The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024819	Citrobacter freundii strain CRCB-101 chromosome, complete genome	5311319	3093271	3161620	5311319	integrase,portal,tail,holin,protease,capsid,head,terminase	Klebsiella_phage(27.45%)	81	3092995:3093011	3131594:3131610
3092995:3093011	attL	CGATAACGGCAAACAGA	NA	NA	NA	NA
WP_100194296.1|3093271_3094399_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	49.9	2.2e-102
WP_044691230.1|3094391_3094625_-	excisionase	NA	NA	NA	NA	NA
WP_100194297.1|3094676_3097148_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	39.2	2.4e-114
WP_032944383.1|3097289_3097616_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003832307.1|3098107_3098488_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
WP_003832309.1|3098593_3098806_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
WP_100194299.1|3098809_3099364_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.0	1.4e-14
WP_157787657.1|3099412_3100528_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	54.3	8.9e-48
WP_157787670.1|3100439_3100985_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.8	4.9e-68
WP_100194301.1|3101000_3101417_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_100194936.1|3101422_3101761_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	46.7	1.8e-15
WP_100194303.1|3102067_3102541_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	3.1e-66
WP_100194304.1|3102544_3102784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194937.1|3103094_3104174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194305.1|3104188_3104536_-	colicin transporter	NA	NA	NA	NA	NA
WP_080625281.1|3104830_3105064_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	62.3	1.8e-19
WP_080625280.1|3105109_3105355_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.5	3.4e-21
WP_048235144.1|3105483_3105684_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	63.1	1.9e-17
WP_100194306.1|3105686_3106046_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	62.7	4.7e-43
WP_100194307.1|3106042_3106642_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	73.4	3.0e-82
WP_100194308.1|3106997_3108380_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100194309.1|3108716_3108947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194310.1|3108937_3109453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100194311.1|3109836_3110646_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048233519.1|3111000_3111294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003832349.1|3111550_3111829_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
WP_071684701.1|3111800_3112340_+	lysozyme	NA	K7PM52	Enterobacteria_phage	91.8	1.8e-94
WP_100194938.1|3112369_3112852_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000990801.1|3112848_3113079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194312.1|3113705_3113861_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_100194313.1|3114240_3114453_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
WP_057069020.1|3114463_3114652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000756041.1|3114725_3114956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100119.1|3115160_3115334_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_100194314.1|3115706_3116246_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	77.1	2.1e-42
WP_100194315.1|3116521_3116884_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	3.7e-56
WP_080625271.1|3117134_3117569_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.1	1.2e-29
WP_100194316.1|3117568_3119290_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.9	1.9e-190
WP_080625269.1|3119283_3119463_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	64.9	1.2e-12
WP_100194317.1|3119462_3120722_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.5e-221
WP_100194318.1|3120758_3121679_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	79.7	4.6e-135
WP_100194319.1|3121751_3123038_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	1.0e-212
WP_100194320.1|3123134_3123512_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	58.2	5.5e-18
WP_032950890.1|3123492_3123810_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.1e-39
WP_100194321.1|3123806_3124157_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	75.7	1.9e-44
WP_100194322.1|3124125_3124515_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	65.3	3.9e-43
WP_100194323.1|3124511_3124913_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	85.7	2.9e-57
WP_003832379.1|3124946_3125429_+	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	80.6	6.1e-62
WP_032949492.1|3125491_3125854_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	4.8e-27
WP_100194324.1|3126104_3129407_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	63.4	0.0e+00
WP_100194325.1|3129407_3129740_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.0	2.0e-40
