The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	994010	1002666	4806250	integrase	Escherichia_phage(66.67%)	9	990532:990546	1005985:1005999
990532:990546	attL	GTTGACGGCCTGCCG	NA	NA	NA	NA
WP_099991739.1|994010_994955_-	SDR family oxidoreductase	NA	Q76TT0	Molluscum_contagiosum_virus	26.8	3.8e-07
WP_099991741.1|994990_995764_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_099991743.1|995825_996458_-	aldolase	NA	A0A077SK32	Escherichia_phage	67.5	4.8e-75
WP_099991746.1|996450_997701_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	59.6	1.7e-124
WP_059113805.1|997697_998606_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	72.6	1.3e-108
WP_099991748.1|998861_999650_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	51.4	1.2e-62
WP_021140529.1|999670_999796_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_099991751.1|999816_1000875_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_099991754.1|1001340_1002666_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	27.7	3.0e-26
1005985:1005999	attR	GTTGACGGCCTGCCG	NA	NA	NA	NA
>prophage 2
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	1711624	1776990	4806250	transposase,tRNA	Stx2-converting_phage(15.38%)	59	NA	NA
WP_021138552.1|1711624_1713073_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_021138553.1|1713172_1713565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310300.1|1713668_1714301_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_099992576.1|1714702_1715620_+	flagellin	NA	NA	NA	NA	NA
WP_099992578.1|1716199_1717114_+	flagellin	NA	NA	NA	NA	NA
WP_099994747.1|1717216_1717603_+	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_099992580.1|1717636_1719031_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_099992582.1|1719056_1719479_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_099994748.1|1719529_1719802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099992584.1|1719801_1721889_+	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_099992586.1|1721925_1722477_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099992588.1|1722902_1723952_-	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_192873359.1|1723955_1724507_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_099992592.1|1724503_1725631_-	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_099992594.1|1725676_1726966_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_099992596.1|1726962_1727718_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_099992598.1|1727714_1728560_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_099992600.1|1728550_1729693_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	34.0	4.7e-36
WP_099992602.1|1729689_1730694_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	L7Y3T9	Megavirus	32.4	6.8e-39
WP_099992603.1|1730799_1731615_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_192873360.1|1731607_1732558_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_058394726.1|1732554_1733247_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_099992605.1|1733350_1734109_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058394724.1|1734206_1735139_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_099992607.1|1735506_1737126_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.1	1.8e-25
WP_005310327.1|1737492_1738296_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_011898874.1|1738495_1738951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021139807.1|1739147_1739810_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099994750.1|1740047_1741577_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059112308.1|1741573_1742536_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059112307.1|1742538_1743345_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099992609.1|1743341_1744775_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.7	1.6e-09
WP_058394721.1|1745065_1746265_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.7	9.0e-14
WP_099992611.1|1746319_1747228_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_192873361.1|1747408_1748197_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_099992615.1|1748183_1750475_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_005310350.1|1750754_1751087_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017411397.1|1751260_1751830_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_058394717.1|1752058_1753282_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_192873399.1|1753384_1754620_+	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_021139818.1|1755036_1756134_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_005310365.1|1756224_1756614_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_099992617.1|1756917_1759794_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.2	1.5e-261
WP_096118506.1|1759921_1760167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099992619.1|1760297_1761581_+	MFS transporter	NA	NA	NA	NA	NA
WP_099992621.1|1761644_1762864_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	2.9e-15
