589087_4590500_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|4590608_4594043_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|4594053_4595406_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|4595429_4595912_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_024210760.1|4596128_4596869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100183864.1|4596878_4597358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|4597494_4598280_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|4598816_4599548_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|4599612_4600080_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|4600076_4600799_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4600832_4601588_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4601659_4603018_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|4603065_4603689_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|4603692_4604493_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|4604733_4605648_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|4605644_4606448_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|4612208_4612784_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|4612971_4614003_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|4613995_4614649_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|4614688_4615504_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4615621_4616026_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4616022_4616730_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|4616841_4618560_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|4618613_4619438_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|4619637_4620348_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|4620361_4620784_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|4620780_4621326_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4621491_4621692_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4621678_4621939_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|4621987_4623286_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|4623350_4623740_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|4623796_4625938_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4626036_4626996_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4627008_4630491_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4630527_4631124_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|4631120_4632269_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4632268_4633057_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4633060_4633516_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4633620_4634646_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4634649_4635135_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4635256_4637689_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4637718_4639071_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	0	51687	176274	integrase,transposase	Escherichia_phage(50.0%)	52	5940:5999	51692:52512
WP_001067858.1|1332_2037_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|2449_3310_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|3322_3865_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|4346_4538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|4543_4789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837927.1|4839_5967_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
5940:5999	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|6003_6708_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000796505.1|7499_7694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403365.1|8250_9117_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|9106_9994_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|10004_10829_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|10834_11908_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|11900_13211_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067834.1|15130_15835_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000874189.1|16544_17030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|17054_17540_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|17526_18222_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|18226_19357_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_100183867.1|19346_20630_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|20632_22012_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|22115_22643_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|22683_24570_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|24916_25732_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|25914_26421_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|26410_26569_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000428546.1|29420_30014_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|30126_31332_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001322387.1|31410_32037_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|32014_32701_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|32708_33095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049802299.1|33087_33351_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001067834.1|34220_34925_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_013362816.1|35247_36780_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013362817.1|37308_37758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100249774.1|38272_38383_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
WP_013362818.1|38387_39125_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|39250_39346_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|39480_40185_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|40306_41212_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|41208_42447_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|42446_43031_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|43523_44288_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|44514_44820_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|44830_46036_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|46191_46395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|46522_47362_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|47355_47703_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|47908_48697_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|48827_49301_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|49458_50472_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_157787290.1|50440_51037_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|50982_51687_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
