The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	78985	226099	2868496	holin,tRNA,transposase	Streptococcus_phage(13.51%)	124	NA	NA
WP_002298563.1|78985_79732_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002301399.1|80404_81364_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326711.1|81738_82917_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002317041.1|83261_83600_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002348801.1|83734_84136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317547.1|84247_84868_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002294300.1|84958_87628_-	YfhO family protein	NA	NA	NA	NA	NA
WP_002290463.1|87865_88054_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002294298.1|88323_88686_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002301169.1|88737_90420_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002301167.1|90536_92573_+	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	22.9	5.3e-06
WP_002289721.1|92621_93623_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002294295.1|93744_93987_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002287889.1|94254_95259_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002287891.1|95259_96204_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287892.1|96203_97166_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287893.1|97192_98107_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287894.1|98132_99914_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287896.1|100261_100948_+	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002301166.1|100967_104549_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002348798.1|104557_105367_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002301165.1|105378_106377_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_002294288.1|106563_108831_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002326066.1|109014_109968_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294287.1|109985_110438_-	YueI family protein	NA	NA	NA	NA	NA
WP_002294286.1|110587_111538_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	1.6e-66
WP_002301163.1|111530_112490_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002301162.1|112486_113242_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.2e-13
WP_002301160.1|113264_114218_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287909.1|114861_115158_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|115513_115870_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002348747.1|115879_116779_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010782507.1|117011_117971_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_010782508.1|118228_119674_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
WP_002348590.1|119719_120454_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_002301190.1|120779_121190_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|121182_121884_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002348592.1|121883_123497_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002290506.1|123486_123708_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297929.1|123704_124466_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	1.2e-16
WP_002294268.1|124846_125356_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	7.5e-10
WP_002294267.1|125425_125965_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|126104_126716_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002324284.1|127031_127829_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002294262.1|127856_128492_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|128511_129285_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002348595.1|129692_130490_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297923.1|130467_130881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294258.1|130864_133510_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002301736.1|133527_135636_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002348596.1|135657_136218_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297218.1|136356_137652_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002285758.1|137911_138106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|138095_138449_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|138550_140098_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002348864.1|140177_142166_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|142388_143102_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|143178_143625_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002290528.1|143794_144397_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|144409_145411_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002341570.1|145439_146018_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294249.1|146069_146552_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|146668_147043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294246.1|147842_149195_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002297079.1|149341_149932_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002294242.1|150059_151409_-	amino acid permease	NA	NA	NA	NA	NA
WP_002294240.1|151576_152317_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002297081.1|152329_153922_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002293448.1|154489_154786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294236.1|154961_155687_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002301156.1|155679_156522_+	chorismate mutase	NA	NA	NA	NA	NA
WP_002294232.1|156524_157046_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002289284.1|157298_157862_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002289282.1|158112_158382_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002297086.1|158569_160696_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289280.1|161205_161472_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002289279.1|161615_163607_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.9	8.4e-65
WP_002294228.1|163960_165262_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002326809.1|165637_166933_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_010782510.1|167000_168179_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	39.9	3.8e-65
WP_002289277.1|168525_169896_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002289744.1|170077_170401_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002299254.1|170725_171334_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002348768.1|171663_172380_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002289749.1|172392_173088_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002289751.1|173171_173801_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_086953915.1|174315_175654_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002294220.1|175723_176326_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	30.6	3.6e-19
WP_002296548.1|176347_176836_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002294217.1|177156_178530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294214.1|178513_178981_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_002329999.1|179229_180975_-	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.1	1.3e-40
WP_002293424.1|181170_182247_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002317074.1|182399_183752_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_086272912.1|184067_185585_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	1.3e-62
WP_002294209.1|185714_186065_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002294207.1|186080_187202_+	alanine racemase	NA	NA	NA	NA	NA
WP_002289874.1|187212_187575_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.8	7.6e-09
WP_002293413.1|187750_188020_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002294206.1|188209_189157_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016171130.1|189302_190598_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	1.1e-09
WP_002301399.1|190864_191824_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002294203.1|192049_194755_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002294202.1|195351_197175_+	APC family permease	NA	NA	NA	NA	NA
WP_002348885.1|197316_197502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294199.1|197976_198240_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002301121.1|198239_198506_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002301116.1|199736_200408_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301114.1|200404_201322_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293405.1|201318_201960_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002348889.1|201963_203139_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
WP_002350806.1|203331_204363_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002341590.1|206039_206993_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002319878.1|207083_208379_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002326809.1|208540_209836_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289743.1|210545_213185_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002294185.1|213352_214051_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002341590.1|214153_215107_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294183.1|215335_216481_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|216577_216958_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_010782512.1|217262_219860_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010782513.1|219767_221378_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	8.4e-124
WP_002300788.1|223655_224135_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|224760_226099_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 2
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	257444	265181	2868496		Streptococcus_phage(66.67%)	6	NA	NA
WP_002297361.1|257444_259304_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_000398284.1|259860_261066_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002286940.1|261849_263760_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_032509114.1|263863_264088_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002345010.1|264204_264702_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_002345009.1|264788_265181_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