WP_005314534.1|1762975_1763152_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_017413027.1|1763286_1763535_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_099992623.1|1763615_1764380_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_099992625.1|1764376_1765087_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_059113897.1|1765076_1765574_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_099994752.1|1765765_1767142_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.5	8.7e-45
WP_099992627.1|1767228_1768583_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.2	2.9e-69
WP_099992631.1|1769222_1770263_+|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	42.1	2.2e-72
WP_001809438.1|1770322_1771354_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_099992633.1|1772566_1772971_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	36.9	7.7e-10
WP_099992635.1|1772967_1773315_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	91.3	3.2e-57
WP_099992637.1|1775437_1775800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099992639.1|1775973_1776990_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 3
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	2012618	2054233	4806250	integrase,transposase	uncultured_Caudovirales_phage(16.67%)	39	2045746:2045777	2063204:2063235
WP_099992627.1|2012618_2013972_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.2	2.9e-69
WP_099992861.1|2014048_2016778_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	28.5	2.2e-71
WP_099992863.1|2016793_2017732_-	universal stress protein	NA	NA	NA	NA	NA
WP_099992865.1|2018321_2019338_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_192873378.1|2019401_2019833_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_058394101.1|2019842_2020874_-	response regulator	NA	NA	NA	NA	NA
WP_099992869.1|2020928_2021867_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034282930.1|2021940_2022642_-	DUF2982 domain-containing protein	NA	NA	NA	NA	NA
WP_099992871.1|2022811_2024749_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.1	6.3e-17
WP_099992873.1|2024839_2025565_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_099992875.1|2025754_2026519_+	DNA repair protein	NA	NA	NA	NA	NA
WP_192873379.1|2026512_2027067_+	VOC family protein	NA	NA	NA	NA	NA
WP_099992877.1|2027111_2028320_-	MFS transporter	NA	NA	NA	NA	NA
WP_099992879.1|2028413_2029289_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005315034.1|2029362_2030337_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_099992881.1|2030483_2031077_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.5	5.0e-42
WP_005315040.1|2031325_2032018_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_005315043.1|2032112_2033783_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005299934.1|2033875_2034160_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.6e-12
WP_005315045.1|2034316_2034601_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_005315046.1|2034610_2035777_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_087755526.1|2035887_2036589_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_099992883.1|2036662_2037220_-	rhombosortase	NA	NA	NA	NA	NA
WP_192873380.1|2037239_2037860_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_099994768.1|2037883_2038591_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	6.4e-84
WP_005315059.1|2038652_2039324_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	39.4	9.8e-18
WP_099992885.1|2039325_2039556_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_011898638.1|2039552_2040116_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_058394089.1|2040184_2040592_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_021140293.1|2041170_2042751_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005315094.1|2042855_2043437_+	thymidine kinase	NA	A0A0F6TIQ8	Escherichia_coli_O157_typing_phage	52.7	1.6e-48
WP_005315095.1|2043496_2044834_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_080561576.1|2044992_2045448_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
2045746:2045777	attL	GAGGGTTCGAATCCCTCCCTCACCGCCAAATA	NA	NA	NA	NA
WP_099992887.1|2046183_2047161_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099992889.1|2047397_2048549_+|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	34.4	2.5e-37
WP_099992891.1|2048632_2049607_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_099992893.1|2050148_2051501_+	ATPase	NA	A0A2I7QJQ6	Vibrio_phage	29.1	1.7e-21
WP_099991418.1|2051938_2053092_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	64.6	4.6e-100
WP_099992895.1|2053192_2054233_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	43.2	3.3e-73
2063204:2063235	attR	GAGGGTTCGAATCCCTCCCTCACCGCCAAATA	NA	NA	NA	NA
>prophage 4
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	2800458	2899741	4806250	integrase,protease,transposase,tRNA	Vibrio_phage(12.5%)	82	2843395:2843454	2899690:2901221
WP_021139607.1|2800458_2801217_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_005310748.1|2801440_2802961_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.2e-87
WP_005310746.1|2802982_2803471_-	CvpA family protein	NA	NA	NA	NA	NA
WP_099993634.1|2803658_2804954_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.5	2.2e-90