51692:52512	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTGTGGACTGTGCGTCTCACACCCGGGCCATCGTCAACGCGGTCACACCGCTGAGAAAAGATTTTGCCGTATTCGCCGGTTTTGATGAGTACTTTGTACCCAATCTGATGAACGGAGGCGCCGGAGTTCTTTCCGGACTGAATAATGTGGTGCCGGAGCTTTTTGCCCAAATTATGCGGGCCTATCGGGCCGGCGACCTCAATGAAGTCGCCGGATTACACAAAGAAATTGGGCGACTTTCCGGGATATATGCCATTGGTGATGATTTTGTCAGTACGATCAAAACCGCCATTTCCAGAAAGTATGGCTACATGACGCCGGTCTCACGGAATCATAACGGCCAGTTAACAGCCGACCAGGCAGACTGCCTAGACAAATTGTTCGGTCTGTAACCGCAAAAGGACAGGAGGCACATCATGAAAAAAGACATCATTTATACCACCGGGGCTCCTGCCCCCGGTGGGGCATTATCTCAGGCGGTGAAAGCCGGGGAAACCATTTATCTCGCCGGTCAGGTCGGTTTTGACCCGCATACCATGCAAGTGGTCTCAACAGATTTCGATGAACAGGCCCGTCAGGCGTTTAAAAATTTGCTGTCGGTGGCAGAGGCCGCAGGAGGGAGTGATAGGGATATTGTGAAGCTGAATGCCTATCTGACCGACGTGAACATGTTCCCGCGATTTAACGCCATTATGTCGGAATACTTTTCGCCACCGTACCCCGCCAGGGCTACGTTGGGTATCGCCGCCCTGCCGCAGGGGG	NA	NA	NA	NA
>prophage 2
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	58716	61453	176274	transposase	Macacine_betaherpesvirus(33.33%)	3	NA	NA
WP_001066942.1|58716_59457_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_100183871.1|59741_60713_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.0	4.5e-96
WP_001067858.1|60748_61453_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 3
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	67230	76496	176274	transposase	Escherichia_phage(62.5%)	9	NA	NA
WP_012372828.1|67230_68247_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|68474_68792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|69078_69438_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|69465_69645_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|69649_70030_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|70029_70251_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001553856.1|70433_71990_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_048266692.1|71986_73258_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	27.6	6.9e-12
WP_001553854.1|73379_76496_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
>prophage 4
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	89362	97260	176274	integrase	Macacine_betaherpesvirus(80.0%)	6	77868:77884	103050:103066
77868:77884	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
WP_000016982.1|89362_90169_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|90942_91698_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|92285_93452_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|93451_94423_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_001348615.1|95289_96192_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|96576_97260_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
103050:103066	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
>prophage 5
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	102981	108707	176274	transposase	Thalassomonas_phage(33.33%)	5	NA	NA
WP_001348621.1|102981_103545_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_032153960.1|103570_103807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089634947.1|104907_105477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087523611.1|105461_106735_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
WP_000053332.1|107696_108707_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.1	6.2e-16
>prophage 6
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	112268	117206	176274		Bacillus_phage(33.33%)	4	NA	NA
WP_000813680.1|112268_113699_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
WP_001037799.1|113893_115288_+	glycoporin	NA	NA	NA	NA	NA
WP_059330006.1|116496_116859_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_000624725.1|116855_117206_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
>prophage 7
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	128306	129053	176274		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000205701.1|128306_129053_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.0	9.3e-09
>prophage 8
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	152685	152907	176274		Vibrio_virus(100.0%)	1	NA	NA
WP_001278692.1|152685_152907_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
>prophage 9
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	160958	161780	176274		Yersinia_phage(100.0%)	1	NA	NA
WP_001234465.1|160958_161780_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	1.7e-43
>prophage 10
NZ_CP024816	Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence	176274	174849	175710	176274		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000027057.1|174849_175710_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 1
NZ_CP024817	Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence	96990	0	96896	96990	transposase,terminase,holin,integrase,tail	Escherichia_phage(60.0%)	105	8398:8413	91330:91345
WP_023153696.1|577_1594_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
WP_000602719.1|1595_2381_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	3.6e-144
WP_000896801.1|2367_3096_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|3099_4317_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|4326_4704_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|4850_5096_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|5098_5677_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000096174.1|5743_5899_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_012817939.1|5840_6503_+	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000484110.1|6400_7027_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_023352819.1|7023_7701_+	hypothetical protein	NA	Q71TJ1	Escherichia_phage	99.6	1.1e-133
WP_000684868.1|7697_8399_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
8398:8413	attL	AATATTGCTCTAATAA	NA	NA	NA	NA
WP_023153718.1|8700_9963_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	9.2e-235
WP_000021768.1|10035_10542_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_023153717.1|10736_11465_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
WP_000158004.1|11548_11752_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_023352820.1|11744_11984_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_023154014.1|11980_12706_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	49.8	7.5e-48
WP_000118152.1|12702_13002_+	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_033550033.1|13003_13561_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	62.8	5.1e-36
WP_000224220.1|13562_13826_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_053903357.1|13836_14436_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	92.6	7.5e-78
WP_000516537.1|14518_14752_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_001677496.1|14930_15224_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_023154376.1|15230_15605_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	97.6	1.1e-66
