The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	2969	55393	5196956	terminase,portal,transposase,head,tail,holin,capsid	Stx2-converting_phage(27.45%)	62	NA	NA
WP_001296031.1|2969_3245_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|3241_3799_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|4210_4480_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|4536_5205_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|5403_5586_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_022645053.1|5813_6599_+	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_000972097.1|6600_7134_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|7164_7692_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_071550361.1|7707_10614_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001016257.1|11075_11822_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|11836_13378_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|14018_17492_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_061089814.1|17834_18467_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|18412_19156_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|19166_19865_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|19864_20206_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|20198_23441_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|23488_23698_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|23793_24168_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|24182_24899_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|24965_25310_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|25306_25753_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|25749_26100_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|26109_26436_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|26432_29018_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|28963_29185_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|29229_31167_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|31230_32892_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|32888_33452_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|33742_34108_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|34149_34350_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|34548_34764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|34849_35035_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|35256_35343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|35897_36431_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|36536_36809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|36774_37119_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|37123_37339_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|37489_39343_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|39603_39939_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|40219_40351_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|41152_42202_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|42353_42551_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|42777_43599_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|43595_43976_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|43976_45032_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|45033_45306_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|45473_45686_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|45866_46532_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|46706_47132_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|47147_47918_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|47939_48686_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|48692_49655_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|49677_50103_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|50099_50315_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|50364_51081_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|51353_51509_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|51668_51887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023142248.1|51935_52103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|52452_52641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|52637_52829_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|52921_55393_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
>prophage 2
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	194893	240602	5196956	terminase,portal,tRNA,lysis,head,tail,integrase,holin,capsid	Enterobacteria_phage(56.0%)	58	213677:213691	242271:242285
WP_000654172.1|194893_195172_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|195168_197190_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|197248_200731_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|200791_201394_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|201330_202074_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|202078_202777_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|202776_203106_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|203102_205664_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|205656_206091_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|206072_206495_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|206510_207251_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|207258_207654_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|207650_208229_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|208240_208594_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|208605_209004_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|209045_210071_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|210126_210459_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|210468_211788_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|211768_213370_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|213366_213573_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|213569_215495_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
213677:213691	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|215469_216015_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|216578_216761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|216967_217294_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|217774_218068_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|218158_218341_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|218557_219034_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|219020_219326_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|219647_220337_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|220333_220474_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|220470_220833_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|220829_221120_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|221112_221283_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|221282_221738_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|221734_221836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|222185_223229_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|223265_227531_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|227780_228482_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|228478_229408_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|229494_230034_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|230103_230334_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|230438_231128_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|231723_231930_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|232005_232302_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|232307_233093_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|233089_233770_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|233766_233949_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|233921_234113_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|234123_234405_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|234503_234725_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|234724_235051_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|235034_235274_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|235413_235650_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|235639_236782_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|236895_238146_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|238317_238971_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|238980_239442_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|239495_240602_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
242271:242285	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 3
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	532522	619808	5196956	terminase,plate,portal,tRNA,lysis,transposase,head,tail,integrase,holin,capsid	Burkholderia_virus(25.35%)	104	550745:550761	613275:613291