WP_170946529.1|2805294_2806632_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	41.2	2.0e-78
WP_005310741.1|2806756_2807365_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_005300047.1|2810169_2810661_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_081045651.1|2810811_2811021_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_161494964.1|2811297_2811453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058394662.1|2811735_2812686_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.2	6.6e-60
WP_099993636.1|2812743_2813991_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	1.7e-15
WP_058394664.1|2814093_2814564_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005310730.1|2814583_2815291_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005310729.1|2815287_2816004_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2816072_2816291_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_099993638.1|2816359_2818612_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.1	1.6e-168
WP_005310725.1|2818671_2818989_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.3e-14
WP_005300025.1|2819218_2819437_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_099993640.1|2819547_2820411_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	30.9	6.7e-27
WP_151909614.1|2823102_2823546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993644.1|2823478_2824519_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	42.6	4.8e-72
WP_099993646.1|2824636_2824939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993648.1|2825039_2827139_-	ATP-binding protein	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	33.3	2.2e-07
WP_099994799.1|2827466_2827766_-	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
WP_099994800.1|2828180_2828423_-	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_099993650.1|2828587_2829514_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_099994801.1|2829770_2830971_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	69.8	2.9e-113
WP_099993652.1|2830993_2831389_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_099991418.1|2831536_2832689_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	64.6	4.6e-100
WP_099993654.1|2832705_2833353_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_151909615.1|2833570_2833942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993644.1|2834210_2835251_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	42.6	4.8e-72
WP_099992430.1|2835476_2836394_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	57.0	2.6e-93
WP_099993657.1|2836397_2837126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993659.1|2837234_2837672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993661.1|2837906_2838197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993663.1|2838629_2839547_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	54.8	2.8e-92
WP_151909616.1|2841780_2842005_-	hypothetical protein	NA	NA	NA	NA	NA
2843395:2843454	attL	GTAACCGTTCACCGGGAGGATGTTGACAACAACTCTTCCGGGAGCGGGTAGTCTGTTTTC	NA	NA	NA	NA
WP_005327996.1|2843402_2844821_-|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_099993667.1|2845729_2846596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993669.1|2846692_2847169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151909617.1|2847281_2847485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993671.1|2847614_2848343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993673.1|2848431_2849124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005327996.1|2849403_2850822_+|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_099993675.1|2850826_2851087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151909618.1|2851601_2851826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151909619.1|2851890_2852817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192873409.1|2852916_2853285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151909620.1|2853493_2853883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993679.1|2853872_2854427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993681.1|2854538_2855456_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	56.5	6.1e-95
WP_099993683.1|2856540_2856984_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_042877918.1|2857125_2857422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099994802.1|2857633_2858773_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.0	7.0e-08
WP_099993685.1|2858907_2859339_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_161494965.1|2859826_2860408_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_099993689.1|2862557_2863034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993691.1|2864370_2865006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099994803.1|2865917_2866934_-	AAA family ATPase	NA	A0A2P1CFH0	Microbacterium_phage	22.5	5.0e-05
WP_099993693.1|2867943_2868906_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_099993695.1|2869043_2870252_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	32.4	1.0e-36
WP_099994804.1|2870952_2871936_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099993697.1|2872705_2874442_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.7	3.4e-30