WP_077780118.1|15586_16519_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.7	2.6e-178
WP_001261544.1|16515_16878_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_001377386.1|17539_17791_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_000506726.1|17914_18304_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|18376_18598_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|18597_18978_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|18982_19162_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000648823.1|19189_20233_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	2.2e-205
WP_001369802.1|20321_20774_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_000219605.1|20860_22054_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.0	4.1e-208
WP_000124155.1|22053_23538_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
WP_000611656.1|23562_24414_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|24524_24734_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542336.1|25337_25559_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_000067534.1|25566_26598_+|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.7	2.2e-194
WP_023156637.1|27205_27766_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	95.7	2.3e-97
WP_023156639.1|27954_28596_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	98.1	1.6e-113
WP_023156640.1|28652_29960_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000747846.1|30006_30255_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|30251_30692_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_062914756.1|30725_37493_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
WP_023153801.1|37568_39278_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_023352830.1|39270_40290_+	hypothetical protein	NA	Q71TR6	Escherichia_phage	89.7	7.6e-163
WP_001345478.1|40581_41139_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_023352831.1|41307_41796_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	87.7	1.1e-74
WP_023351931.1|41998_42787_+	hypothetical protein	NA	A0A077SK34	Escherichia_phage	99.2	8.0e-144
WP_023352832.1|42779_43874_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	6.7e-40
WP_001165936.1|43905_44214_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_062914757.1|44203_47191_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.5	0.0e+00
WP_048218295.1|47290_48499_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	99.8	4.1e-224
WP_000175491.1|48538_48904_-	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_048218296.1|48900_50820_-	defense against restriction protein A	NA	A0A1B0V7H1	Salmonella_phage	98.4	0.0e+00
WP_001345482.1|50821_51424_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|51410_51854_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|51850_52180_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_048218298.1|52254_52518_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	62.4	4.0e-23
WP_023351542.1|52953_53526_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.6	1.5e-83
WP_048218313.1|53556_54045_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	72.2	1.7e-59
WP_048218300.1|54044_54647_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	2.3e-95
WP_001032314.1|54618_55035_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	4.1e-22
WP_077879135.1|55037_58259_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	46.0	1.1e-16
WP_001286326.1|58270_58705_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_048218248.1|58783_59620_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	98.2	8.4e-152
WP_062914759.1|59619_61053_-	hypothetical protein	NA	A0A1B0VAD6	Salmonella_phage	99.8	8.2e-272
WP_000002800.1|61049_61406_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_100183872.1|61405_65101_-	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	85.9	0.0e+00
WP_000926342.1|65182_66064_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
WP_000523980.1|66078_66690_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_023153778.1|66700_67267_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
WP_032192786.1|67497_68391_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	3.4e-26
WP_001057312.1|68442_68919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093548.1|68941_69292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396852.1|69650_69770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071550046.1|69788_70010_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	9.3e-26
WP_033560573.1|70006_71098_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	79.8	7.1e-159
WP_001187875.1|71262_72063_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_062914760.1|72092_72938_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	97.5	1.8e-149
WP_052761440.1|73202_74258_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	70.8	9.0e-143
WP_001561122.1|74327_74615_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_053896077.1|74904_75501_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	100.0	6.3e-109
WP_000509939.1|75672_76182_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035251.1|76193_76775_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_062914761.1|76810_77626_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	9.8e-113
WP_062914762.1|77635_79225_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	1.9e-301
WP_023153705.1|79285_80992_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
WP_053903354.1|81218_82220_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	4.8e-178
WP_001285362.1|82236_83433_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001076427.1|83990_84851_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_000458377.1|85177_85579_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
WP_001281923.1|85649_86009_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
WP_000336811.1|86020_86161_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	97.8	3.1e-19
WP_000007769.1|86186_86609_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_048218262.1|86648_87437_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.9	1.7e-117
WP_001369296.1|87445_87625_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177862.1|87898_88183_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_000472529.1|88175_89081_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_062914763.1|89077_91342_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	66.8	0.0e+00
WP_000751808.1|93316_94144_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
91330:91345	attR	AATATTGCTCTAATAA	NA	NA	NA	NA
WP_001276603.1|94533_95898_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_062914764.1|95897_96896_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	8.1e-194
