The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024812	Enterobacter sp. CRENT-193 chromosome, complete genome	4852690	738450	771752	4852690	tRNA,integrase,transposase	Virus_Rctr41k(33.33%)	30	741474:741489	771223:771238
WP_003861139.1|738450_739815_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_000868608.1|740011_741169_+|integrase	site-specific integrase	integrase	A7J266	Streptococcus_phage	24.1	2.2e-09
WP_032471379.1|741199_741469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
741474:741489	attL	TTTATCTCAGCCAGTT	NA	NA	NA	NA
WP_000802152.1|741888_742842_-	replication protein	NA	NA	NA	NA	NA
WP_032471378.1|742828_743074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032471366.1|746062_746596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271073.1|746598_747210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709417.1|747389_747680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091004.1|747699_747954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000347733.1|747953_751358_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001266261.1|751361_752786_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_000783472.1|753029_753887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060801.1|753883_754279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901447.1|754693_754963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273953.1|755236_755554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031951562.1|756206_757079_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000556384.1|758275_759211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032471365.1|759782_760718_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_000845039.1|760686_761700_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001209508.1|761845_762637_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|762800_763148_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|763141_763981_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|764108_764609_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|764591_764732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|765115_765880_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_058647329.1|766531_767494_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.4	3.4e-56
WP_000777554.1|767857_768331_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_058647330.1|768741_769029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647331.1|769038_770286_-	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	36.9	2.1e-74
WP_000427614.1|770747_771752_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
771223:771238	attR	AACTGGCTGAGATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP024812	Enterobacter sp. CRENT-193 chromosome, complete genome	4852690	1965508	2058253	4852690	head,tRNA,portal,plate,transposase,tail,terminase,lysis,integrase,capsid	Escherichia_phage(23.4%)	98	1952420:1952437	2050484:2050501
1952420:1952437	attL	CGCGCTGAAGCTGCGCTC	NA	NA	NA	NA
WP_000427614.1|1965508_1966513_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003862253.1|1966790_1968008_+	succinyl transferase OpgC	NA	NA	NA	NA	NA
WP_022651687.1|1968018_1968918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651686.1|1968926_1970141_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_003862258.1|1970130_1970469_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_022651685.1|1970476_1970896_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_022651684.1|1970996_1972172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651683.1|1972183_1972975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651682.1|1972956_1973700_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022651681.1|1973708_1974473_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003862272.1|1974476_1975799_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_022651680.1|1975874_1977113_-	MFS transporter	NA	NA	NA	NA	NA
WP_003862277.1|1977421_1978492_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015571630.1|1978488_1979460_+	SnoaL-like polyketide cyclase	NA	NA	NA	NA	NA
WP_015571629.1|1979565_1980708_+	SnoaL-like polyketide cyclase	NA	NA	NA	NA	NA
WP_022651679.1|1980708_1982004_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_022651678.1|1982057_1983368_+	amidase	NA	NA	NA	NA	NA
WP_003863115.1|1983893_1984376_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_006811645.1|1984493_1984970_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863119.1|1984959_1985247_+	RnfH family protein	NA	NA	NA	NA	NA
WP_003863121.1|1985308_1985647_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_022651676.1|1985785_1987447_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003863124.1|1987532_1988411_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_003863126.1|1988533_1989127_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_026094274.1|1989179_1990466_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863130.1|1990485_1991277_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_003863132.1|1991443_1992805_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003863133.1|1992921_1993170_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863136.1|1993185_1993725_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863138.1|1993756_1994524_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1994567_1994915_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863141.1|1995047_1995452_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_058647360.1|1995490_1996861_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003863144.1|1996863_1997349_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003863147.1|1997361_1998582_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_003863149.1|1998574_1999111_-	YfiR family protein	NA	NA	NA	NA	NA
WP_003863151.1|1999264_1999639_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003863153.1|1999851_2000922_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_003863156.1|2000932_2002054_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_044704196.1|2002252_2002645_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.2	2.8e-25
WP_023323577.1|2002690_2002912_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	4.9e-27
WP_023323578.1|2002988_2004158_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.8	4.6e-172
WP_023323579.1|2004154_2004619_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	9.3e-60
WP_044704185.1|2004629_2007080_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.6	2.8e-304
WP_017382998.1|2007069_2007192_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_032618991.1|2007224_2007548_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	2.3e-25
WP_023295232.1|2007605_2008124_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_044704184.1|2008136_2009330_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	1.1e-184