>prophage 3
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	280758	327590	2868496	tRNA,transposase	Streptococcus_phage(40.0%)	44	NA	NA
WP_002354485.1|280758_281445_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002348732.1|281596_284638_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	4.0e-18
WP_002348733.1|284827_285412_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_010782519.1|285408_286548_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002336644.1|286925_288968_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336645.1|288978_289599_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002336646.1|289610_290069_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002331203.1|290087_290366_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002336647.1|290390_291758_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002331205.1|291772_292918_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
WP_002331206.1|292944_293436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002345001.1|293878_295078_+	MFS transporter	NA	NA	NA	NA	NA
WP_002331208.1|295572_296331_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002331209.1|296498_297434_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002336649.1|297430_298876_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002336650.1|298903_299359_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336651.1|299377_300352_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002336652.1|301167_301782_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002331215.1|302022_302406_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301781.1|302768_303278_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002296570.1|303377_304028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291914.1|304478_305417_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002291912.1|305429_306482_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296392.1|306747_307383_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002296391.1|307573_308365_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002326839.1|308844_309753_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002295755.1|309808_310306_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002340421.1|310342_311026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|311372_311639_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|311665_311965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|312138_312690_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|312835_313129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304106.1|313121_313418_+	peptidase	NA	NA	NA	NA	NA
WP_002296256.1|313492_314491_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|314582_315536_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294735.1|315634_316351_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002296623.1|316549_317845_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_025478783.1|317891_319940_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002294732.1|321149_322391_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002294730.1|322537_323173_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294728.1|323363_324104_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002296909.1|324248_325886_-	membrane protein	NA	NA	NA	NA	NA
WP_002321965.1|325851_326373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|326411_327590_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	763594	772066	2868496		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|763594_764239_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|764253_764583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|764596_765535_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|765570_766395_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|766387_766735_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|766803_767676_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|767784_768906_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|768959_769562_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|769876_772066_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 5
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	826583	902008	2868496	tRNA,head,portal,protease,integrase,transposase,terminase,tail,holin,capsid	Enterococcus_phage(25.64%)	91	882145:882160	885498:885513
WP_002286621.1|826583_829382_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|829430_830957_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|830971_831619_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|831802_832132_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|832308_833037_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|833052_834066_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|834065_835343_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|835405_838108_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|838259_838577_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|838606_838927_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|839012_840473_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|840540_840762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|840792_840975_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|840974_841388_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|841510_842692_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|843222_844362_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|844660_845296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|845408_846044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|846077_846539_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002348715.1|846668_847100_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|847117_847438_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|847736_848513_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|848527_848731_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|848746_849085_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|849071_849251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|849293_849764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|849850_850549_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|850726_851068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|851060_851732_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|851737_852424_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|852426_853176_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|853187_853457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|853618_853921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|853917_854079_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|854075_854381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|854380_854737_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|854696_854942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|854938_855358_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|855354_855912_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|855908_856205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|856281_856695_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|857152_857428_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|857881_858088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|858283_858451_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|858476_858821_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|858825_859107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|859209_859524_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|859501_861196_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|861215_862394_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|862356_863043_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|863042_864203_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|864212_865088_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|865084_865396_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|865385_865739_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|865728_866130_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|866122_866527_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|866538_867147_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|867166_867529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|867531_867714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348716.1|867730_871162_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|871212_871950_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002286497.1|871959_874251_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286495.1|874274_876401_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|876563_877010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|877011_877149_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|877186_877480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|877476_877701_+|holin	holin	holin	NA	NA	NA	NA
WP_002349643.1|877697_878723_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_087046766.1|879662_880824_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|881747_882155_+	hypothetical protein	NA	NA	NA	NA	NA
882145:882160	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|882168_882570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|882571_882943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|882978_883281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076005172.1|883529_883730_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002348827.1|884034_885267_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|885523_886093_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
