The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024727	Prevotella intermedia strain KCOM 1949 chromosome 1, complete sequence	2011558	466126	514303	2011558	integrase,transposase	unidentified_phage(28.57%)	38	458065:458079	521299:521313
458065:458079	attL	GGAGGGGCTGTTCAA	NA	NA	NA	NA
WP_015546386.1|466126_467356_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.6	4.9e-23
WP_100013713.1|467381_468584_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_006951737.1|468590_468953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100013714.1|469032_470184_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	28.4	9.0e-11
WP_100013715.1|470343_472041_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	8.5e-42
WP_100013716.1|472044_473790_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	6.3e-40
WP_023925022.1|473991_476367_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006951753.1|476385_477567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004371346.1|477707_478688_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004371347.1|478779_479013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004371348.1|479035_479362_+	RteC domain-containing protein	NA	NA	NA	NA	NA
WP_004371349.1|479449_479866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021663299.1|480575_481004_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_100014537.1|481636_482887_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_046824816.1|482901_483762_+	DUF4007 family protein	NA	NA	NA	NA	NA
WP_100013719.1|483748_486898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021663293.1|486894_488004_+	hypothetical protein	NA	M4Q4R0	Dunaliella_viridis_virus	34.7	3.6e-09
WP_157764997.1|488179_488344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046824815.1|488346_489600_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_100013721.1|489602_491873_+	DEAD/DEAH box helicase family protein	NA	A0A2H4UTW8	Bodo_saltans_virus	24.5	1.3e-08
WP_021663289.1|491879_492113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100013722.1|492109_494284_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_021663287.1|494290_494866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100013723.1|495354_496575_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_100013724.1|496631_497861_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	37.5	3.3e-27
WP_100013725.1|498375_499530_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_014709132.1|499631_500171_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_061868429.1|500302_501247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100013726.1|501289_502420_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_014709129.1|502449_502869_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_100013727.1|502865_504176_-	DUF2851 family protein	NA	NA	NA	NA	NA
WP_172952353.1|504700_505912_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_100013729.1|506263_507019_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_061868419.1|507068_508607_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_100013730.1|508712_509342_+	WbqC family protein	NA	NA	NA	NA	NA
WP_100013731.1|509449_510055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172952330.1|510396_511974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100013733.1|512815_514303_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
521299:521313	attR	GGAGGGGCTGTTCAA	NA	NA	NA	NA
>prophage 2
NZ_CP024727	Prevotella intermedia strain KCOM 1949 chromosome 1, complete sequence	2011558	821926	897999	2011558	integrase,protease,tRNA,transposase	Bacillus_phage(15.38%)	50	895609:895641	899093:899125
WP_100013879.1|821926_823327_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_100013880.1|823380_824535_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_096406353.1|824544_825066_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_100013881.1|825078_826392_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_096406363.1|826396_826999_-	DUF4290 domain-containing protein	NA	NA	NA	NA	NA
WP_028906343.1|827052_827745_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_100013882.1|828363_829152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100013883.1|829452_830223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100013884.1|830371_832222_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_100013885.1|832231_834145_-	type I pullulanase	NA	NA	NA	NA	NA
WP_100013886.1|834204_836406_-	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_100013887.1|836481_839175_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_100013888.1|839840_841061_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100013889.1|841236_842118_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_100013890.1|842129_843284_-	MFS transporter	NA	NA	NA	NA	NA
WP_100013891.1|843301_845200_-	GH32 C-terminal domain-containing protein	NA	S6ATV4	Bacillus_phage	32.1	3.8e-59
WP_100013892.1|845226_847542_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_100013893.1|847878_850527_+	substrate-binding domain-containing protein	NA	Q6XM27	Feldmannia_irregularis_virus	24.2	1.7e-12
WP_097646886.1|851282_852164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097646885.1|852294_852741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097646884.1|852937_853441_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_100013894.1|853437_854169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100013895.1|854165_855080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028906361.1|855167_855536_+	DNA topoisomerase II	NA	NA	NA	NA	NA
WP_100013897.1|861611_863297_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.1	2.5e-38
WP_100013899.1|863605_864508_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100013900.1|864817_865420_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_100013901.1|865617_867927_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.8	1.2e-11
WP_100013902.1|867960_869082_-	lytic transglycosylase domain-containing protein	NA	I6ZXX9	Escherichia_phage	33.6	2.1e-09
WP_100013903.1|869122_869896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100013904.1|869919_870828_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	36.6	5.2e-14
WP_024998705.1|870869_871637_-	ParA family protein	NA	Q8JL10	Natrialba_phage	38.3	8.0e-24
WP_100013905.1|871747_872518_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	32.5	1.3e-29
WP_100013906.1|872569_873712_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_100013831.1|874117_874963_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100013907.1|875299_875935_-	DedA family protein	NA	NA	NA	NA	NA
WP_100013908.1|875970_877428_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_172419443.1|877503_878196_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_100013909.1|878222_879773_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.7	7.0e-43
WP_100013910.1|880451_883289_+	DNA gyrase/topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	29.5	1.2e-40
WP_100013911.1|883296_884115_+	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_100013912.1|884114_885134_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_100013913.1|885742_887410_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_100013914.1|887673_889116_+	trigger factor	NA	NA	NA	NA	NA
WP_014708844.1|889950_890616_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	46.6	2.8e-41
WP_100013915.1|890619_891852_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	52.0	3.2e-115
WP_096406490.1|891946_894130_+	DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	38.9	7.2e-86