WP_044704182.1|2009800_2010253_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	39.6	1.1e-15
WP_044704181.1|2010254_2012684_-	hypothetical protein	NA	S4TP62	Salmonella_phage	48.3	1.9e-103
WP_044704180.1|2012695_2013226_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	3.1e-91
WP_032618987.1|2013218_2014127_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_044704178.1|2014132_2014483_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	71.6	3.1e-39
WP_044704177.1|2014479_2015115_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.3	3.7e-99
WP_100185462.1|2015183_2015633_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.1	4.7e-48
WP_058675207.1|2015625_2016093_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	68.4	2.3e-58
WP_039269012.1|2016188_2016605_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	68.8	4.2e-43
WP_063132907.1|2016604_2017036_-	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	76.2	7.6e-56
WP_023295248.1|2017032_2017545_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
WP_014170137.1|2017528_2017750_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	72.6	2.1e-25
WP_017382979.1|2017740_2017944_-|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_032609900.1|2017943_2018450_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_023323597.1|2018549_2019305_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.9	7.5e-75
WP_017382976.1|2019308_2020376_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.6	9.7e-169
WP_017382975.1|2020431_2021286_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	2.4e-114
WP_045893680.1|2021451_2023221_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.7	3.8e-303
WP_032618971.1|2023222_2024248_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	4.6e-168
WP_052753438.1|2024574_2025198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704163.1|2025244_2025502_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	58.8	6.8e-20
WP_044704194.1|2025867_2026332_-	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	51.3	1.1e-39
WP_044704159.1|2026337_2028623_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	74.6	0.0e+00
WP_044704158.1|2028612_2028888_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	60.4	1.7e-24
WP_044704157.1|2028904_2029120_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_044704156.1|2029185_2029686_-	hypothetical protein	NA	M1SV55	Escherichia_phage	88.0	9.4e-82
WP_044704192.1|2029676_2029856_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	64.9	1.4e-11
WP_023295263.1|2029858_2030131_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	3.4e-38
WP_032610269.1|2030290_2030584_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	68.0	4.2e-34
WP_032609917.1|2030653_2031634_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	80.1	4.4e-152
WP_003863157.1|2031823_2032696_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_003863160.1|2032692_2033853_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100229775.1|2033960_2034008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003863162.1|2034113_2034455_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003863164.1|2034722_2035460_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863165.1|2035591_2036572_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863167.1|2036568_2037300_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_022651674.1|2037429_2040003_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	4.5e-127
WP_058647525.1|2045653_2046106_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	49.3	4.3e-33
WP_003860741.1|2046257_2047565_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_003860739.1|2047561_2047885_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_022651673.1|2047931_2049287_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_022651672.1|2049396_2052060_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
2050484:2050501	attR	GAGCGCAGCTTCAGCGCG	NA	NA	NA	NA
WP_003860734.1|2052095_2052794_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_003860733.1|2052864_2053284_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_022651671.1|2053488_2054574_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860729.1|2054613_2055303_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_003860727.1|2055618_2056002_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860725.1|2056054_2057383_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860724.1|2057515_2058253_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP024812	Enterobacter sp. CRENT-193 chromosome, complete genome	4852690	2504623	2512369	4852690		Ostreococcus_lucimarinus_virus(16.67%)	7	NA	NA
WP_003859473.1|2504623_2506030_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
WP_003859475.1|2506119_2507205_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	3.7e-99
WP_003859476.1|2507205_2508087_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.4	1.5e-103
WP_003859477.1|2508326_2509493_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_003859478.1|2509541_2510546_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-33
WP_003859479.1|2510738_2511719_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_003859480.1|2511757_2512369_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.1e-14
>prophage 4
NZ_CP024812	Enterobacter sp. CRENT-193 chromosome, complete genome	4852690	2594950	2643564	4852690	head,integrase,tail,holin	Salmonella_phage(33.9%)	72	2586456:2586470	2630498:2630512
2586456:2586470	attL	TCGTGCCGTACTGGC	NA	NA	NA	NA
WP_100185466.1|2594950_2596246_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	68.9	3.9e-180
WP_014070846.1|2596291_2596537_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	67.9	9.4e-27
WP_100185467.1|2596643_2596874_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	89.5	5.3e-32
WP_063137247.1|2596882_2597122_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	73.1	1.4e-27
WP_063963182.1|2597099_2597720_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	44.9	4.2e-47
WP_100185468.1|2597716_2597938_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	2.1e-17
WP_048244440.1|2598029_2598260_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	39.7	2.9e-06
WP_048244438.1|2598256_2598478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100185469.1|2598474_2599044_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.2	2.1e-53
WP_100185470.1|2599204_2599633_-	regulator	NA	M9NYX4	Enterobacteria_phage	93.0	9.2e-70
WP_026080606.1|2599629_2600310_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	96.0	3.1e-128
WP_100185471.1|2600306_2600513_-	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	82.0	5.6e-17
WP_100185472.1|2600509_2601355_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	55.8	3.4e-68