885498:885513	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002297963.1|886270_886711_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|886868_887633_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|887664_888588_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|888663_889803_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|889795_890596_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|890595_891423_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|891400_892135_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|892234_893101_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|893114_893687_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|893708_894737_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|894834_895686_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002348826.1|895719_897753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348825.1|897796_899077_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002297185.1|899173_900469_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_010782578.1|900733_902008_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
>prophage 6
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	1073836	1131675	2868496	protease,tRNA,transposase	Lysinibacillus_phage(25.0%)	56	NA	NA
WP_002297218.1|1073836_1075132_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002321398.1|1075367_1077467_+	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002290060.1|1077662_1078526_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_002322512.1|1078630_1079104_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002297218.1|1079170_1080466_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294386.1|1080721_1081609_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002294387.1|1081627_1081999_+	protein RibT	NA	NA	NA	NA	NA
WP_002305297.1|1081968_1082766_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002296975.1|1082749_1083319_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002294391.1|1083324_1084041_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296977.1|1084370_1084982_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002290168.1|1085359_1086883_+	YfcC family protein	NA	NA	NA	NA	NA
WP_002294399.1|1087119_1088460_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002294400.1|1088612_1089350_+	thioesterase	NA	NA	NA	NA	NA
WP_002294401.1|1089514_1089736_-	ferredoxin	NA	NA	NA	NA	NA
WP_002305295.1|1089766_1090798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303122.1|1090784_1092188_+	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.5e-64
WP_002294404.1|1092253_1092889_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303123.1|1092937_1093618_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294406.1|1093752_1094982_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002296982.1|1095163_1096474_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002290178.1|1096716_1096992_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_002297185.1|1097217_1098513_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002294410.1|1098748_1099795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289879.1|1099796_1101056_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002289878.1|1101061_1101643_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_002294412.1|1101724_1102600_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002290045.1|1102747_1103080_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294414.1|1103191_1104400_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290187.1|1104553_1105009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1105202_1106498_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290188.1|1106892_1107168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288388.1|1107180_1109259_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002288390.1|1109418_1111305_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002294416.1|1111316_1112264_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288392.1|1112283_1112811_+	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002288393.1|1112873_1113527_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288394.1|1113658_1114501_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288395.1|1114658_1115555_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288396.1|1115557_1116271_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002288397.1|1116290_1116809_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288398.1|1116805_1117033_+	YozE family protein	NA	NA	NA	NA	NA
WP_002294418.1|1117184_1117736_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002288403.1|1117818_1118361_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002288405.1|1118597_1118996_-	glyoxalase	NA	NA	NA	NA	NA
WP_002296988.1|1119255_1120116_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002296990.1|1120108_1120876_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002303743.1|1120931_1121789_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002288411.1|1121910_1123989_+	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002320953.1|1123957_1125334_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288415.1|1125531_1126437_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_002288419.1|1126473_1127022_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002288421.1|1127035_1128436_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
WP_002290223.1|1128453_1129245_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_002296994.1|1129326_1130202_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_002297218.1|1130379_1131675_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 7
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	1192795	1201856	2868496		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1192795_1194091_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1194270_1194648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1194903_1195632_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1195631_1195886_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1195887_1196559_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1196559_1198782_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1198766_1200206_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1200237_1201281_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1201277_1201856_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 8
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	1472373	1524819	2868496	protease,transposase	Synechococcus_phage(25.0%)	60	NA	NA
WP_002297185.1|1472373_1473669_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002303421.1|1474064_1474595_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002303420.1|1474776_1475433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303419.1|1475559_1476033_-	trimethoprim-resistant dihydrofolate reductase DfrF	NA	F8SJN4	Pseudomonas_phage	45.1	3.0e-21
WP_002296683.1|1476700_1477915_-	ammonium transporter	NA	NA	NA	NA	NA
WP_002290686.1|1478255_1478498_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002295944.1|1478529_1479087_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002295945.1|1479099_1479288_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002295947.1|1479300_1479867_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002295138.1|1481096_1481570_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1481578_1481806_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002326711.1|1482376_1483555_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_099745844.1|1483579_1485121_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.4e-123
WP_002295142.1|1485344_1485716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1485971_1486214_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1486245_1487148_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1487160_1487349_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1487362_1487926_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1487963_1488857_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1488934_1489873_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1489906_1490257_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1490289_1491192_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1491184_1492042_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002348903.1|1492375_1493185_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1493224_1493722_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1494366_1494690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1494853_1495108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1495177_1495423_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002348902.1|1495519_1495864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1495924_1496488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|1497055_1497256_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002303202.1|1498142_1499690_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|1499791_1500145_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1500134_1500329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296656.1|1501861_1502575_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1502567_1503653_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1503669_1504113_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1504146_1504500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1504611_1505013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1505049_1505559_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1505580_1506438_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1506455_1507289_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1507302_1508100_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1508132_1508417_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1508413_1509415_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1509416_1510319_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1510482_1511331_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1511976_1512183_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1512384_1513386_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1513390_1515304_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1515471_1515978_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1516137_1516578_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1516603_1517761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1517763_1518120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1518417_1519392_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1519587_1520427_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1520611_1521499_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1522082_1522778_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1522761_1523160_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1523568_1524819_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 9