WP_192873410.1|2875376_2875841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059112254.1|2876073_2876559_+	YqhA family protein	NA	NA	NA	NA	NA
WP_099993701.1|2876680_2877130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993703.1|2880123_2880963_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_099993705.1|2881048_2882473_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021140308.1|2882520_2883096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993707.1|2883202_2884471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993709.1|2884567_2886238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412350.1|2886339_2887542_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.8e-22
WP_099993711.1|2887646_2889071_-	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_005310491.1|2889180_2889648_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_099993713.1|2889845_2890526_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.1e-29
WP_099993715.1|2890553_2892995_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_099993717.1|2892991_2894059_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_192873411.1|2894254_2895202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140300.1|2895735_2896215_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.3	2.8e-14
WP_099993721.1|2896804_2898250_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005327996.1|2898322_2899741_+|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
2899690:2901221	attR	GAAAACAGACTACCCGCTCCCGGAAGAGTTGTTGTCAACATCCTCCCGGTGAACGGTTACGATCAAAGTGCTAGCCTATGGGTCATTGGAGGAATGCTATCCAAATTACTTAGATTGGAAAAGAACAGAGCAAGAAGTTGCAAGTATGACGGGAAAACAGAAAACACAACTGTCAAAACGTGTTGGTGATGAAATCACAAAAGAACAATTCGAAACTGATATGAAACCTGTATTCGAAACACTTGTTTGCGCATGGGAGTTGTCGTTTTAAAACTTAACAAGATACTCCTCACTGAAATTTCACTAGCTGCGCTCAAAAAACTCCGGTGGGTGGTGCGTTACAGGTAAACCTGGAGACTCCCACTGATTTAACCAATAAATAAAATCCCGACAAAACCTGTTCTGCCGGGATTTTATTTTTCCACCTGCTCTACCAAATAGAGAATGCTGTGATGGGGAATGCCAGCGTGCTGACTTAGCCCATCTAGCTGGTACGGCTATTCCAGTAACATCGAAGAGCTGAATATATGCTAGCCCGGATATATCCCCTGCTTTGTTGGAGAAGGGATTGGGCGAAGAATTATTTGCGGCCGCGGGCAAGGGATTTGAGAAATGCCAGAGTGCGGCGATTAAACTGCTCCGGCTGCTCCACATTGCAGACATGACCACACTGTTCGATCACCGCCAGAGATGAGCTGGCATCGCGGGCCACCTGCTCGCGCACCGGCGCCAGGAACATATGATCCTCCTCCCCCATCACGTAGAGGGTCGGGATCGGCAAAGCCCGCTCCTTGAAGTAGCGCATCAGGGGGTTGACCTCGGTGGCGAGGCGGAACCAGCGTTTGAACTCCTTCTGGCACAATTTGCGCGCCTCGCGCACGAACAGGTTGCGCGACTCCTGATGGTGCTGGCGCGGCATTATGATGAAGGCGAACAGGCGGTAGAGCCACATGTAGGGCAGGATGTGCTGGCCGAGGCGGCCGAGCTGTACCAATACCCGGGAGCGAATGTCCAGCCGCAGTATGGCGCCCCCCAATACCATGCTCTTGACCCGCTCCGGGCAGAGCTCCGCCAGATGGCGAATGAGGATGGTGCCAAGGGAGATGCCGACGAAGTGAGCGCAACGGATATTGAGATGATCGAGCAGACGCACTATGTCTTCGGTCACGGCCCGGAAGCTGTAGTGCCCCTTGACCACCTGCTGCAACTGGTGGGACTGACCGTGGCCACGCAGATCCAGCAGCAGCACGTTGAAGTGCTCGCGATAGGCGCGCAGCTGCTTGAACCAGATGGAGGAGCTGCCACCGGCGCCGTGCACGAATACCACCCAATCCCTGTCGGGGCCAAGCTCGAACGTCTTGTGATACAGCATCTTGCGACTCCCTCATCGACGGCATTGGGGTATAGTAGGCGCGCATCTTAGCAGATATTTTCACCTAAAAAATACGTTTGCATGGCAACTGGCGAGGAGCGTGACCATGGAGTTGACGAGTTTGAGAGCCTTTCTGCTGACCCTGCCGGGCACTCAGGAG	NA	NA	NA	NA
>prophage 5
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	2921646	2986493	4806250	protease,portal,integrase,transposase,head,terminase,capsid,tail,tRNA	uncultured_Caudovirales_phage(15.38%)	57	2969934:2969949	2989067:2989082
WP_099368944.1|2921646_2922672_-|transposase	IS110-like element ISAs24 family transposase	transposase	NA	NA	NA	NA
WP_021140476.1|2922801_2926719_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	60.5	1.2e-131
WP_099993723.1|2926869_2928360_+	membrane-bound lytic murein transglycosylase MltF	NA	G0YQ82	Erwinia_phage	35.1	4.6e-07
WP_011898860.1|2928536_2928683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327996.1|2928786_2930205_-|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_099993725.1|2930270_2930486_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_017411381.1|2930590_2932090_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_099993727.1|2932164_2933349_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_005310432.1|2933341_2933992_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099993729.1|2933995_2935273_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_059112283.1|2935411_2936527_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_099993731.1|2936537_2937488_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_087755913.1|2937477_2938269_-	PilW family type IVa pilus biogenesis/stability lipoprotein TapF	NA	NA	NA	NA	NA
WP_099993733.1|2938281_2939385_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_005310418.1|2939554_2939983_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	3.7e-18
WP_099993735.1|2940266_2941550_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.5	1.1e-30
WP_099993737.1|2941587_2942892_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.2	4.1e-36
WP_005310414.1|2943051_2943390_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_099993739.1|2943391_2945239_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.2	7.9e-102
WP_058394705.1|2945267_2945786_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_005310407.1|2945901_2946225_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.8	1.1e-22