WP_001295930.1|532522_533308_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|533443_534223_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|534199_535093_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|535246_535993_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|535989_536172_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|536223_537456_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|537492_538479_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|538475_540224_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|540260_542525_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|542730_543015_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|543174_544848_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|544958_545642_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|545814_546597_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001281701.1|546740_547130_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|547101_547551_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|547552_547759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|547748_547979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|547975_548659_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|548655_548871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|548885_549182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|549191_549464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|549752_550283_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|550310_550580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|550582_551749_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
550745:550761	attL	CACTGCACCGGCGTCCA	NA	NA	NA	NA
WP_000186588.1|551759_553529_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|553544_553862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|553861_554782_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|554792_555101_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|555153_555342_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|555435_555792_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|555908_556673_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|556863_557079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|557077_557482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|557457_558186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|558316_558667_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|558669_559410_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|559393_560044_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|560040_560367_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|560366_560678_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|560677_561223_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000167500.1|561219_562815_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_000090684.1|562814_564311_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|564291_565113_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|565115_565574_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|565788_566904_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|566918_567872_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|567881_568220_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|568221_568668_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|568667_569132_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|569128_569383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|569372_570800_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|570799_571321_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|571323_571605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|571702_572038_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|571961_572120_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|572195_575147_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|575146_576031_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|576027_576243_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|576230_577385_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|577381_577978_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|578032_578380_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|578370_579474_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|579466_580045_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_074162941.1|580047_581328_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	44.1	2.7e-40
WP_000072165.1|581334_581949_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_001486917.1|581948_582431_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
WP_064767240.1|582471_582912_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|582971_583544_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|583799_585083_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|585153_586242_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|586440_587133_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|587262_589023_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|589428_590286_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|590340_592623_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|592942_593161_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001576679.1|593242_594406_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	5.9e-204
WP_000978911.1|594405_594885_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000785970.1|597338_597458_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|597490_597766_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|597822_598341_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001576673.1|598353_599544_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	3.1e-224
WP_001576672.1|599855_600332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576671.1|600772_601150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|602203_602950_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|602964_604506_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001576667.1|604765_607390_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	95.7	0.0e+00
WP_001576666.1|607400_607931_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	2.3e-102
WP_001121498.1|607923_608832_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	1.7e-161
WP_000127163.1|608836_609184_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001576664.1|609180_609816_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	1.2e-113
WP_001001786.1|609882_610335_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917151.1|610327_610795_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001576659.1|610902_611328_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	93.6	1.5e-64
WP_001576658.1|611315_611741_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.0e-57
WP_001576656.1|611755_612253_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000123124.1|612252_612534_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|612537_612741_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|612740_613250_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001576654.1|613349_614093_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	1.6e-125
613275:613291	attR	TGGACGCCGGTGCAGTG	NA	NA	NA	NA
WP_001576652.1|614096_615170_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001085955.1|615228_616083_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.2	5.2e-133
WP_000156861.1|616256_618029_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001576650.1|618028_619063_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	98.8	7.9e-200
WP_001576649.1|619388_619808_-	hypothetical protein	NA	Q6K1E9	Salmonella_virus	76.3	5.7e-56
>prophage 4
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	623124	683865	5196956	head,plate,tRNA,tail,transposase,terminase,portal,integrase,holin,capsid	Enterobacteria_phage(71.19%)	72	636203:636222	676210:676229
WP_001576643.1|623124_625404_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_001576641.1|625393_625669_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.9e-44
WP_001576640.1|625665_625890_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	1.5e-34
WP_001576638.1|625889_626192_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	1.6e-44
WP_001576637.1|626191_626416_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	5.2e-32
WP_000217677.1|626479_626980_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001576635.1|627157_627514_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	98.3	2.0e-62
WP_000072552.1|627618_627930_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023390.1|628023_629019_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|629050_629848_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000109283.1|629944_631093_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|631406_632033_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|632068_632932_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|632933_633551_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|633561_636006_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
636203:636222	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023737.1|636305_637298_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|637367_637709_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|637813_638335_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|638339_638762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|638768_638960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|639097_639448_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_000159455.1|639458_639737_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514277.1|639748_639991_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|639987_640101_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|640194_640605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|640628_640832_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|640828_641095_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|641091_641391_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000013455.1|641713_641944_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