WP_080625260.1|3129748_3130444_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.0	1.0e-94
WP_100194326.1|3130455_3131190_+|tail	phage tail protein	tail	A5LH41	Enterobacteria_phage	77.4	9.4e-115
WP_100194327.1|3131835_3135216_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	70.4	0.0e+00
3131594:3131610	attR	CGATAACGGCAAACAGA	NA	NA	NA	NA
WP_080625256.1|3137977_3138559_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.5	1.1e-54
WP_075146261.1|3138845_3139292_+	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
WP_080625255.1|3139301_3139937_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_075146259.1|3140123_3140549_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_100194328.1|3140561_3141851_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	3.5e-165
WP_047052019.1|3141895_3142216_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.8	7.7e-21
WP_075146256.1|3142301_3143000_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	3.8e-89
WP_100194329.1|3143146_3143431_-	DinI family protein	NA	S4TND2	Salmonella_phage	80.3	1.5e-23
WP_100194330.1|3143444_3144575_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	34.8	5.5e-37
WP_075146253.1|3144816_3145059_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	7.6e-29
WP_080625253.1|3145378_3145756_+	DNA polymerase V	NA	Q71TH8	Escherichia_phage	69.0	1.3e-46
WP_075146250.1|3145886_3146348_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_100194331.1|3146570_3147239_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	6.9e-80
WP_047410825.1|3147681_3147957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043016138.1|3148142_3149615_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.8	1.1e-16
WP_043016139.1|3149647_3150454_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_043016140.1|3150453_3151647_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_100194939.1|3151657_3153016_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	6.6e-37
WP_043016141.1|3153019_3154615_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	2.5e-51
WP_047410834.1|3154614_3156177_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_071524452.1|3156271_3156334_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_047410842.1|3156451_3157330_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_003020628.1|3157326_3157947_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_003020625.1|3158047_3158923_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_075146244.1|3159004_3159595_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_043016145.1|3159591_3160353_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	5.7e-06
WP_043016146.1|3160573_3161620_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 2
NZ_CP024819	Citrobacter freundii strain CRCB-101 chromosome, complete genome	5311319	3232011	3237451	5311319	integrase,tRNA	Escherichia_phage(33.33%)	7	3230384:3230396	3235107:3235119
3230384:3230396	attL	GACGCCAGCAAGC	NA	NA	NA	NA
WP_043016204.1|3232011_3233385_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	3.9e-53
WP_043016205.1|3233463_3234399_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	1.3e-140
WP_043016206.1|3234448_3234691_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	76.0	2.2e-28
WP_003840850.1|3235032_3235275_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
3235107:3235119	attR	GCTTGCTGGCGTC	NA	NA	NA	NA
WP_043016207.1|3235461_3235896_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
WP_043016208.1|3235977_3236190_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_043016209.1|3236335_3237451_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.9	1.1e-122
>prophage 3
NZ_CP024819	Citrobacter freundii strain CRCB-101 chromosome, complete genome	5311319	3664307	3674315	5311319	tRNA	Tupanvirus(28.57%)	10	NA	NA
WP_100194460.1|3664307_3665087_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	6.7e-10
WP_100194461.1|3665083_3666526_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.5	4.5e-52
WP_100194462.1|3666587_3667301_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003832591.1|3667619_3668084_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_080625088.1|3668161_3668911_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	24.5	1.8e-07
WP_047411703.1|3668910_3669462_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_043016594.1|3669522_3670503_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	5.1e-15
WP_003030571.1|3670624_3670924_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_043016595.1|3670928_3673316_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_043016596.1|3673331_3674315_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 4
NZ_CP024819	Citrobacter freundii strain CRCB-101 chromosome, complete genome	5311319	4022552	4063630	5311319	integrase,portal,lysis,tail,tRNA,plate,protease,capsid,head,terminase	Escherichia_phage(27.5%)	43	4027044:4027070	4058315:4058341