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	1615895	1847188	2868496	tRNA,head,portal,protease,plate,transposase,integrase,terminase,tail,holin,capsid	Streptococcus_phage(15.66%)	234	1750293:1750311	1855381:1855396
WP_002297218.1|1615895_1617191_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288491.1|1617337_1617925_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002288492.1|1618007_1619258_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.8	1.1e-147
WP_002297218.1|1619546_1620842_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002292069.1|1621026_1622316_-	trigger factor	NA	NA	NA	NA	NA
WP_002296313.1|1622469_1623402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296311.1|1623558_1624218_-	RDD family protein	NA	NA	NA	NA	NA
WP_002296309.1|1624220_1625246_-	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	33.1	3.2e-20
WP_002287827.1|1625258_1625549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287825.1|1625957_1627763_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.8	9.8e-97
WP_002287824.1|1627834_1629190_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002287822.1|1629213_1630383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287821.1|1630379_1631267_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_002287819.1|1631455_1635148_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_002287818.1|1635346_1635868_+	DsbA family protein	NA	NA	NA	NA	NA
WP_002287817.1|1636566_1637124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321468.1|1637302_1637914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287812.1|1638026_1638284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287830.1|1638880_1639159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321467.1|1639192_1639444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|1640016_1640970_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002326695.1|1640966_1641548_-	DUF443 family protein	NA	NA	NA	NA	NA
WP_002321528.1|1641734_1642385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289698.1|1642927_1643863_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.0e-53
WP_002289697.1|1643896_1644895_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	2.6e-115
WP_002289695.1|1644891_1645776_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
WP_002296517.1|1645910_1646642_-	aspartate racemase	NA	NA	NA	NA	NA
WP_002294441.1|1646645_1647911_-	D-aspartate ligase	NA	NA	NA	NA	NA
WP_002296519.1|1648173_1650990_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	3.6e-311
WP_002294444.1|1650999_1652994_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_002296521.1|1653252_1654755_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002292113.1|1654756_1655494_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	2.8e-34
WP_010782567.1|1655723_1656407_+	sugar diacid utilization regulator	NA	NA	NA	NA	NA
WP_002297185.1|1656474_1657770_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002289374.1|1657956_1659123_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
WP_002292134.1|1659273_1661103_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.2e-136
WP_002296525.1|1661153_1661717_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002289532.1|1661810_1662854_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_002289534.1|1663087_1664254_-	oxygen-independent coproporphyrinogen III oxidase	NA	A0A0N7G7K6	Chrysochromulina_ericina_virus	32.8	5.5e-08
WP_002300943.1|1664269_1664497_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_002289535.1|1664980_1665571_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002289536.1|1665760_1666474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289537.1|1666588_1667599_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002294466.1|1667635_1668118_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002294467.1|1668267_1668636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296526.1|1669100_1669553_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296527.1|1669732_1670527_-	sugar transporter	NA	NA	NA	NA	NA
WP_002288522.1|1670539_1671325_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002288521.1|1671676_1672618_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_002288520.1|1672621_1673545_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002294143.1|1676722_1676944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294142.1|1677051_1677399_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294141.1|1677425_1679732_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1679744_1680056_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1680052_1680346_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002301262.1|1680367_1681543_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1681566_1682040_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002294138.1|1682183_1686536_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_002294137.1|1686747_1688457_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1688524_1689793_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1689953_1690754_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1690750_1691563_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002287107.1|1691971_1693222_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1693540_1694098_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1694100_1694823_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1694958_1695840_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1695938_1696721_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1697079_1697559_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1697775_1698867_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1698859_1698988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1698991_1699537_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1699989_1701681_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1702100_1703048_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1703162_1704182_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1704272_1705502_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1705962_1706664_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326809.1|1706835_1708131_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301319.1|1708794_1709811_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1709807_1710272_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002348676.1|1710278_1710821_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1710804_1711629_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1711717_1712698_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1712721_1714206_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1714217_1715207_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1715454_1715622_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1715683_1717495_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1717491_1717857_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1718019_1718415_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1718432_1719395_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1719394_1719607_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1719627_1720326_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1720345_1720888_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1721019_1722024_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1722020_1723010_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1723006_1723813_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_010782564.1|1723978_1724935_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1725011_1725530_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1725617_1725767_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1725994_1726441_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1726635_1728531_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1728855_1729830_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_086953915.1|1730635_1731975_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_084201531.1|1732045_1733071_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_002286683.1|1733067_1733292_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|1733288_1733582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745846.1|1733619_1733757_-	XkdX family protein	NA	NA	NA	NA	NA
WP_070704958.1|1733758_1734166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|1734193_1734718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293029.1|1734717_1735086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085805908.1|1735090_1735879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745847.1|1735878_1736787_-|plate	phage baseplate upper protein	plate	A0A1P8BKW9	Lactococcus_phage	25.2	4.1e-11
WP_002342970.1|1736752_1737271_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_099745848.1|1737281_1740104_-	hypothetical protein	NA	A0A191KC22	Streptococcus_virus	41.8	7.7e-64
WP_099745855.1|1740100_1740805_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069314734.1|1740816_1743120_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	48.3	2.1e-83
WP_069314733.1|1743314_1743779_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	40.3	1.7e-16
WP_069314732.1|1743778_1744405_-|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	4.4e-28
WP_002353260.1|1744411_1744777_-	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	41.1	7.7e-17
WP_010725764.1|1744766_1745105_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	47.7	6.6e-23
WP_069314730.1|1745094_1745421_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	1.7e-23
WP_002301326.1|1745401_1745680_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_069314729.1|1745681_1747046_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.4	2.2e-125
WP_084201523.1|1747058_1747634_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	68.4	1.1e-65
WP_099745849.1|1747599_1748829_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.5	2.7e-146