WP_005310405.1|2946240_2946624_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	4.8e-54
WP_059112288.1|2946665_2947880_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_017411386.1|2947937_2948441_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_099993741.1|2948534_2949257_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_059168990.1|2949437_2949854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099994805.1|2949800_2950340_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_099993743.1|2950529_2951525_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.3	2.0e-22
WP_099993745.1|2951602_2952475_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_080937909.1|2952793_2953699_-	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_021139835.1|2953831_2954200_-	rhodanese domain-containing protein	NA	NA	NA	NA	NA
WP_021139834.1|2954300_2955248_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.4	3.4e-48
WP_011898866.1|2955257_2957111_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_021139832.1|2957129_2957465_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.4	1.1e-09
WP_021139831.1|2957516_2958653_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.0	1.5e-90
WP_059112294.1|2958723_2959791_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_017411391.1|2960002_2960449_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005900002.1|2961103_2961670_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_099993747.1|2961781_2963374_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.4	1.0e-41
WP_099993749.1|2966546_2966876_+	hypothetical protein	NA	A0A2I6PI47	Pseudomonas_phage	38.6	1.8e-09
WP_099993751.1|2966872_2967148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993753.1|2968534_2969053_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.0	5.2e-51
WP_099993755.1|2969119_2969404_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	56.2	6.8e-21
WP_099993757.1|2969412_2969544_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
2969934:2969949	attL	AAACAGCTTGGCCAGC	NA	NA	NA	NA
WP_099993759.1|2971992_2972484_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	50.3	3.5e-33
WP_099993761.1|2972483_2973644_+	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	54.0	4.1e-96
WP_161494966.1|2974997_2976644_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	40.9	2.4e-110
WP_099993768.1|2976624_2977029_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_161494967.1|2977416_2977584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161494968.1|2977593_2977911_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	36.2	1.8e-09
WP_099993772.1|2977910_2978198_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_099993774.1|2978198_2979233_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	31.3	2.7e-43
WP_161494969.1|2979219_2979747_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	47.4	7.9e-31
WP_099993778.1|2979798_2980938_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	27.1	2.5e-21
WP_099993780.1|2981605_2983738_-	PriCT-2 domain-containing protein	NA	D3W0G0	Lactococcus_phage	29.4	3.1e-17
WP_099993782.1|2984166_2985183_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.3e-186
WP_099993784.1|2985470_2986493_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	30.8	5.9e-22
2989067:2989082	attR	AAACAGCTTGGCCAGC	NA	NA	NA	NA
>prophage 6
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	3126121	3184063	4806250	transposase,tRNA	Acinetobacter_phage(28.57%)	46	NA	NA
WP_099993922.1|3126121_3127087_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099993923.1|3128534_3130097_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005327996.1|3131194_3132613_-|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_099993924.1|3132777_3134184_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_058394242.1|3137342_3138524_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099993925.1|3138667_3139309_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099993926.1|3139512_3140199_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099993927.1|3140316_3141495_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005319118.1|3141558_3142422_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_099993928.1|3142598_3143927_-|transposase	IS4-like element ISAs30 family transposase	transposase	NA	NA	NA	NA
WP_021139995.1|3144064_3144988_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_099993929.1|3145130_3145700_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.3	5.2e-20
WP_170946482.1|3145798_3146683_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_005319127.1|3146675_3147296_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_099993930.1|3147432_3148314_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_146612888.1|3148535_3148739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993931.1|3148750_3150388_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_059168631.1|3150380_3150980_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	36.3	3.0e-26
WP_021139988.1|3150990_3152004_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.1	6.6e-50