WP_000599382.1|642016_642382_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000123489.1|642388_645211_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000686485.1|645287_646247_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|646251_646566_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|646649_647492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|647531_648029_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_001300563.1|648236_649349_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000236495.1|650102_650627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|650641_651688_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|651687_653439_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262655.1|653593_654430_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055083.1|654453_655506_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|655551_656352_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_000063100.1|656453_656948_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|656947_657148_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|657150_657474_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|657470_657863_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|657859_658255_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000202148.1|658393_660271_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000921127.1|660294_660762_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|660754_661390_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|661386_661968_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|661964_662315_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|662318_663215_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|663207_663738_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_032140708.1|663740_665963_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_001554335.1|665964_666492_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|666520_667054_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_032142265.1|667056_667614_-	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000905061.1|667832_668432_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|668460_668949_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|668961_671769_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|671755_671911_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|671919_672294_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|672349_672862_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|672861_674046_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|674203_675313_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|675353_675614_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|675805_675946_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|676251_677544_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
676210:676229	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000067797.1|677634_678978_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|678988_679600_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|679758_683865_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
>prophage 6
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	1642898	1736506	5196956	protease,portal,tRNA,lysis,transposase,terminase,tail,integrase	Enterobacteria_phage(39.34%)	99	1693590:1693605	1740117:1740132
WP_001300563.1|1642898_1644011_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118464.1|1644273_1645404_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|1645492_1647409_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843689.1|1647779_1648184_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102393.1|1648209_1648923_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528533.1|1649071_1649638_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094685.1|1649672_1650260_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130187.1|1650374_1651328_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001112568.1|1651606_1653037_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906193.1|1653106_1653883_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000738712.1|1653922_1654219_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781072.1|1654432_1655719_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241659.1|1655719_1656652_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264707.1|1656653_1659116_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|1659197_1659263_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223200.1|1659476_1660163_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001295754.1|1660562_1660703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|1660798_1661515_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920358.1|1661574_1662927_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219582.1|1662984_1664409_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
WP_001188689.1|1664408_1665098_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|1665110_1665584_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|1665794_1666664_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942350.1|1666660_1667308_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001531361.1|1667359_1667887_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068677.1|1667965_1668292_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409419.1|1668381_1670319_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|1670525_1672193_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000093834.1|1672313_1673546_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001295751.1|1673566_1674949_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132966.1|1674997_1675966_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124608.1|1676071_1676716_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105853.1|1676743_1677760_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_001293116.1|1677760_1679092_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000224879.1|1679258_1679978_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816460.1|1680034_1681258_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477800.1|1681309_1682632_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
WP_001295412.1|1682709_1683489_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143221.1|1683746_1685297_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088370.1|1685268_1686132_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563043.1|1686366_1687146_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001298490.1|1687142_1688216_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|1688337_1688499_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001531357.1|1688625_1689231_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|1689623_1691210_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217535.1|1691429_1691678_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	3.5e-37
WP_000389073.1|1692124_1693159_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	41.8	7.1e-76
WP_000954672.1|1693257_1694016_+	hypothetical protein	NA	NA	NA	NA	NA
1693590:1693605	attL	TGATAATGAATTTGAA	NA	NA	NA	NA
WP_001555785.1|1694319_1694613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555784.1|1694655_1695696_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	2.4e-124
WP_000654148.1|1695705_1695987_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	2.4e-18
WP_021548541.1|1695986_1698359_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	70.4	1.8e-170
WP_021548540.1|1698419_1701833_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_011478365.1|1701893_1702541_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
WP_032142951.1|1702438_1703182_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.5e-149
WP_001152386.1|1703186_1703885_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.0e-134
WP_000447253.1|1703894_1704224_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372035.1|1704223_1707280_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	99.5	0.0e+00
WP_001161009.1|1707251_1707581_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|1707589_1707976_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211119.1|1708036_1708780_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	1.4e-129
WP_001079398.1|1708790_1709192_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677123.1|1709188_1709779_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	1.6e-80
WP_001283153.1|1709790_1710066_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|1710058_1710382_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001360054.1|1710468_1712496_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_011478361.1|1712440_1714021_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|1713948_1714161_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934133.1|1714157_1716260_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349501.1|1716259_1716751_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	6.6e-72