WP_100185473.1|2601373_2601658_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	93.6	6.5e-48
WP_100185474.1|2601665_2602745_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	70.2	5.8e-36
WP_157787721.1|2602815_2603262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047344318.1|2603248_2603422_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_047717799.1|2603578_2603788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269180.1|2603951_2604389_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	3.9e-76
WP_045907318.1|2604883_2605516_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.1	9.8e-36
WP_045343394.1|2605614_2605836_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	53.6	2.4e-13
WP_100185476.1|2605865_2606408_+	regulator	NA	M9NZI6	Enterobacteria_phage	77.8	7.8e-74
WP_100185477.1|2606636_2607722_+	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.4	2.0e-84
WP_058691364.1|2607718_2609092_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	64.0	6.8e-167
WP_075551288.1|2609081_2609396_+	protein ren	NA	M1FPD5	Enterobacteria_phage	51.6	6.6e-17
WP_045345369.1|2609392_2609593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100185478.1|2609589_2610003_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	42.2	5.8e-13
WP_058656688.1|2610004_2610673_+	hypothetical protein	NA	Q6UAU0	Klebsiella_phage	91.3	1.0e-123
WP_058656690.1|2611548_2611758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023330681.1|2611949_2612399_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	52.7	1.3e-37
WP_100185479.1|2612391_2612562_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	89.3	1.3e-19
WP_047352406.1|2612554_2613187_+	bacteriophage Lambda NinG protein	NA	S4TSR3	Salmonella_phage	51.9	6.8e-53
WP_094166857.1|2613183_2613300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100185480.1|2613299_2614109_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	99.3	1.1e-153
WP_001514183.1|2614583_2614985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|2614981_2615257_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_022651099.1|2615259_2615802_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	2.7e-74
WP_022651100.1|2615798_2616071_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	59.1	3.1e-15
WP_047724946.1|2616027_2616225_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.7	1.6e-16
WP_100185524.1|2616526_2617009_+	hypothetical protein	NA	A0A0A6Z588	Enterobacter_phage	40.9	3.2e-18
WP_100185481.1|2617147_2617354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100185482.1|2617357_2617996_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.0	3.7e-115
WP_022651005.1|2618028_2618508_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	87.2	3.3e-60
WP_100185483.1|2618494_2619973_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	86.4	7.2e-255
WP_100185484.1|2619988_2621341_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	80.0	4.8e-213
WP_100185485.1|2621294_2622224_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	81.5	2.5e-136
WP_100185486.1|2622227_2623490_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	87.4	1.9e-211
WP_032676278.1|2623502_2623958_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	82.8	3.0e-63
WP_032676277.1|2623972_2625070_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	83.6	6.2e-179
WP_032676276.1|2625079_2625376_+	hypothetical protein	NA	G0ZNE0	Cronobacter_phage	70.4	7.3e-34
WP_023303612.1|2625434_2625836_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	91.7	3.4e-66
WP_017384089.1|2626007_2626370_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	92.5	3.2e-63
WP_042889545.1|2626377_2626815_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	97.9	1.7e-74
WP_100185487.1|2626811_2627198_+	hypothetical protein	NA	A0A1V0E5P4	Salmonella_phage	95.3	9.5e-66
WP_058685349.1|2627215_2627950_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	85.2	1.0e-113
WP_063216497.1|2627989_2628643_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	92.2	7.9e-113
WP_000735926.1|2629256_2629532_+	hypothetical protein	NA	Q5G8V7	Enterobacteria_phage	72.5	1.8e-26
WP_042889550.1|2629649_2630054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059596139.1|2630118_2633520_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	51.4	8.7e-187
2630498:2630512	attR	GCCAGTACGGCACGA	NA	NA	NA	NA
WP_063250684.1|2633519_2633867_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	94.8	7.0e-60
WP_063250681.1|2633877_2634084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154815480.1|2634076_2634283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063946804.1|2634449_2635154_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	4.2e-136
WP_100185525.1|2635153_2635873_+	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	81.0	2.8e-119
WP_017385011.1|2635815_2636349_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	68.2	1.0e-54
WP_100185488.1|2636358_2640108_+	DUF1983 domain-containing protein	NA	A0A1V0E5M1	Salmonella_phage	60.7	0.0e+00
WP_017694302.1|2640150_2640465_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	3.0e-33
WP_006809145.1|2640465_2641137_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.0e-87
WP_100185489.1|2641244_2641478_+	cor protein	NA	E4WL42	Enterobacteria_phage	76.3	7.3e-29
WP_100185490.1|2641536_2642919_+|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	56.1	1.5e-121
WP_157787722.1|2643013_2643253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017693216.1|2643240_2643564_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.5	1.4e-22
>prophage 5
NZ_CP024812	Enterobacter sp. CRENT-193 chromosome, complete genome	4852690	2741672	2805073	4852690	head,protease,tail,terminase,integrase,holin	Cronobacter_phage(31.15%)	88	2743858:2743886	2792790:2792818
WP_003859784.1|2741672_2741903_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_022651439.1|2742040_2742412_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_022651438.1|2742413_2743283_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003859787.1|2743299_2743638_+	YebY family protein	NA	NA	NA	NA	NA
2743858:2743886	attL	ACAGGAATCGTATTCGGTCTCTTTTTATC	NA	NA	NA	NA
WP_039268953.1|2743960_2745046_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	9.6e-148
WP_023300430.1|2745014_2745287_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	2.9e-29
WP_047725139.1|2745407_2745929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053004013.1|2745985_2746201_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	66.2	2.6e-17
WP_047725137.1|2746292_2746523_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	39.7	7.7e-07
WP_047725134.1|2746519_2746741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720562.1|2746737_2746956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072058660.1|2746965_2747682_-	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	49.6	1.1e-62