WP_100194547.1|4022552_4023956_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.9	3.9e-32
WP_100194548.1|4023952_4024675_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	9.2e-30
WP_043017945.1|4024701_4025412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194549.1|4025532_4026894_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	3.1e-204
4027044:4027070	attL	CCCTTACGCAGGCTTATTTTTTGCCTG	NA	NA	NA	NA
WP_047090157.1|4027556_4027778_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	74.0	2.9e-27
WP_100194550.1|4027853_4029023_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.8	6.6e-171
WP_019077153.1|4029019_4029484_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	1.8e-58
WP_100194551.1|4029497_4031939_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	74.7	7.1e-308
WP_019077155.1|4031928_4032051_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	1.3e-13
WP_032942881.1|4032083_4032398_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	66.0	2.2e-28
WP_100194552.1|4032451_4032970_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	1.7e-78
WP_100194553.1|4032982_4034176_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.4	8.0e-188
WP_099530299.1|4034312_4034891_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.0	4.9e-58
WP_100194554.1|4034890_4036573_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	59.4	1.4e-121
WP_100194555.1|4036583_4037114_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	90.3	1.5e-93
WP_100194556.1|4037106_4038015_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	84.8	8.9e-139
WP_100194557.1|4038020_4038371_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	72.4	6.2e-40
WP_100194558.1|4038367_4039009_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	80.8	6.8e-93
WP_100194559.1|4039339_4040812_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100194560.1|4040998_4041454_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.7	2.8e-48
WP_100194561.1|4041446_4041914_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	3.6e-59
WP_100194562.1|4042009_4042438_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	74.0	6.4e-47
WP_100194563.1|4042419_4042851_-	lysA protein	NA	A0A218M4L6	Erwinia_phage	62.9	1.1e-46
WP_100194564.1|4042847_4043360_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	3.0e-83
WP_100194565.1|4043343_4043565_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	77.8	8.4e-27
WP_100194566.1|4043555_4043759_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	85.1	1.2e-27
WP_100194567.1|4043758_4044265_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	4.0e-64
WP_100194568.1|4044364_4045120_-|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	72.2	7.8e-80
WP_100194569.1|4045123_4046191_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.3	3.3e-169
WP_100194570.1|4046252_4047107_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	72.5	2.9e-115
WP_100194571.1|4047273_4049043_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	84.9	2.1e-301
WP_100194572.1|4049044_4050061_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.3	9.2e-169
WP_100194573.1|4050560_4052789_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099530336.1|4055168_4055444_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	60.0	5.8e-25
WP_100194574.1|4055474_4055684_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	62.1	2.8e-11
WP_029139596.1|4055750_4056251_-	hypothetical protein	NA	M1SV55	Escherichia_phage	74.7	2.8e-70
WP_049002087.1|4056431_4056707_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	80.2	2.8e-40
WP_016153649.1|4056826_4057126_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	88.9	3.9e-43
WP_100194576.1|4057222_4058230_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	85.4	1.8e-169
WP_003036804.1|4058433_4060710_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
4058315:4058341	attR	CCCTTACGCAGGCTTATTTTTTGCCTG	NA	NA	NA	NA
WP_003036810.1|4060740_4061061_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|4061384_4061609_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_043016897.1|4061683_4063630_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	3.7e-41
>prophage 5
NZ_CP024819	Citrobacter freundii strain CRCB-101 chromosome, complete genome	5311319	4106326	4114751	5311319	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_080624930.1|4106326_4108360_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	5.2e-54
WP_100194586.1|4108570_4109029_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_043017948.1|4109073_4109544_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.3	1.2e-62
WP_100194587.1|4109590_4110310_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_043016932.1|4110306_4111992_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	4.8e-279
WP_043016933.1|4112217_4112949_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.0	1.0e-105