WP_069314727.1|1748850_1750578_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	7.6e-264
1750293:1750311	attL	CTTTTTCATTTTCTTTAAC	NA	NA	NA	NA
WP_002301332.1|1750574_1751027_-	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	68.5	8.0e-48
1750293:1750311	attL	CTTTTTCATTTTCTTTAAC	NA	NA	NA	NA
WP_002317992.1|1751138_1751519_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	67.2	9.1e-45
WP_073441332.1|1751515_1751902_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	37.5	1.8e-11
WP_069314725.1|1751882_1752269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154212406.1|1752573_1752717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010725701.1|1753041_1753509_-	ArpU family phage transcriptional regulator	NA	D7RWH7	Brochothrix_phage	29.1	2.4e-07
WP_050397116.1|1753583_1754024_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	37.7	9.0e-20
WP_069314724.1|1754053_1754347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002309099.1|1754343_1754547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314723.1|1754553_1754784_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_069314722.1|1754950_1755241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314721.1|1755251_1755827_-	DUF1642 domain-containing protein	NA	A0A0E3T929	Enterococcus_phage	32.1	2.1e-16
WP_048946628.1|1756137_1756356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314720.1|1756352_1756877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314719.1|1756876_1757167_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	42.4	2.4e-13
WP_084205653.1|1757166_1757472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314717.1|1757468_1757630_-	antitoxin	NA	NA	NA	NA	NA
WP_010721325.1|1757626_1757929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314716.1|1758090_1758360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314715.1|1758371_1759223_-	replication protein	NA	A0A1S5SFJ6	Streptococcus_phage	67.1	2.1e-49
WP_099745850.1|1759229_1759916_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.5	4.9e-89
WP_002286557.1|1759921_1760593_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1760585_1760927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1761104_1761803_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1761889_1762360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314713.1|1762402_1762582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342110.1|1762594_1762861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353431.1|1762871_1763066_-	hypothetical protein	NA	M1IFE9	Streptococcus_phage	53.1	1.1e-11
WP_033655448.1|1763370_1763790_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	62.3	3.0e-41
WP_069314712.1|1763806_1764229_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	50.7	3.6e-34
WP_002317583.1|1764257_1764458_+	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	87.9	2.5e-25
WP_069314711.1|1764543_1764984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314710.1|1765121_1766327_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	7.3e-64
WP_002296332.1|1766610_1767177_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348678.1|1767432_1768764_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
1767404:1767422	attR	GTTAAAGAAAATGAAAAAG	NA	NA	NA	NA
WP_002296335.1|1768729_1769080_+	hypothetical protein	NA	NA	NA	NA	NA
1767404:1767422	attR	GTTAAAGAAAATGAAAAAG	NA	NA	NA	NA
WP_002296337.1|1769591_1769936_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1770201_1771161_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1771350_1771947_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1772070_1773870_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1774147_1774360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1775223_1776183_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1776395_1777304_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1777352_1777739_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000122610.1|1778042_1779335_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002288574.1|1779553_1780900_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1781011_1782361_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1782477_1783731_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1783801_1784287_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1784309_1785068_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1785083_1786262_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1786491_1788612_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002296838.1|1788834_1789560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1789549_1790059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1790128_1791577_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1791576_1792293_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1792273_1792624_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1792767_1793541_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1794297_1794600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1795038_1796217_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1796553_1796793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1797154_1797415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1797599_1798097_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1798226_1798937_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1798949_1800614_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1800818_1801481_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1801490_1802306_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1802567_1803011_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1803144_1803483_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1803470_1803848_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|1804071_1805265_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1805430_1805853_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1806441_1806897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|1807013_1808192_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002288982.1|1808391_1809564_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1812694_1815022_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|1815293_1816481_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288970.1|1817338_1817632_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002286913.1|1817889_1818237_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1818372_1819134_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1819123_1819645_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1819814_1820606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1820730_1820982_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1820993_1821269_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1821521_1822076_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1822154_1822676_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1822679_1823258_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1823369_1824788_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1824808_1825147_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1825106_1825610_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1825740_1826445_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|1826441_1828178_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1828280_1830752_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002326707.1|1831024_1832299_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002289807.1|1832585_1833476_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1833672_1834155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1834362_1834728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1834818_1835136_-	SdpI family protein	NA	NA	NA	NA	NA
WP_010782561.1|1835877_1836837_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|1836959_1837934_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1838343_1839594_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1839879_1840137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1840368_1840782_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002326711.1|1841038_1842217_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_099745851.1|1842377_1843287_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_099098442.1|1843588_1844751_-|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_099745852.1|1844855_1846194_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.4e-78
WP_002301695.1|1846234_1846927_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_002296536.1|1846921_1847188_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	56.5	1.4e-07
1855381:1855396	attR	ATTTGATTTTCAATGT	NA	NA	NA	NA
>prophage 10
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	1947404	1984673	2868496	holin,transposase	Streptococcus_phage(40.0%)	38	NA	NA
WP_000997695.1|1947404_1948583_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002348961.1|1948672_1948939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305582.1|1948931_1949255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348960.1|1949266_1950523_-	lipase	NA	NA	NA	NA	NA
WP_010782554.1|1950519_1950915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348958.1|1950957_1951209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782553.1|1951208_1951529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|1951639_1952326_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000122610.1|1952960_1954253_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002305818.1|1954350_1955505_-	VanA-type vancomycin resistance histidine kinase VanS	NA	NA	NA	NA	NA
WP_001280781.1|1955482_1956178_-	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_001226076.1|1956391_1956967_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.8	9.0e-20
WP_002343843.1|1959805_1960021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|1960068_1960755_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002291653.1|1961204_1962206_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_002313499.1|1962415_1963519_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002348956.1|1963581_1964184_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002308608.1|1964186_1964627_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002308607.1|1964751_1965690_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	5.5e-75