WP_058663640.1|2747678_2748341_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	91.2	8.2e-118
WP_058663639.1|2748316_2748844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058663638.1|2748840_2748990_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_058663637.1|2748986_2749415_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.8	3.4e-72
WP_058663636.1|2749411_2750092_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.2	1.4e-125
WP_058663635.1|2750088_2750934_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	4.8e-70
WP_045330311.1|2750951_2751236_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	93.6	1.5e-47
WP_006809788.1|2751307_2751517_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_058663634.1|2751668_2751938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058648000.1|2752096_2752534_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	96.6	1.5e-75
WP_058691551.1|2752958_2753156_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	90.6	1.0e-23
WP_100185496.1|2753293_2754112_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.8	2.0e-36
WP_058663706.1|2754343_2755003_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	66.5	8.0e-73
WP_022650973.1|2755111_2755330_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.0	1.9e-10
WP_047724847.1|2755360_2755903_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	92.2	3.3e-88
WP_047724849.1|2756036_2756765_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	69.1	5.6e-35
WP_086527956.1|2756761_2757541_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.2	1.8e-95
WP_047724854.1|2757537_2757837_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	53.7	7.4e-18
WP_047724857.1|2757833_2758130_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	9.3e-29
WP_053004007.1|2758126_2758435_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	48.6	1.1e-11
WP_047724860.1|2758431_2758818_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	79.0	1.5e-31
WP_047724863.1|2758819_2759023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663708.1|2759551_2759746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663710.1|2760022_2760277_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	47.4	4.1e-09
WP_023330682.1|2760422_2760704_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	53.8	3.2e-23
WP_058663711.1|2760914_2761364_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.9	3.8e-34
WP_058663712.1|2761356_2761527_+	NinE family protein	NA	G8C7V4	Escherichia_phage	82.1	8.5e-19
WP_058663713.1|2761519_2762125_+	protein ninG	NA	A0A1P8DTE0	Proteus_phage	63.8	4.3e-65
WP_072206104.1|2762121_2762322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023330677.1|2762308_2762425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663714.1|2762421_2763111_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	6.5e-57
WP_122008274.1|2763849_2764155_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_044704956.1|2764141_2764582_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.2	8.0e-61
WP_044704953.1|2764578_2764965_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	40.3	7.9e-12
WP_046695771.1|2765363_2765579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651103.1|2765638_2765974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704358.1|2766001_2766517_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	76.4	2.3e-67
WP_044704357.1|2766516_2767989_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.9	1.3e-253
WP_044704355.1|2768000_2769461_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	74.8	8.5e-200
WP_072056246.1|2769408_2770395_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.1	4.0e-108
WP_044704353.1|2770426_2770621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044704352.1|2770713_2771910_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	48.4	5.7e-93
WP_047724469.1|2771913_2772348_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	5.1e-52
WP_014884000.1|2772357_2773455_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	7.6e-161
WP_047724465.1|2773464_2773830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047724463.1|2773832_2774213_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	5.3e-29
WP_047724461.1|2774212_2774386_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	1.0e-11
WP_047724459.1|2774385_2774736_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	4.0e-39
WP_047724457.1|2774738_2775107_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	3.0e-45
WP_047724455.1|2775103_2775487_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	2.9e-38
WP_047724454.1|2775545_2776301_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	53.4	9.9e-59
WP_047724452.1|2776351_2777095_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.2	1.9e-62
WP_032619448.1|2777167_2777542_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	54.4	1.3e-24
WP_047724448.1|2777599_2779927_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	52.3	6.2e-152
WP_047724447.1|2779926_2780424_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.7	4.3e-87
WP_015571561.1|2780423_2780894_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_047724445.1|2780907_2781273_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.9	1.7e-61
WP_047724443.1|2781259_2783737_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.1	0.0e+00
WP_003859861.1|2783792_2786216_+	SGNH/GDSL hydrolase family protein	NA	G0XNW5	Escherichia_phage	39.8	3.5e-142
WP_039268929.1|2786895_2788206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859865.1|2788198_2789128_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	90.1	5.7e-157
WP_003859867.1|2789124_2789487_-	GtrA family protein	NA	U5P0S6	Shigella_phage	85.0	4.4e-49
WP_003859869.1|2789599_2789905_+	hypothetical protein	NA	I6PCW5	Cronobacter_phage	40.6	7.8e-15
WP_003859872.1|2789904_2791173_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.5	3.4e-229
WP_032666022.1|2791315_2791723_+	cell envelope integrity/translocation protein TolA	NA	NA	NA	NA	NA
WP_047724439.1|2791789_2792461_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.0	2.6e-79
WP_003859879.1|2792938_2793919_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
2792790:2792818	attR	ACAGGAATCGTATTCGGTCTCTTTTTATC	NA	NA	NA	NA
WP_003859884.1|2794086_2794731_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	3.3e-55
WP_003859885.1|2794765_2795005_-	YebV family protein	NA	NA	NA	NA	NA
WP_022651437.1|2795111_2796575_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003859888.1|2796631_2799265_-	PqiB family protein	NA	NA	NA	NA	NA