WP_003027354.1|4113000_4113108_+	protein YohO	NA	NA	NA	NA	NA
WP_043016934.1|4113088_4113820_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_043016935.1|4113803_4114751_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.6	1.4e-06
>prophage 6
NZ_CP024819	Citrobacter freundii strain CRCB-101 chromosome, complete genome	5311319	4578010	4722686	5311319	protease,integrase,portal,lysis,tail,tRNA,holin,plate,transposase,capsid,head,terminase	Salmonella_phage(53.85%)	145	4615217:4615276	4721407:4722721
WP_043017227.1|4578010_4579090_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003037559.1|4579297_4579717_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
WP_043017228.1|4579786_4580485_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_100194672.1|4580521_4583182_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_003835350.1|4583296_4584652_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_043017970.1|4584696_4585020_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_043017230.1|4585016_4586315_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	1.1e-44
WP_043017231.1|4592329_4594903_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	9.0e-128
WP_100194673.1|4595032_4595764_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_043017233.1|4595760_4596741_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_043017234.1|4596872_4597610_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003031244.1|4597879_4598218_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_101706155.1|4598321_4598369_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_047409410.1|4598468_4599629_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_003826456.1|4599726_4600848_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_016154067.1|4600858_4601929_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	2.0e-89
WP_043017971.1|4602144_4602519_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_047409405.1|4602677_4603196_+	YfiR family protein	NA	NA	NA	NA	NA
WP_043017237.1|4603188_4604415_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.1e-06
WP_043017238.1|4604427_4604910_+	OmpA family protein	NA	NA	NA	NA	NA
WP_100194674.1|4605163_4606180_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
WP_100194675.1|4607231_4608092_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	51.5	2.0e-79
WP_100194676.1|4608210_4608435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194677.1|4608470_4608980_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	92.9	3.3e-82
WP_100194678.1|4608987_4609188_+	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	82.3	1.3e-23
WP_100194679.1|4609933_4610116_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	88.3	2.7e-23
WP_100194680.1|4610374_4612093_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_157787660.1|4612454_4612592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194681.1|4612637_4613654_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.7	3.0e-167
4615217:4615276	attL	GAGACTGTAATTAAAATTGTGTAATTGCCTGTTTTTGATATGTTCACTCCAACAACGGAG	NA	NA	NA	NA
WP_100193912.1|4615287_4616496_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	9.3e-51
WP_100194955.1|4616516_4616735_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	82.1	2.6e-28
WP_100194682.1|4616784_4617630_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_002914145.1|4617818_4618166_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003031232.1|4618205_4618973_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003031230.1|4619017_4619566_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003031228.1|4619584_4619833_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003031226.1|4620086_4621448_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_100194683.1|4621613_4622405_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_008324538.1|4622423_4623713_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_043017972.1|4623763_4624357_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_032944608.1|4624480_4625359_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_043017240.1|4625444_4627106_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003826401.1|4627255_4627600_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003839823.1|4627649_4627946_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071600335.1|4627929_4628385_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_043017973.1|4628527_4629010_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	2.0e-28
WP_100194684.1|4629591_4640862_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_100194685.1|4640962_4642372_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_100194686.1|4642368_4644555_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	5.5e-17