WP_099993932.1|3152003_3153500_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	NA	NA	NA	NA
WP_042060260.1|3153585_3154779_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_058394248.1|3154775_3155582_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_058394249.1|3157365_3157857_-	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	34.6	1.4e-16
WP_099993933.1|3157846_3158113_-	thioesterase	NA	NA	NA	NA	NA
WP_005327996.1|3158177_3159596_-|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_058394250.1|3159822_3160164_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_034524650.1|3161020_3161938_-|transposase	IS5-like element ISAs13 family transposase	transposase	Q9MCT5	Escherichia_phage	55.8	2.0e-93
WP_099993934.1|3162264_3162777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993935.1|3163559_3165467_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_058394254.1|3165936_3167343_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_099993936.1|3167556_3167862_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_099993937.1|3167862_3168630_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_192873227.1|3168709_3169639_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_034524276.1|3169635_3170115_+	NUDIX hydrolase	NA	A0A023W5N2	Serratia_phage	62.2	8.9e-05
WP_099993939.1|3170272_3171379_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_017412872.1|3171576_3172188_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_099993940.1|3172363_3173734_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.3	3.7e-112
WP_099993941.1|3173898_3175029_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_058395693.1|3175090_3175621_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_099993942.1|3175653_3177288_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099993943.1|3177287_3177902_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_059113935.1|3177949_3178588_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_099993944.1|3178749_3179073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192873228.1|3179069_3181046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058395689.1|3181256_3182468_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_099993946.1|3182734_3184063_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	3228076	3264972	4806250	transposase	Bacillus_phage(60.0%)	21	NA	NA
WP_099993964.1|3228076_3229093_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_001809438.1|3229234_3230266_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_099993965.1|3230598_3230802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099994819.1|3231215_3232541_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_099994820.1|3232696_3233188_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_059112912.1|3233251_3234274_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_099993966.1|3234573_3235371_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_099993967.1|3235384_3236239_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001809438.1|3236250_3237282_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_151909625.1|3237636_3237747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993968.1|3237800_3238763_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_099993681.1|3252851_3253769_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	56.5	6.1e-95
WP_099993969.1|3253827_3254403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043134661.1|3254420_3254882_-	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_021138420.1|3254901_3255231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099993970.1|3255610_3257698_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.1	1.7e-39
WP_099993971.1|3257694_3259059_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_192873231.1|3259055_3261239_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.9	1.6e-45
WP_005319361.1|3261368_3262043_+	response regulator	NA	W8CYM9	Bacillus_phage	33.8	4.3e-29
WP_034523497.1|3262042_3263428_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_099993928.1|3263643_3264972_-|transposase	IS4-like element ISAs30 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	3861409	3932601	4806250	integrase,transposase,tRNA	uncultured_Caudovirales_phage(14.29%)	58	3914465:3914515	3922805:3922855
WP_099994261.1|3861409_3862699_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	2.8e-85
WP_041205730.1|3863066_3863432_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005325174.1|3863431_3863734_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_161494974.1|3863962_3865141_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_042045363.1|3865445_3865694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004364974.1|3866285_3867182_-	cation transporter	NA	NA	NA	NA	NA
WP_004364961.1|3867277_3867685_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_029303618.1|3867790_3868192_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_099994263.1|3868321_3869092_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	62.1	5.9e-83
WP_099994264.1|3869088_3870102_-|transposase	IS21-like element ISAeme17 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	1.1e-73