WP_001139675.1|1717426_1717579_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|1717566_1718034_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|1718030_1718528_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|1718527_1718743_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799705.1|1718810_1719863_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	6.1e-208
WP_000917723.1|1720013_1720217_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_001033965.1|1720487_1720934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577385.1|1721018_1721384_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
WP_001577384.1|1721401_1722391_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001061386.1|1722398_1723196_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	8.3e-149
WP_000767115.1|1723215_1723605_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210170.1|1723601_1723928_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|1723924_1724578_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_011478357.1|1724577_1725072_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	2.6e-84
WP_000061519.1|1725068_1725887_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000620696.1|1725883_1726108_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_099996242.1|1726104_1727256_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	99.0	4.8e-214
WP_000526665.1|1727252_1727804_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001191669.1|1727796_1728057_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001311077.1|1728154_1728847_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135682.1|1729569_1729932_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081290.1|1729997_1730822_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000008232.1|1730949_1731486_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_001242727.1|1731476_1731839_+	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.7e-64
WP_000206713.1|1731838_1732195_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	74.1	7.7e-38
WP_001229296.1|1732196_1732562_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000628710.1|1732558_1733353_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	49.8	2.7e-59
WP_000653746.1|1733920_1734916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218287.1|1735291_1736506_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
1740117:1740132	attR	TTCAAATTCATTATCA	NA	NA	NA	NA
>prophage 7
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	3364143	3417143	5196956	protease,integrase,transposase	Stx2-converting_phage(25.0%)	36	3415129:3415143	3423721:3423735
WP_000997995.1|3364143_3365682_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|3366809_3367160_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|3367156_3367582_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|3367953_3368091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|3368242_3369160_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|3369193_3370069_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|3370117_3371590_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|3371593_3372424_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|3372469_3373180_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|3373192_3374302_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|3374363_3375287_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|3375322_3376057_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|3376156_3377143_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|3377294_3378522_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|3379022_3381113_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|3381944_3382217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|3382507_3382867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|3382870_3383086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|3387866_3389018_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|3389614_3393502_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_000973516.1|3394445_3396647_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|3396728_3398006_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|3398002_3399745_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|3399744_3400692_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|3400692_3402417_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|3402552_3403746_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|3404463_3404892_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|3404931_3405492_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|3405533_3405794_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|3407627_3407741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156432.1|3407831_3408957_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_023146305.1|3408926_3409142_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_000006213.1|3409608_3409842_-	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_001774069.1|3412333_3412885_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000147017.1|3414578_3415622_-	hypothetical protein	NA	NA	NA	NA	NA
3415129:3415143	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218869.1|3415877_3417143_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|3415877_3417143_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
3423721:3423735	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 8
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	3739465	3819090	5196956	head,plate,tRNA,lysis,tail,terminase,portal,integrase,capsid	Salmonella_phage(66.67%)	93	3774968:3775017	3807815:3807864
WP_000047157.1|3739465_3742096_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000906486.1|3742330_3742516_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|3743704_3744271_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287462.1|3744267_3744696_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|3744768_3746325_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130208.1|3746474_3746990_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000638136.1|3747040_3748153_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001097132.1|3748149_3748857_-	RNA ligase family protein	NA	NA	NA	NA	NA
WP_001296316.1|3749114_3750653_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|3750669_3751842_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378443.1|3751968_3752499_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119749.1|3752589_3752925_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|3752914_3753652_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000165701.1|3753775_3754960_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216534.1|3755151_3756144_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774966.1|3756200_3757265_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985509.1|3757257_3758460_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777934.1|3758815_3759775_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
WP_000246582.1|3759784_3761929_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.9e-196
WP_000080947.1|3761901_3762312_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|3762308_3762554_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|3762800_3763130_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|3763281_3763626_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|3763662_3764112_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115381.1|3764779_3765184_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229463.1|3765230_3765755_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137288.1|3765764_3766064_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|3766246_3766405_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|3766488_3766938_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156817.1|3766938_3767601_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001296312.1|3767621_3769022_-	GABA permease	NA	NA	NA	NA	NA
WP_000625041.1|3769258_3770539_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
WP_000772888.1|3770552_3772001_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271888.1|3772026_3773292_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993107.1|3773311_3774289_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
3774968:3775017	attL	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001547641.1|3775134_3776160_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	1.4e-193
WP_023352525.1|3776161_3776794_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	6.9e-106
WP_000063849.1|3776913_3777162_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	71.6	3.4e-24
WP_023135813.1|3777194_3777704_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.9	7.8e-84
WP_000956182.1|3777711_3777912_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|3777875_3778217_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244228.1|3778284_3778518_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752619.1|3778517_3778745_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_029364117.1|3778741_3779599_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.2e-161