WP_003859890.1|2799233_2800517_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_006811006.1|2800649_2801147_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003859895.1|2801243_2801930_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_003859896.1|2801949_2803998_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
WP_003859899.1|2804191_2805073_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 6
NZ_CP024812	Enterobacter sp. CRENT-193 chromosome, complete genome	4852690	3055631	3151974	4852690	tRNA,plate,tail,terminase,integrase,holin	Enterobacteria_phage(26.42%)	88	3045744:3045760	3153208:3153224
3045744:3045760	attL	TGACGGTCGATCAGCAC	NA	NA	NA	NA
WP_022651334.1|3055631_3056975_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_022651333.1|3056971_3057646_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022651332.1|3057645_3059316_+	OmpA family protein	NA	NA	NA	NA	NA
WP_022651331.1|3059321_3059813_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022651330.1|3059986_3062635_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	1.2e-95
WP_022651329.1|3062631_3064989_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_022651327.1|3067342_3067924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651326.1|3068004_3068625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651325.1|3068821_3069085_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	48.0	1.5e-06
WP_022651324.1|3069087_3070296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268917.1|3070288_3073660_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_022651322.1|3073679_3075287_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_022651321.1|3075319_3077089_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022651318.1|3079543_3080035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651316.1|3080367_3081450_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022651315.1|3081485_3082010_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_039268915.1|3082014_3084477_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_022651313.1|3084466_3085474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647470.1|3088103_3088448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123839387.1|3088623_3088899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003856903.1|3089462_3089987_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022651308.1|3091132_3091588_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022651307.1|3091611_3092928_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_003856913.1|3092956_3093445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651306.1|3093761_3094892_+	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_003856916.1|3094982_3095966_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_003856922.1|3096450_3097824_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.1e-50
WP_003856923.1|3097867_3098803_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
WP_022651305.1|3098852_3100091_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	70.0	4.3e-168
WP_022651304.1|3100092_3100305_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	63.4	4.3e-20
WP_020882485.1|3100369_3100612_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_022651303.1|3100650_3101736_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.3	2.8e-123
WP_058647468.1|3101745_3104883_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.3	0.0e+00
WP_022651301.1|3105701_3106094_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	63.1	6.3e-41
WP_022651300.1|3106193_3106421_+	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	62.2	1.6e-20
WP_039268913.1|3106423_3106975_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	47.3	7.5e-32
WP_022651298.1|3107119_3107977_+	phage replication protein O domain	NA	K7PGZ0	Enterobacteria_phage	70.1	3.1e-101
WP_014884021.1|3107973_3108660_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	63.4	5.2e-83
WP_014832179.1|3108936_3109386_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014884019.1|3109687_3109906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268909.1|3110251_3111433_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_022651295.1|3111919_3112366_+	VOC family protein	NA	NA	NA	NA	NA
WP_022651294.1|3112736_3112961_+	DinI family protein	NA	H6WRY5	Salmonella_phage	62.3	1.8e-21
WP_022651293.1|3113349_3113952_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	82.5	6.8e-95
WP_032645711.1|3114159_3114522_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
WP_022651290.1|3114518_3115352_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.7	3.3e-124
WP_022651288.1|3115877_3116069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570936.1|3116854_3117241_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_022651286.1|3117227_3117509_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_022651285.1|3117508_3118138_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	2.3e-101
WP_032645710.1|3118145_3118421_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.4	3.7e-32
WP_032645635.1|3120141_3120591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651282.1|3120637_3121636_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
WP_022651281.1|3121613_3122921_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	57.3	1.3e-143
WP_022651280.1|3122922_3124311_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.2	2.1e-123
WP_022651279.1|3124312_3125410_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.9	1.8e-117
WP_022651278.1|3125490_3126261_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
WP_039268908.1|3126273_3127227_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	5.3e-134
WP_022651276.1|3127544_3128027_+	hypothetical protein	NA	A0A0E3GMJ4	Enterobacteria_phage	34.7	2.6e-12
WP_022651275.1|3128028_3128379_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	2.1e-32
WP_022651274.1|3128380_3128965_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	55.3	1.4e-49
WP_058647467.1|3128961_3129372_+	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	52.2	2.5e-32
WP_022651272.1|3129441_3130113_+	hypothetical protein	NA	I6PBN6	Cronobacter_phage	47.3	7.4e-50
WP_022651271.1|3130178_3130490_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
WP_032645632.1|3130486_3130801_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	1.1e-16
WP_022651270.1|3130797_3133710_+|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	34.7	1.6e-128
WP_020690998.1|3133784_3134138_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
WP_022651269.1|3134194_3134542_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	62.6	1.7e-37
WP_022651268.1|3134538_3135294_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	77.2	2.0e-115
WP_022651267.1|3135295_3136009_+|tail	phage tail protein	tail	K7PLS6	Enterobacteria_phage	97.4	1.0e-142