WP_087050841.1|4644562_4645726_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_100194687.1|4646451_4647657_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_100194688.1|4648201_4649761_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_100194689.1|4650296_4650464_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	73.3	1.7e-11
WP_100194690.1|4650453_4650570_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_100194691.1|4650541_4651123_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	56.4	7.4e-54
WP_100194692.1|4651122_4652799_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.3	3.9e-71
WP_016150406.1|4652791_4653355_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	40.9	8.2e-26
WP_033816599.1|4653344_4654265_-|plate	baseplate J/gp47 family protein	plate	A0A193GYM8	Enterobacter_phage	48.5	1.4e-62
WP_033816600.1|4654248_4654602_-	GPW/gp25 family protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	52.0	1.4e-20
WP_100194693.1|4654641_4655760_-	late control protein D	NA	R9TNM7	Vibrio_phage	33.1	9.6e-34
WP_100194694.1|4655761_4655977_-|tail	tail protein X	tail	R9TR63	Vibrio_phage	51.4	7.5e-12
WP_099531048.1|4655951_4656425_-|tail	phage tail protein	tail	R9TMP6	Vibrio_phage	45.0	3.8e-24
WP_100194695.1|4656418_4658344_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	35.4	2.1e-28
WP_032943852.1|4658446_4658746_-|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	7.2e-05
WP_016150414.1|4658804_4659311_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_100194696.1|4659307_4660777_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	37.1	3.9e-75
WP_100194697.1|4660815_4661433_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	36.2	3.0e-13
WP_100194698.1|4661425_4661980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100194699.1|4661991_4662648_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	35.3	6.9e-16
WP_040230736.1|4662649_4663006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033816609.1|4663005_4663341_-	DUF2190 family protein	NA	A0A2K9V343	Faecalibacterium_phage	31.1	6.2e-05
WP_100194700.1|4663413_4665516_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	52.4	3.0e-198
WP_033816611.1|4665472_4666984_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	54.2	2.4e-149
WP_016150423.1|4666992_4667208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100194701.1|4667204_4669322_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	70.4	4.4e-306
WP_047358011.1|4669325_4669832_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	63.7	3.1e-48
WP_033816613.1|4670053_4670398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100194702.1|4670481_4671009_-	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	34.3	6.8e-06
WP_100194703.1|4671005_4671623_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	79.9	5.0e-93
WP_000250463.1|4671622_4671904_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	3.1e-18
WP_008784467.1|4671890_4672277_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_100194704.1|4672423_4673476_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	80.0	1.1e-169
WP_157787661.1|4674140_4674686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023196866.1|4674901_4675591_-	phage antiterminator protein	NA	NA	NA	NA	NA
WP_100194706.1|4675612_4676608_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	70.8	5.9e-144
WP_100194707.1|4676604_4677291_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	53.8	1.3e-57
WP_003034741.1|4677304_4677691_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
WP_100194708.1|4677687_4679622_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.8	3.0e-200
WP_033816620.1|4679614_4680496_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	84.5	4.4e-143
WP_100194709.1|4680492_4681350_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	96.6	5.9e-60
WP_024135506.1|4681339_4681519_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	2.3e-14
WP_000526197.1|4681691_4682243_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.2	6.7e-65
WP_000278289.1|4682265_4682469_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	67.8	2.1e-16
WP_044691226.1|4683602_4683974_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	5.9e-57
WP_100194710.1|4684031_4684850_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	89.8	2.0e-137
WP_079958256.1|4684978_4685518_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	79.9	1.2e-79
WP_100194711.1|4685678_4685933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194712.1|4686042_4686294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194956.1|4686301_4686739_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	42.0	1.4e-12
WP_100194713.1|4686740_4687310_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	82.4	5.1e-92
WP_100194714.1|4687515_4688691_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	65.7	4.1e-144
WP_100194715.1|4688730_4689543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032281459.1|4689697_4689913_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	2.7e-22