WP_099996227.1|3779595_3782010_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154431.1|3782162_3782351_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001555842.1|3782361_3782595_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	4.0e-35
WP_001399243.1|3782897_3784331_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_073980331.1|3784365_3785406_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.8	7.5e-174
WP_001717244.1|3785402_3786128_-|terminase	terminase-like family protein	terminase	A4JWU9	Burkholderia_virus	32.6	3.2e-22
WP_073980332.1|3786127_3787894_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_000216237.1|3788036_3788870_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742511.1|3788886_3789945_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|3789948_3790599_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|3790694_3791159_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|3791158_3791362_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|3791365_3791581_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|3791600_3792074_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_077896521.1|3792075_3792453_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	37.6	2.6e-15
WP_073980334.1|3792449_3792878_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	2.4e-46
WP_001039944.1|3792973_3793405_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_000829122.1|3793397_3793844_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
WP_000993775.1|3793912_3794491_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|3794487_3794847_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268280.1|3794833_3795742_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086824.1|3795734_3796340_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_099997881.1|3796336_3797737_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.1	1.7e-152
WP_021546685.1|3797763_3798204_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
WP_047649528.1|3798175_3798778_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.4	4.3e-97
WP_047649542.1|3798777_3799281_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	54.9	8.1e-41
WP_001463281.1|3799353_3799920_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_000046146.1|3800062_3801235_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|3801244_3801760_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281016.1|3801814_3802117_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763311.1|3802131_3802251_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_099996229.1|3802243_3805321_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
WP_000980413.1|3805317_3805803_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011796.1|3805799_3806900_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980501.1|3806968_3807187_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_048231062.1|3807213_3807696_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.7	6.0e-17
WP_000162574.1|3808396_3808879_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3807815:3807864	attR	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600193.1|3809010_3809487_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|3809476_3809767_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3809828_3810170_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880939.1|3810318_3811980_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|3812065_3812944_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|3813066_3813660_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|3813713_3815000_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001314062.1|3815020_3815812_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3815978_3817340_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3817476_3817725_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3817743_3818292_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264790.1|3818322_3819090_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	4315773	4325218	5196956		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|4315773_4316700_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783109.1|4316704_4317436_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4317416_4317524_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|4317583_4318315_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|4318536_4320222_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4320218_4320938_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4320984_4321455_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|4321495_4321957_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|4322081_4324085_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|4324081_4325218_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 10
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	4419394	4425697	5196956		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|4419394_4420789_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|4420963_4421857_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|4422229_4423315_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|4423314_4424214_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|4424271_4425150_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|4425154_4425697_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 11
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	4456500	4462952	5196956	transposase	Pseudomonas_phage(16.67%)	9	NA	NA
WP_000086752.1|4456500_4457145_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|4457163_4457385_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|4457447_4457924_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|4457939_4458413_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|4458506_4458752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|4458751_4459570_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|4459790_4460201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|4460649_4461396_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|4461410_4462952_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 12
NZ_CP024717	Escherichia coli strain LS4 chromosome, complete genome	5196956	4604552	4692798	5196956	plate,tRNA,tail,transposase,terminase,portal,integrase,holin,capsid	Escherichia_phage(22.73%)	103	4604367:4604426	4646979:4647103
4604367:4604426	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|4604552_4605569_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|4605537_4605801_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|4606010_4606193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|4606192_4606762_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|4606758_4608975_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|4609005_4609326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|4610336_4610750_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|4610848_4611079_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|4611137_4611614_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|4611653_4611878_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|4611874_4612630_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|4612619_4614035_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|4614073_4614484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|4614485_4614722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|4614718_4615030_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|4615026_4615251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|4615932_4616721_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|4616895_4617819_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|4619007_4619706_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|4620168_4620774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|4620783_4621272_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|4621670_4621904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|4622147_4622789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|4622940_4623120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|4623197_4623794_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|4623790_4624084_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|4624083_4624755_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|4624867_4625251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|4625250_4625523_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|4625522_4626002_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|4626009_4626204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|4626263_4626509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|4626877_4627444_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|4627430_4629293_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|4629292_4629526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|4629522_4631097_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|4631096_4632404_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|4632403_4632733_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|4632791_4633826_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|4633860_4634280_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|4634276_4634657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|4634688_4635369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|4635365_4635902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|4635882_4636785_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|4636787_4637129_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|4637125_4638046_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|4638048_4638675_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|4638667_4639852_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|4639851_4640241_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|4640237_4641740_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|4641757_4642270_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|4642282_4642564_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|4642672_4644313_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|4644348_4644738_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|4644899_4645124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|4646338_4646758_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|4647229_4647895_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