WP_157787723.1|3136059_3136653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651265.1|3136764_3137391_+|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	59.9	1.8e-53
WP_022651264.1|3137443_3140995_+|tail	phage tail protein	tail	K7P840	Enterobacteria_phage	84.6	0.0e+00
WP_022651263.1|3141035_3141350_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	6.6e-33
WP_022651262.1|3141350_3142061_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	3.6e-87
WP_022651261.1|3142129_3142363_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	76.3	9.5e-29
WP_022651260.1|3142421_3143684_+	hypothetical protein	NA	K7PM99	Enterobacterial_phage	65.9	3.2e-147
WP_104468396.1|3144543_3145374_-|tail	tail fiber domain-containing protein	tail	A0A192Y7T9	Enterobacteria_phage	30.6	8.4e-35
WP_022651255.1|3145456_3146023_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.0	6.0e-77
WP_022651254.1|3146437_3146776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032645629.1|3146980_3147208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651253.1|3147769_3147988_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	65.7	2.9e-19
WP_071787990.1|3148270_3148483_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_022651252.1|3148520_3149210_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.1e-77
WP_071785691.1|3149534_3149735_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_003856931.1|3150155_3150353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651250.1|3150356_3150779_+	GFA family protein	NA	NA	NA	NA	NA
WP_003856933.1|3150813_3151974_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.3	2.5e-117
3153208:3153224	attR	GTGCTGATCGACCGTCA	NA	NA	NA	NA
>prophage 7
NZ_CP024812	Enterobacter sp. CRENT-193 chromosome, complete genome	4852690	3767338	3811218	4852690	head,tRNA,portal,protease,tail,terminase,integrase,capsid,holin	Enterobacterial_phage(34.0%)	61	3768293:3768307	3813320:3813334
WP_022650866.1|3767338_3768622_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.4e-09
3768293:3768307	attL	AGCGCCCTGAAGCTG	NA	NA	NA	NA
WP_058647314.1|3768882_3769203_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.8e-25
WP_153213704.1|3769190_3769430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059468795.1|3769524_3770907_-	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	56.3	6.1e-123
WP_032665940.1|3770965_3771199_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	3.9e-30
WP_100185511.1|3771306_3771978_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.2	9.9e-87
WP_006809146.1|3771978_3772293_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	7.3e-32
WP_100185512.1|3772337_3776183_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	64.0	0.0e+00
WP_022650859.1|3776235_3776820_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.6	7.4e-54
WP_023296258.1|3776819_3777530_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
WP_016240208.1|3777532_3778291_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
WP_058647356.1|3778287_3778626_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	60.7	1.1e-38
WP_058663677.1|3778628_3782093_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	89.3	0.0e+00
WP_058647333.1|3782155_3782521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647334.1|3782567_3782846_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	2.8e-43
WP_040117541.1|3782854_3783238_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	7.4e-63
WP_040117540.1|3783246_3783690_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	1.5e-70
WP_058663681.1|3783749_3784097_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	97.4	5.0e-58
WP_058663680.1|3784093_3784543_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.0	3.8e-74
WP_016042205.1|3784539_3784878_-|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	100.0	2.9e-58
WP_080396119.1|3784877_3785204_-	hypothetical protein	NA	K7PGU9	Enterobacterial_phage	97.2	1.8e-54
WP_058647336.1|3785236_3786394_-|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	97.4	5.2e-208
WP_057992068.1|3786396_3787074_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	99.6	5.4e-125
WP_032624427.1|3787091_3788366_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.8	1.9e-248
WP_058647353.1|3788365_3789880_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	99.4	2.0e-292
WP_058663679.1|3789886_3790372_-	hypothetical protein	NA	Q77WA1	Escherichia_phage	99.4	3.5e-81
WP_059468687.1|3790525_3790762_-	hypothetical protein	NA	K7PHC8	Enterobacterial_phage	96.2	7.4e-37
WP_059468688.1|3790761_3791103_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	98.2	1.3e-63
WP_058663728.1|3791099_3791690_-	hypothetical protein	NA	K7P6K4	Enterobacteria_phage	95.2	2.1e-104
WP_058647381.1|3791671_3793129_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.3	2.1e-270
WP_058647382.1|3793144_3794083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127673971.1|3794454_3794658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647384.1|3794976_3795246_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	49.4	7.2e-12
WP_058647385.1|3795253_3795880_-	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	93.8	2.1e-110
WP_000220248.1|3795876_3796158_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_006809173.1|3796154_3796559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047746036.1|3796657_3796990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647386.1|3797144_3797723_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.8	3.6e-45
WP_058647387.1|3797735_3798725_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	91.2	2.1e-181
WP_080396120.1|3798721_3799447_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.7	9.8e-56
WP_023293909.1|3799462_3799852_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.0	1.1e-66
WP_058647388.1|3799848_3800169_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.4	1.1e-43
WP_058647389.1|3800165_3801119_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	93.0	1.7e-169
WP_032673528.1|3801102_3801288_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.4e-13
WP_072059691.1|3801451_3802012_-	hypothetical protein	NA	A5LH68	Enterobacteria_phage	52.2	2.4e-46
WP_045345728.1|3802034_3802286_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_058647390.1|3802320_3803073_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	55.8	2.6e-75
WP_006809187.1|3803233_3803482_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	61.9	2.4e-22
WP_006809188.1|3803474_3803933_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	50.7	4.8e-40
WP_006809189.1|3803932_3804346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647391.1|3804431_3804788_+	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	92.4	3.4e-54
WP_058647392.1|3804822_3805032_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	68.8	1.5e-17