WP_002348955.1|1965704_1966730_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289570.1|1966773_1967604_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002289568.1|1967618_1968557_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289566.1|1968723_1969074_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002322015.1|1969073_1969391_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_002289495.1|1969690_1971259_-	daptomycin-sensing surface protein LiaX	NA	NA	NA	NA	NA
WP_002294975.1|1971358_1972126_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002348954.1|1972122_1973154_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002289490.1|1973391_1974069_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002289489.1|1974081_1974840_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.2e-19
WP_002289486.1|1974855_1975662_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.8e-13
WP_002296590.1|1975676_1976561_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002292761.1|1976560_1977481_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002292763.1|1977595_1978453_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_010782552.1|1978789_1980238_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002317241.1|1980389_1981283_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002292768.1|1981266_1981953_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.7	2.5e-29
WP_096157771.1|1982057_1983159_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_000122610.1|1983380_1984673_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
>prophage 11
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	2100178	2126200	2868496	tRNA,plate,transposase,tail,holin	Bacillus_phage(33.33%)	29	NA	NA
WP_000222572.1|2100178_2101132_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2101165_2102395_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2102396_2103314_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2103317_2104055_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2104145_2104673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2104852_2105446_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2105549_2106035_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2106187_2106385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2106479_2108240_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2108236_2109967_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2110359_2110572_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2110573_2112253_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2112506_2112707_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002347086.1|2113782_2114181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|2114173_2114626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318238.1|2114612_2115119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|2115223_2116402_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2116630_2117970_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002312527.1|2118039_2119065_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	3.6e-64
WP_002286683.1|2119061_2119286_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|2119282_2119576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|2119613_2119751_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|2119750_2120158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|2120185_2120710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|2120709_2121159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|2121162_2121780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|2121779_2122688_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347081.1|2122700_2125463_-	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002303299.1|2125459_2126200_-|tail	tail protein	tail	NA	NA	NA	NA
>prophage 12
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	2129561	2175853	2868496	head,tRNA,portal,transposase,terminase,tail	Enterococcus_phage(26.09%)	55	NA	NA
WP_002303295.1|2129561_2130170_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002298045.1|2130170_2130548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|2130549_2130945_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298048.1|2130937_2131309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|2131308_2131650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311614.1|2131661_2131877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312521.1|2131899_2132790_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002348774.1|2132944_2134264_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002350777.1|2134487_2135189_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002304492.1|2135237_2135555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033582200.1|2135556_2136435_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_002343932.1|2136514_2138050_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_002304486.1|2138061_2139480_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002304484.1|2139457_2139886_-	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002311618.1|2139903_2140128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304480.1|2140678_2141065_-	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002322045.1|2141077_2141491_-	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002286693.1|2141567_2141864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304475.1|2141860_2142064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304474.1|2142070_2142301_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304473.1|2142297_2142609_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304472.1|2142747_2143563_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002350868.1|2143559_2143886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292988.1|2143882_2144044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304469.1|2144058_2144418_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002304468.1|2144414_2145266_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002303278.1|2145280_2146081_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002303277.1|2146123_2147014_-	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303275.1|2147015_2147957_-	endonuclease	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303273.1|2148189_2148525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304466.1|2148776_2149016_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
WP_002299038.1|2149324_2149480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|2149551_2149782_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002303266.1|2149949_2150216_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303265.1|2150415_2151120_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303264.1|2151206_2152496_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303263.1|2152561_2153914_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002304462.1|2153808_2154480_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002287951.1|2154534_2155188_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2155177_2156491_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2156800_2159446_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|2159838_2160486_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|2161058_2162270_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287956.1|2162285_2163428_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287957.1|2163592_2165314_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287958.1|2165512_2166073_-	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287959.1|2166098_2166938_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287960.1|2166971_2167805_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287961.1|2168036_2169005_+	asparaginase	NA	NA	NA	NA	NA
WP_002287962.1|2169159_2169897_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287963.1|2169912_2170746_-	phosphotransferase	NA	NA	NA	NA	NA
WP_002294080.1|2170947_2172276_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002348865.1|2173365_2173995_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002287966.1|2174108_2174483_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_086956687.1|2174691_2175853_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 13
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	2330950	2357017	2868496	protease,bacteriocin,transposase	Bacillus_phage(33.33%)	25	NA	NA
WP_000997695.1|2330950_2332129_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002290607.1|2332477_2334103_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	4.9e-156
WP_002288862.1|2334153_2334438_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|2334662_2335325_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002303458.1|2335400_2336693_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303461.1|2336862_2337492_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2337594_2338404_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002305460.1|2338458_2339328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|2339328_2340645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294131.1|2340641_2342477_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002288850.1|2342481_2343186_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294132.1|2343375_2344236_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002322652.1|2344222_2344792_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002294609.1|2345740_2346127_-	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_002294608.1|2346123_2346645_-	RDD family protein	NA	NA	NA	NA	NA
WP_002294607.1|2346646_2347681_-	signal peptide peptidase SppA	NA	A0A1C9LW82	Vibrio_phage	29.2	6.6e-13
WP_002348772.1|2347713_2349129_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002303464.1|2349097_2351251_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	7.0e-41