4646979:4647103	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|4647945_4649157_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|4649347_4649587_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|4649624_4650122_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|4650293_4650617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|4650880_4650967_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|4651081_4651333_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|4651410_4651914_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|4652708_4653698_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001187827.1|4653767_4655282_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|4655296_4656283_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|4656449_4657250_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|4657224_4658649_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|4658655_4659084_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|4659863_4660214_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|4660216_4660795_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|4660921_4661809_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|4661805_4662732_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|4662736_4664701_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|4664721_4665225_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|4665369_4667031_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|4667321_4668182_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_059329493.1|4668184_4669234_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	4.6e-06
WP_000763867.1|4669248_4669638_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|4669648_4670293_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|4670481_4671630_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|4671622_4673701_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|4673700_4674093_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|4674145_4675879_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|4676094_4676661_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|4676674_4677421_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|4677808_4678909_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|4678933_4681363_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_000564759.1|4681398_4682370_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|4682366_4683110_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|4683150_4683546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|4683598_4684417_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|4684413_4684980_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|4685289_4687062_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|4687054_4687507_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|4687535_4688276_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|4688310_4688832_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|4688833_4689436_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|4689506_4689572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4689710_4690322_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|4690330_4691341_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|4691450_4692798_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 1
NZ_CP024718	Escherichia coli strain LS4 plasmid p1LS4, complete sequence	111779	287	69028	111779	integrase,transposase	Macacine_betaherpesvirus(19.23%)	65	51101:51116	74161:74176
WP_000086185.1|287_971_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001309734.1|1530_1965_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|1961_2312_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|2342_3956_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_099996264.1|3982_4807_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|5673_6645_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|6644_7811_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|8398_9154_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|9927_10734_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|10734_11040_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|11041_11260_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000151784.1|11805_12318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545986.1|12351_13485_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000905949.1|13651_14425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528932.1|14437_14938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261278.1|15202_15433_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000361611.1|18140_19118_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066953.1|19402_20143_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_023141670.1|20263_20389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|21588_22758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|22953_23247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|23352_23628_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|23627_23912_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|24516_25269_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|25314_26280_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|26312_26693_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001077068.1|26717_27608_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001403365.1|28591_29458_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|29447_30335_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|30345_31170_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|31175_32249_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|32241_33552_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067834.1|35471_36176_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000874189.1|36885_37371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|37395_37881_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|37867_38563_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|38567_39698_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|39687_40971_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|40973_42353_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|42456_42984_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|43024_44911_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|45257_46073_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001067855.1|46298_47003_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
51101:51116	attL	GGGATGCGCAGTTCGT	NA	NA	NA	NA
WP_000205725.1|51691_52438_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
WP_000704528.1|52496_53357_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.8	6.7e-11
WP_000139321.1|53459_54020_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001309245.1|54148_54361_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233838.1|54605_55067_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001298565.1|55112_55322_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766805.1|55359_55950_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083819.1|56189_56450_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|56674_56749_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130647.1|56741_57599_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000027057.1|58624_59485_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|59667_60225_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|60651_61356_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000978817.1|62820_63282_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	3.6e-19
WP_001067855.1|63475_64180_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553864.1|64070_64400_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	55.6	6.9e-09
WP_000454193.1|64525_64876_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|65078_66092_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|66249_66723_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|66853_67642_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|67847_68195_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|68188_69028_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
74161:74176	attR	GGGATGCGCAGTTCGT	NA	NA	NA	NA