WP_058647393.1|3805212_3805440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647394.1|3805429_3805666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648915.1|3806068_3806389_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	3.6e-26
WP_058647431.1|3806437_3806851_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.9	8.1e-55
WP_065187046.1|3806847_3807885_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	93.6	1.9e-177
WP_045895832.1|3807871_3808546_+	hypothetical protein	NA	K7P6H6	Enterobacteria_phage	97.4	4.4e-34
WP_072202861.1|3809117_3809381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647396.1|3809355_3810498_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.3	1.1e-93
WP_022650816.1|3810717_3811218_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
3813320:3813334	attR	AGCGCCCTGAAGCTG	NA	NA	NA	NA
>prophage 8
NZ_CP024812	Enterobacter sp. CRENT-193 chromosome, complete genome	4852690	4645826	4653421	4852690	integrase	Enterobacteria_phage(30.0%)	10	4635280:4635294	4660992:4661006
4635280:4635294	attL	ACAGGATTACGCCGT	NA	NA	NA	NA
WP_022650433.1|4645826_4646288_+	VUT family protein	NA	A0A2H4N7D9	Pectobacterium_phage	55.7	4.1e-39
WP_022650432.1|4646287_4647088_+	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	85.0	6.6e-138
WP_003863184.1|4647096_4647297_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	71.2	1.1e-20
WP_032628143.1|4647305_4647854_+	hypothetical protein	NA	E5AGD3	Erwinia_phage	35.0	2.3e-20
WP_003863189.1|4647890_4648100_+	hypothetical protein	NA	A0A220IH74	Escherichia_phage	59.3	2.1e-11
WP_003863191.1|4648102_4648453_+	helix-turn-helix domain-containing protein	NA	Q5G8V4	Enterobacteria_phage	95.7	1.5e-57
WP_058647473.1|4648329_4649493_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	95.3	7.7e-220
WP_003863195.1|4649694_4650948_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
WP_003863197.1|4650959_4652063_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.7e-59
WP_003863199.1|4652368_4653421_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
4660992:4661006	attR	ACAGGATTACGCCGT	NA	NA	NA	NA
>prophage 1
NZ_CP024813	Enterobacter sp. CRENT-193 plasmid pCRENT-193_1, complete sequence	298989	80731	120891	298989	protease,integrase,transposase	Acinetobacter_phage(22.22%)	47	106881:106940	121109:122397
WP_000795949.1|80731_81907_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|82076_82289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|82649_83732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|83897_85397_-	kinase	NA	NA	NA	NA	NA
WP_000081060.1|85422_87060_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|87059_88100_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|88184_88823_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|88822_89464_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|89486_90125_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|90587_91055_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|91072_92281_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_031942304.1|92291_93248_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|93247_94327_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|94328_95102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|95094_96237_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|96246_97305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|97625_98207_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|98206_99364_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|99386_99842_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|99864_100905_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|100953_101532_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|101600_102176_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|102604_103846_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|103936_104392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|104632_104824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|104915_105257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|106243_106498_+	hypothetical protein	NA	NA	NA	NA	NA
106881:106940	attL	GGGGTCGTCTCAGAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGAC	NA	NA	NA	NA
WP_000427623.1|107157_108162_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_010791757.1|108311_109994_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_000393453.1|109996_110905_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011405615.1|110901_112119_+	TniQ family protein	NA	NA	NA	NA	NA
WP_010981357.1|112179_112794_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
WP_010981356.1|112832_113153_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_005413392.1|113168_113405_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_031942307.1|113401_113767_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000761850.1|113878_114517_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_077269372.1|114531_114885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010981353.1|114814_115249_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427614.1|115327_116332_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001247892.1|116776_117067_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|117063_117465_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|117454_117811_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|118065_118392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|118388_118889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021243030.1|118885_119257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|119250_119808_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427623.1|119886_120891_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
121109:122397	attR	GTCAAAATCGGTGTTGCAAAAACGGGAGTGACCATAGATTCCGTTTTCTGAGACGACCCCGATCAGTATTACGTTATCCCACTCCAGCCCCTTGGAACCATGCAGTGTGGAAAGGATGAAGGGATCGCAGTCAGTAGCAGCCTCGCCTGGATTCAAGATAAGGTTTAAAAACGTGCGGGAATCGATCTTACTGGAGTCAAGTAGCTCCCCGATCCTCACGACCCCTCGTTGCTGGTCGTTCGATCCAGTGCGAGTTACACCCTCAGAGCCAACACTATCAATGAAACCCTCCATACTCAGGCGTCGTAACACATCGATAGCAGGCGTTTCCTCTCCGTCTTTCTGGCAGATAGTGGCGAGCCTGCCCAGCCGATCTTTTTGGTATTGTGCGCCCTCGAATAACTGACCTAGAGCAGACCATAGGTCGGCGTGCGGAGCCATCAATCCACTGAGCGCCGCTTTGAATTGCCCTTTCTGCCATCTAAAACCAGCCTCCTTCAGAAAGCCGTAAACAATCGCTTGTTTGTTGGGATGGTTTTCCAGTAGCCGCAGATCGCCGTACACAGACAGCAAGACGCCAACTACCAGTATCCCGATTTCGGTGCGGGTGTGTAATGCGCTTGAACCATTGAGGTAGCGATAAGGTAGCCCACACAGGCGTAAAGCAATTTCCGCCTCAGCAAGGTTCGCCTTAGTGCGGGACAATATGGCTTGTGTTCCACTGCTCACCGAGAGGTTTGATAGCACCTTGGATAGGCAGTTATCAAAGTGCAATCTGACCTCTGTTTTGGGGGTGCTAGGATGACTGACACAAAGCTTGGTCAGCTTTGTAGAGTTGCGCCGAATTACCGAGTTAGCCATCAAGGAAAGCTCATGGCCAAATCTGAACGTGCATGACAGTTGAAACACCTTCGTATTCGGGTAGTGCCTTTCAAACAGTCCGCCGATAAAGTCTGGTCGAGCACCACGCCACTCATAAATACACTGGTTAACATCACCAACAGCCATAACCGACGTATCCGACTTAGATAGCAAGCGGGTCATGTCATGCTGTATCAGGTTAACGTCCTGATATTCATCAACAATGATGTGCTTGAAGTGGGCACCAAGGCTGCTGTCATTACGCAACAGTGCGACAGCCTCAATCAAACAGTCATCAAAGGTTCGCAGACTGTTTTCCTCCAGCAGCTCACAATAGCGGCCATAGGCGTGAATAAACTCCCGTTTGATGTTGCTGAACGTTGGATCATTGGCAGCATCAACAGGAGTTACGGCCGCCGCCCGGCAGC	NA	NA	NA	NA