WP_002303465.1|2351508_2351745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294603.1|2351763_2351979_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002348773.1|2352681_2353371_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002348774.1|2353494_2354814_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002348775.1|2355132_2356380_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002294600.1|2356455_2356602_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002305452.1|2356705_2357017_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 14
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	2489199	2554097	2868496	holin,tRNA,transposase	Bacillus_phage(33.33%)	50	NA	NA
WP_002297218.1|2489199_2490495_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294493.1|2490649_2491333_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002285996.1|2491334_2492171_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002302556.1|2492181_2493936_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-39
WP_002285994.1|2494211_2494553_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002294492.1|2494620_2496792_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002285989.1|2497002_2497860_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285988.1|2497930_2498788_-	ROK family protein	NA	NA	NA	NA	NA
WP_002285985.1|2498772_2501475_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002294491.1|2501487_2502777_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002302559.1|2502926_2503973_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285980.1|2503974_2506128_+	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_002304851.1|2506600_2508052_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2508048_2509773_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010782528.1|2509765_2510380_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2510724_2512182_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2512222_2513143_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2513154_2514102_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2514580_2515300_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002304848.1|2515348_2516995_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2517173_2517764_+	transporter	NA	NA	NA	NA	NA
WP_002285962.1|2517855_2519361_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2519444_2520797_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2520796_2521315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2521330_2521657_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2521669_2523649_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2523669_2523984_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2524151_2524445_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2524522_2525635_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2525787_2526012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2526021_2526201_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2526394_2526565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099704171.1|2526988_2527729_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2528154_2531226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303189.1|2533132_2533894_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285920.1|2533993_2535715_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_002285918.1|2535729_2537514_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.7e-46
WP_002285917.1|2537894_2539448_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2539795_2542210_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2542636_2544655_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2545024_2545681_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2545680_2546637_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2546636_2547203_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_000997695.1|2547821_2549000_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_076005178.1|2549023_2549215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2549407_2550595_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_025479400.1|2550691_2550994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|2551768_2552788_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|2552798_2553005_-|holin	holin	holin	NA	NA	NA	NA
WP_002301399.1|2553137_2554097_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 15
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	2693250	2706365	2868496		Streptococcus_phage(83.33%)	16	NA	NA
WP_002297366.1|2693250_2693565_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2693577_2693952_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2693952_2694297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|2694379_2695525_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297361.1|2696239_2698099_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|2698192_2698432_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|2698509_2699184_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2699416_2699851_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2699851_2700559_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2700548_2700839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2701097_2702282_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2702278_2702416_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2703161_2705072_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2705175_2705400_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2705412_2705916_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2705975_2706365_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
>prophage 16
NZ_CP017787	Enterococcus faecium strain E232 chromosome, complete genome	2868496	2723225	2759463	2868496	integrase,transposase	Bacillus_phage(50.0%)	35	2752825:2752840	2763070:2763085
WP_002303202.1|2723225_2724773_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|2724874_2725228_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|2725217_2725412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016252734.1|2725575_2731503_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002332818.1|2732119_2732554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297334.1|2732570_2733776_-	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_002297333.1|2734469_2734856_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002304825.1|2734949_2735141_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002311665.1|2735654_2735987_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297332.1|2735896_2736091_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077828743.1|2736282_2736438_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2738294_2739911_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_002317220.1|2740028_2740247_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2740441_2740903_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2741095_2741335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297324.1|2741358_2742882_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|2742899_2743022_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|2743051_2744035_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2744058_2744208_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2744228_2744606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2744637_2744817_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2744831_2745101_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297310.1|2745623_2747366_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_002297309.1|2747349_2749104_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002297308.1|2749213_2749783_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002311663.1|2749800_2751225_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_002297304.1|2751226_2751895_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071858995.1|2752025_2752610_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2752825:2752840	attL	ACCTTTTCTAAAATAA	NA	NA	NA	NA
WP_002297302.1|2752940_2753174_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_002297295.1|2753188_2754139_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|2754135_2754978_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297293.1|2755299_2756487_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297292.1|2756578_2757319_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002320809.1|2758006_2758165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297291.1|2758236_2759463_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2763070:2763085	attR	TTATTTTAGAAAAGGT	NA	NA	NA	NA
>prophage 1
NZ_CP017788	Enterococcus faecium strain E232 plasmid unnamed1, complete sequence	169793	3393	127379	169793	transposase,integrase,bacteriocin,holin	Streptococcus_phage(18.6%)	115	118556:118615	122911:123156
WP_002297404.1|3393_4644_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|5053_7426_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002353594.1|7486_8956_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|8966_10976_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002303484.1|11321_11918_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002303483.1|11930_12830_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|12832_12964_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|12985_13318_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|13362_13596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|13754_13877_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|14066_14291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|14733_14940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|14939_15191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|15371_15644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|16088_16268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|16326_16683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|17651_18605_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|18725_18989_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|19360_20539_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002332708.1|21070_21979_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300835.1|23923_24379_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|24392_25721_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|25754_26039_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|26040_26556_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|26571_27234_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|27240_27813_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002303202.1|27984_29532_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002287659.1|29633_29987_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|29976_30171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|30352_31873_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|32115_32301_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|32284_32467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|33420_34020_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|34083_34683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305879.1|35698_36571_-	ROK family protein	NA	NA	NA	NA	NA