WP_084214743.1|3870321_3871539_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	50.6	5.1e-105
WP_059169461.1|3871772_3872405_-	LysE family translocator	NA	NA	NA	NA	NA
WP_099994265.1|3878502_3881370_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.8	5.7e-22
WP_096119109.1|3881643_3882300_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_021140099.1|3882372_3882561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099994266.1|3882619_3884551_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_192873419.1|3884574_3885072_-	molybdopterin-binding oxidoreductase	NA	NA	NA	NA	NA
WP_005318975.1|3885167_3886802_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.9	4.2e-187
WP_005318973.1|3886843_3887137_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	1.1e-10
WP_059113491.1|3887353_3888724_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005318970.1|3888748_3889225_-	FxsA family protein	NA	NA	NA	NA	NA
WP_021140094.1|3889675_3891118_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_021140093.1|3891245_3892565_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_099994267.1|3892765_3893851_+	porin	NA	Q1MVN1	Enterobacteria_phage	35.3	1.5e-47
WP_192873244.1|3895315_3896260_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099994268.1|3896253_3898020_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_005318955.1|3898371_3898926_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099994269.1|3898990_3899542_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099994840.1|3899917_3900163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099994270.1|3900473_3901523_-	oxidoreductase	NA	NA	NA	NA	NA
WP_021140085.1|3901630_3902794_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_099994271.1|3903028_3903625_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A1K0HN61	Ugandan_cassava_brown_streak_virus	31.9	1.5e-14
WP_099994272.1|3903710_3904856_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_005318940.1|3905081_3905318_-	ribosome alternative rescue factor ArfA	NA	NA	NA	NA	NA
WP_099994273.1|3905449_3905989_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_059113499.1|3906070_3906511_-	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_099994274.1|3906942_3908535_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.1	3.3e-72
WP_005318932.1|3908652_3909942_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_058395205.1|3910241_3910616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087757230.1|3910596_3911148_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_059113502.1|3911494_3913759_+	alpha amylase C-terminal domain-containing protein	NA	NA	NA	NA	NA
3914465:3914515	attL	ATTTGGTGGCCCCTGCCCGACTTGAACGGGCGACCAATCGATTATGAGTCG	NA	NA	NA	NA
WP_099994275.1|3914703_3915996_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	31.9	1.1e-41
WP_099994276.1|3915992_3916763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099994277.1|3916844_3917039_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_099994279.1|3917426_3918383_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	35.7	6.0e-37
WP_099994280.1|3918379_3919015_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	52.6	4.3e-47
WP_041204923.1|3919042_3920185_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_099994281.1|3920219_3920777_+	hypothetical protein	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	44.5	1.4e-33
WP_151909629.1|3921125_3921806_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	39.9	4.7e-36
WP_151909630.1|3921874_3922528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081100716.1|3923077_3924943_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
3922805:3922855	attR	ATTTGGTGGCCCCTGCCCGACTTGAACGGGCGACCAATCGATTATGAGTCG	NA	NA	NA	NA
WP_099994283.1|3925156_3926944_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.9	5.7e-73
WP_099994284.1|3927032_3927476_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	5.8e-27
WP_005309452.1|3927491_3927707_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_033136007.1|3927886_3928900_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	2.4e-108
WP_005327996.1|3929053_3930472_-|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_099994285.1|3930544_3931507_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	1.3e-34
WP_058395211.1|3931554_3932601_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.3	7.9e-14
>prophage 9
NZ_CP022550	Aeromonas salmonicida strain A527 chromosome, complete genome	4806250	4049699	4057913	4806250		Klosneuvirus(16.67%)	6	NA	NA
WP_099994350.1|4049699_4051847_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	31.4	1.2e-64
WP_099994351.1|4052127_4054077_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	42.4	2.2e-41
WP_099994352.1|4054079_4055234_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	72.8	1.8e-35
WP_099994353.1|4055383_4056064_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	2.0e-26
WP_192873249.1|4056060_4057350_+	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.6	6.3e-05
WP_099994848.1|4057412_4057913_-	NUDIX domain-containing protein	NA	A0A0H4J2U2	Stenotrophomonas_phage	39.3	8.1e-09