>prophage 2
NZ_CP024813	Enterobacter sp. CRENT-193 plasmid pCRENT-193_1, complete sequence	298989	125787	191195	298989	protease,integrase,transposase	Escherichia_phage(38.46%)	56	154286:154345	191276:191415
WP_000462754.1|125787_126444_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000083579.1|127149_128538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|128938_129232_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|129236_130562_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|130622_130829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|130929_131340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001641519.1|131352_132168_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
WP_000278471.1|132420_132846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|133394_133703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|133718_134576_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001287391.1|135182_135587_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|135764_136058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|136083_136320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|136360_136816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|137091_138072_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_000490639.1|138117_138741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|138798_139179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|143088_143793_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_078310596.1|144053_144251_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	57.4	1.2e-11
WP_031942322.1|144614_145283_-	tetracycline resistance transcriptional repressor TetR	NA	NA	NA	NA	NA
WP_031942321.1|145383_146583_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_013851371.1|147097_147601_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001067855.1|147637_148342_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071886840.1|148400_148868_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|148872_149079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|149460_150894_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|150927_152142_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|152402_153167_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|153309_153576_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|153796_154270_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
154286:154345	attL	TTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCTCCATAACATCA	NA	NA	NA	NA
WP_000845048.1|154425_155439_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|155984_156689_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386481.1|157561_158206_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_004199413.1|158778_161796_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_001067855.1|162674_163379_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|164006_166904_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|166998_167604_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001067855.1|168205_168910_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|169053_169608_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|169738_170569_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|171200_171905_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|172011_172872_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|172884_173427_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|174620_175325_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|177646_177979_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|178025_178901_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|179156_180419_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|180982_181540_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|181722_182583_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|182792_183332_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|183303_184140_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|184139_184943_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|185003_185819_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000427619.1|186505_187510_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|189406_190111_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|190181_191195_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
191276:191415	attR	TGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGATGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAA	NA	NA	NA	NA
>prophage 3
NZ_CP024813	Enterobacter sp. CRENT-193 plasmid pCRENT-193_1, complete sequence	298989	208483	213752	298989		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
WP_000927306.1|208483_209962_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|209980_210808_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|210867_211293_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|211305_212595_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|212640_212961_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|213047_213752_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
>prophage 1
NZ_CP024814	Enterobacter sp. CRENT-193 plasmid pCRENT-193_2, complete sequence	44962	0	3036	44962		Streptococcus_phage(100.0%)	1	NA	NA
WP_004199098.1|708_3036_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
>prophage 2
NZ_CP024814	Enterobacter sp. CRENT-193 plasmid pCRENT-193_2, complete sequence	44962	8200	12463	44962	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_004199413.1|8200_11218_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_004683689.1|11452_12463_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	4.1e-52
>prophage 3
NZ_CP024814	Enterobacter sp. CRENT-193 plasmid pCRENT-193_2, complete sequence	44962	15627	20080	44962	transposase	Escherichia_phage(25.0%)	5	NA	NA
WP_001067834.1|15627_16332_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001549892.1|16724_16964_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|17065_18286_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|18374_19037_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|19417_20080_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 4
NZ_CP024814	Enterobacter sp. CRENT-193 plasmid pCRENT-193_2, complete sequence	44962	24680	25196	44962		Tupanvirus(100.0%)	1	NA	NA
WP_001025390.1|24680_25196_+	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 5
NZ_CP024814	Enterobacter sp. CRENT-193 plasmid pCRENT-193_2, complete sequence	44962	43827	44322	44962		Moraxella_phage(100.0%)	1	NA	NA
WP_001215543.1|43827_44322_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