WP_002303302.1|36834_38781_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|38965_40405_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|40406_41369_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|41538_42965_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|43207_43663_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|44248_44479_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|44708_45527_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|45687_46377_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|46390_47893_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|47905_48382_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|48879_50042_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|51159_51678_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|53753_54839_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002287760.1|54946_55900_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-34
WP_002301126.1|56030_57281_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|57299_58226_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|58304_59300_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|59315_60485_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|60500_61235_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|62005_63168_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301811.1|63736_65029_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|65302_65563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|65813_66992_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_073120200.1|67343_67640_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|68588_68984_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|68993_69842_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|69856_70684_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002285758.1|71754_71949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|71938_72292_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002303202.1|72393_73941_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002300493.1|74146_75316_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_099745857.1|75655_76342_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_000195429.1|76965_78138_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_072093095.1|78267_79089_-	aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	99.6	8.0e-155
WP_000997695.1|79143_80322_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002303110.1|81314_82352_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002304895.1|82348_82870_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002304894.1|82918_83185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303113.1|83860_84412_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|84956_85637_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002304893.1|85664_86228_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	2.2e-18
WP_000824191.1|86272_86440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|86473_86773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|86813_87431_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|87755_88151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|88230_90582_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_000718009.1|90706_91396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|91409_91862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|91992_92673_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002348841.1|93291_93495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305972.1|93953_94919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|94998_95679_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|95780_97100_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|97096_97750_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002348630.1|98459_99176_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_016922460.1|99299_99485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|101091_102123_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|102129_102960_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302265.1|102956_103763_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|103768_104593_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002347701.1|104582_105683_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|105860_106646_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|106678_107062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|107137_107269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322470.1|107237_107474_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002302275.1|107551_108523_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002340465.1|109174_110797_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.5	2.7e-122
WP_002301195.1|111082_112459_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|112458_113115_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|113124_114402_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|114651_115813_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002330699.1|115843_116293_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_010706480.1|116448_116799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745858.1|117265_118427_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.8	1.2e-79
118556:118615	attL	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGC	NA	NA	NA	NA
WP_002349250.1|119052_119577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326839.1|119601_120510_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002301108.1|121185_121740_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_000997695.1|122776_123955_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
122911:123156	attR	GCTCTTTTCTACGGCTGTATCTTTTAATTTGCTTATTGAAAGACTCGATTAGATTGGTTGAGTAAATGGTTCTACGAATGCTAGGTGGAAAATCATAAAAAGTTAATAAGTCTTGGTTTTCTATGAGTGACTGCGTCACTTTAGGATAGTTTTTCTTCCATTTCTCAATCATGCCGGATAAGAAGGTATTCGCTTCTTCTTTTGAGTTAGCTTGATAAACAGCCTTAAAGTCATCACAGATTTCTT	NA	NA	NA	NA
WP_002307497.1|124720_125533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002316137.1|126206_127379_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	98.4	1.1e-133
>prophage 1
NZ_CP017789	Enterococcus faecium strain E232 plasmid unnamed2, complete sequence	54822	44538	52209	54822	transposase	Temperate_phage(16.67%)	12	NA	NA
WP_002321302.1|44538_45012_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	62.0	5.6e-44
WP_002321303.1|45377_45638_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002296239.1|46082_46289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305766.1|46288_46540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305764.1|46555_46972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348912.1|46953_47226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305759.1|47392_47794_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	43.1	1.4e-24
WP_002305757.1|47805_48951_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D9J0Y9	Brochothrix_phage	74.6	7.7e-164
WP_002287514.1|49188_49452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|49445_49796_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|49819_50434_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002348911.1|50883_52209_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.6	1.2e-99
>prophage 1
NZ_CP017790	Enterococcus faecium strain E232 plasmid unnamed3, complete sequence	36019	1656	10454	36019	transposase	Streptococcus_phage(100.0%)	11	NA	NA
WP_011117477.1|1656_2343_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	6.5e-126
WP_001814874.1|2482_2566_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038792.1|2690_3428_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_000085862.1|3432_3564_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	7.9e-17
WP_000567888.1|4721_4967_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228166.1|5069_5939_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000662263.1|5919_6654_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000627290.1|7595_8138_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|8230_9025_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_099745860.1|9300_9738_+	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	93.8	3.2e-70
WP_002354485.1|9767_10454_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
>prophage 2
NZ_CP017790	Enterococcus faecium strain E232 plasmid unnamed3, complete sequence	36019	23423	33257	36019	transposase	Streptococcus_phage(50.0%)	12	NA	NA
WP_000754864.1|23423_23753_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	44.6	2.6e-16
WP_000629052.1|24057_24387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312841.1|24376_24664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000017403.1|24942_25506_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.4	2.3e-36
WP_000222571.1|26148_27102_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-34
WP_002354485.1|27261_27948_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_016171138.1|27995_29255_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.2	1.1e-54
WP_010782630.1|29404_30019_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	4.9e-16
WP_002288787.1|30332_30755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|30764_30968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|31178_31763_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_016171137.1|31931_33257_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.8	4.1e-100