WP_100194716.1|4691078_4691564_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	78.1	2.9e-64
WP_100194717.1|4691560_4694356_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	86.8	0.0e+00
WP_032300013.1|4694345_4694468_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	89.7	1.7e-13
WP_100194718.1|4694482_4694785_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	93.0	1.3e-41
WP_065358034.1|4694834_4695350_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	92.4	5.8e-87
WP_100194719.1|4695359_4696532_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	1.2e-209
WP_100194720.1|4696838_4697858_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	32.7	2.1e-32
WP_100194721.1|4697923_4698319_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_100194722.1|4699275_4699887_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	88.5	1.3e-104
WP_100194723.1|4699879_4700797_-|plate	baseplate J/gp47 family protein	plate	E5G6N8	Salmonella_phage	67.9	8.8e-102
WP_100194724.1|4700783_4701143_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.2	5.2e-50
WP_100194725.1|4701139_4701718_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	81.8	1.2e-88
WP_100194726.1|4701795_4702356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194727.1|4702375_4702822_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	74.0	5.6e-54
WP_100194728.1|4702814_4703249_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.6	1.3e-63
WP_100194729.1|4703344_4703770_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	70.1	1.9e-46
WP_100194730.1|4703792_4704308_-	lysozyme	NA	E5G6N1	Salmonella_phage	78.7	3.9e-75
WP_032299972.1|4704288_4704504_-	membrane protein	NA	E5G6N0	Salmonella_phage	56.3	4.5e-17
WP_032280591.1|4704507_4704711_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	2.0e-30
WP_100194731.1|4704710_4705175_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.6e-75
WP_100194732.1|4705268_4705919_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	89.2	4.8e-102
WP_100194733.1|4705922_4706999_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	86.9	1.2e-174
WP_100194734.1|4707015_4707849_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	74.0	3.7e-107
WP_032299980.1|4707990_4709754_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.2	0.0e+00
WP_100194735.1|4709753_4710788_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.2	3.7e-173
WP_100194957.1|4710827_4711373_-	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_100194737.1|4711618_4711876_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	48.9	4.1e-17
WP_100194738.1|4711954_4712188_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	80.5	1.9e-29
WP_100194739.1|4712200_4712389_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	4.6e-26
WP_100194740.1|4712532_4714953_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	92.1	0.0e+00
WP_100194741.1|4714943_4715801_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	81.1	1.2e-129
WP_016150819.1|4715797_4716025_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	3.3e-34
WP_001244238.1|4716024_4716258_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	98.7	2.9e-33
WP_000963480.1|4716325_4716667_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_000956166.1|4716630_4716831_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	98.5	1.2e-32
WP_000460858.1|4716838_4717348_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
WP_100194742.1|4717380_4717623_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	2.0e-37
WP_042999662.1|4717739_4718372_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	70.0	3.1e-82
WP_100194743.1|4718373_4719390_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	3.8e-191
WP_100194744.1|4719386_4720460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003826111.1|4721014_4721371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100193912.1|4721477_4722686_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	9.3e-51
4721407:4722721	attR	GAGACTGTAATTAAAATTGTGTAATTGCCTGTTTTTGATATGTTCACTCCAACAACGGAGACAGGCAAATTATGGACGAAAAGAAACTCAAAGCACTGGCGGCTGAACTGGCTAAGGGCCTTAAAACCGAAGCCGACCTCAATCAGTTTTCCCGTATGCTGACGAAGCTAACCGTCGAAACGGCGCTCAATGCGGAGCTGACTGACCATCTCGGGCATGAGAAAAACGCCCCCAAAACAGGTTCAAACACCCGTAATGGCTACTCGTCAAAAACGGTGTTGTGCGATGACGGCGAGATAGAACTCAACACGCCGCGTGACCGTGAAAATACCTTCGAACCGCAGCTGATTAAGAAGCACCAGACGCGTATTACGCAGATGGACAGCCAGATTTTATCCCTTTATGCCAAAGGCATGACTACTCGTGAAATCGTCGCCACCTTCAAGGAGATGTACGATGCCGATGTGTCACCCACGCTGATCTCTAAAGTCACCGATGCCGTCAAAGAGCAGGTTACTGAGTGGCAAAACCGACAGCTGGATGCGCTGTATCCCATTGTTTACATGGACTGTATCGTCGTAAAAGTTCGTCAGAATGGTAGCGTAATCAACAAAGCTGTTTTCCTGGCGCTGGGGATCAACACCGAAGGCCGGAAAGAGTTGCTGGGCATGTGGCTGGCCGAAAATGAAGGCGCAAAGTTCTGGCTGAGCGTGCTTACAGAGATGAAAAACCGTGGCCTTCAGGACATCCTGATTGCCTGTGTGGACGGTCTGAAGGGCTTCCCGGATGCGATAAATAGCGTCTTCCCGCAGACCCATATCCAGCTGTGCATCATCCATATGGTGCGTAACAGCCTGAAATACGTGTCCTGGAAGGACTACAAAGCCGTTACCAGCGGTCTGAAGACGGTCTATCAGGCCCCGACCGAAGAGGCGGCACTGATGGCGCTGGATACGTTCGCAACAGTCTGGAACGATAAATATCCGCAAATCAGCAAAAGCTGGCGTGCGCACTGGGAAAACCTCAATACGCTCTTCAGTTATCCGCCGGATATCCGCAAGGCCATCTACACCACAAACGCAATAGAATCACTGAACAGCGTGATCCGTGCTGCGATTAAAAAACGCAAAGTGTTCCCGACAGATGACTCGGTACGGAAAGTTATTTATCTGGCGATCAAGGATGCGTCAAAAAAATGGAGTATGCCGATCCAGAACTGGCGGTTAGCAATGAGCCGTTTTATTATCGAGTTCGGTGACCGCCTGAGCGATCACCTTTAATACGTTGGCAGTTACACAGAATTACTGACAGGCTC	NA	NA	NA	NA
>prophage 7
NZ_CP024819	Citrobacter freundii strain CRCB-101 chromosome, complete genome	5311319	5272135	5309799	5311319	integrase,portal,lysis,tail,tRNA,plate,capsid,head,terminase	Erwinia_phage(34.21%)	45	5278494:5278541	5309871:5309918
WP_003024694.1|5272135_5273149_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
WP_001144069.1|5273385_5273601_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_043017666.1|5275942_5277787_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_100194860.1|5277831_5278338_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
5278494:5278541	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
WP_023223216.1|5278696_5278915_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
WP_100194861.1|5278955_5280146_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.6	1.7e-166
WP_100194862.1|5280148_5280613_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.2	2.2e-61
WP_100194863.1|5280624_5283054_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	71.0	2.4e-287
WP_000763326.1|5283046_5283166_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_100194864.1|5283198_5283480_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	7.9e-30
WP_100194865.1|5283542_5284061_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	4.5e-71
WP_100194866.1|5284073_5285261_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.5	3.2e-189
WP_100194867.1|5285325_5285904_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	81.8	2.4e-81
WP_157787663.1|5285930_5286356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194967.1|5286705_5286777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157787664.1|5286748_5286871_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_100194868.1|5288125_5288737_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	2.6e-94
WP_100194869.1|5288729_5289638_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.5	3.9e-134
WP_000213440.1|5289642_5289990_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	70.4	2.8e-40
WP_100194870.1|5289986_5290628_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	82.2	8.0e-94
WP_100194871.1|5290696_5291146_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	70.7	7.7e-51
WP_100194872.1|5291138_5291606_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	3.7e-56
WP_100194874.1|5291713_5292127_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	1.3e-36
WP_100194875.1|5292123_5292633_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.7	9.2e-77
WP_000524754.1|5292616_5292838_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|5292828_5293032_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177981.1|5293031_5293532_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	2.9e-59
WP_100194876.1|5293629_5294388_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	66.4	6.6e-79
WP_100194877.1|5294391_5295552_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.4	1.5e-130
WP_052935788.1|5295582_5296446_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.2	3.4e-103
WP_100194878.1|5296610_5298380_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.2	6.5e-287
WP_100194879.1|5298379_5299414_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.9	1.6e-163
WP_100194880.1|5299865_5301281_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100194881.1|5301277_5302270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100194968.1|5302220_5303372_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	30.1	8.6e-30
WP_100194882.1|5303527_5303968_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	1.7e-66
WP_100194883.1|5304085_5306308_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.2	0.0e+00
WP_100194884.1|5306309_5306531_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	82.2	3.8e-27
WP_100194885.1|5306530_5306758_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	77.3	1.7e-22
WP_100194886.1|5306827_5307028_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	90.9	1.4e-28
WP_100194887.1|5307014_5307242_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	93.3	1.7e-35
WP_096185558.1|5307249_5307759_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	86.4	9.9e-79
WP_100194888.1|5307789_5308053_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.5	9.7e-38
WP_064343243.1|5308183_5308762_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	64.1	7.1e-65
WP_100194889.1|5308761_5309799_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.9e-198
5309871:5309918	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