WP_100013916.1|894771_895602_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
895609:895641	attL	TCTTATCCAAAGTAAAATGTTATCCAAAGTAAG	NA	NA	NA	NA
WP_044249289.1|895760_896999_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099976809.1|896991_897999_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
899093:899125	attR	CTTACTTTGGATAACATTTTACTTTGGATAAGA	NA	NA	NA	NA
>prophage 3
NZ_CP024727	Prevotella intermedia strain KCOM 1949 chromosome 1, complete sequence	2011558	949957	1028469	2011558	integrase,protease,tRNA,transposase	unidentified_phage(25.0%)	60	994073:994088	1025645:1025660
WP_100013949.1|949957_951202_-|integrase	site-specific integrase	integrase	A0A218M9P0	Mycobacterium_phage	26.0	4.2e-06
WP_100013950.1|951214_952444_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	37.5	5.6e-27
WP_100013951.1|952948_953893_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_014708810.1|953949_954510_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_100013952.1|954586_955063_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_100013953.1|955078_955879_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_099995178.1|955956_956970_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_100013954.1|957020_958475_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_100013955.1|958725_959652_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_100013956.1|959859_961740_+	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_014708801.1|962536_962896_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_100013957.1|962947_965014_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	43.7	4.6e-98
WP_099976770.1|965020_965884_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_100013958.1|966321_968673_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	5.2e-05
WP_100013959.1|969125_969938_+	peptidase	NA	NA	NA	NA	NA
WP_100013960.1|970092_970971_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_100013961.1|971657_972083_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_100013962.1|972157_975382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100013963.1|975378_977850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100013964.1|977860_978415_-	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_100013965.1|978411_979344_-	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_100013966.1|980211_981312_+	histidine kinase	NA	NA	NA	NA	NA
WP_099976761.1|981325_982057_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_028904911.1|982204_982600_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_100014558.1|983041_984055_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_100013967.1|984230_986351_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_100013968.1|986355_987033_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.1e-32
WP_100013969.1|987056_987914_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100013970.1|988391_991349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100013971.1|991720_992986_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_100013973.1|993714_994644_-	ADP-ribosylglycohydrolase family protein	NA	A0A1X6WFT7	Pacmanvirus	32.6	5.9e-37
994073:994088	attL	GAAAGTTGCTCATTAT	NA	NA	NA	NA
WP_172952338.1|994813_996229_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_100013974.1|996307_997267_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044048027.1|997276_998164_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_097646612.1|998198_998858_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_100013975.1|998860_999514_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014710470.1|999545_1000385_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_028904898.1|1000864_1002073_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.2	8.0e-103
WP_100014559.1|1002150_1004064_-	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_028904896.1|1004458_1004827_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045166723.1|1005072_1005525_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_099995159.1|1006029_1006581_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_100013976.1|1006698_1007604_-	DMT family transporter	NA	NA	NA	NA	NA
WP_100013977.1|1007781_1008564_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_100013978.1|1008707_1009991_+	MFS transporter	NA	NA	NA	NA	NA
WP_100013979.1|1010006_1010990_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	31.4	1.9e-25
WP_100013980.1|1011768_1012362_+	IMP cyclohydrolase	NA	Q58MG3	Prochlorococcus_phage	40.3	3.1e-31
WP_024998806.1|1012478_1013501_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_045166716.1|1013585_1014467_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_014710455.1|1014555_1015059_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_100013981.1|1015055_1017179_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_014710453.1|1017228_1018704_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_100013982.1|1019262_1020717_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	30.9	8.7e-11
WP_014710451.1|1021113_1021698_-	LemA family protein	NA	NA	NA	NA	NA
WP_100013983.1|1021739_1022519_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_100014560.1|1023049_1024279_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	33.8	5.8e-24
WP_100013984.1|1024284_1025451_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.2	1.4e-16
WP_040580766.1|1025593_1026337_-	hypothetical protein	NA	NA	NA	NA	NA
1025645:1025660	attR	ATAATGAGCAACTTTC	NA	NA	NA	NA
WP_100013985.1|1026424_1026979_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_099890983.1|1027167_1028469_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP024727	Prevotella intermedia strain KCOM 1949 chromosome 1, complete sequence	2011558	1683320	1719531	2011558	integrase,transposase	unidentified_phage(28.57%)	33	1717709:1717723	1721256:1721270
WP_100014345.1|1683320_1684232_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_100013832.1|1684357_1685203_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100014293.1|1685594_1686494_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_100014346.1|1686687_1687500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100014347.1|1687674_1688949_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.5	9.4e-86
WP_099977215.1|1688954_1689911_+	D-2-hydroxyacid dehydrogenase	NA	A0A1M7XU89	Cedratvirus	31.3	1.4e-33
WP_100014348.1|1689941_1690577_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_100013831.1|1691311_1692157_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014709902.1|1692549_1693926_-	tryptophanase	NA	NA	NA	NA	NA
WP_100014350.1|1694210_1695593_-	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_045168034.1|1695759_1696155_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_100014351.1|1696145_1696811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014352.1|1696820_1698794_+	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	38.3	1.7e-118
WP_100014354.1|1699375_1700278_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_028904992.1|1700494_1701847_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_100014355.1|1701887_1702772_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.3	1.3e-30
WP_028904994.1|1702857_1703037_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_076123288.1|1703050_1703284_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_096405164.1|1703287_1704373_+	3-methyl-2-oxobutanoate dehydrogenase subunit VorB	NA	NA	NA	NA	NA
WP_061868952.1|1704393_1705164_+	2-oxoglutarate oxidoreductase	NA	NA	NA	NA	NA
WP_088437745.1|1705186_1705735_+	2-oxoacid:acceptor oxidoreductase family protein	NA	NA	NA	NA	NA
WP_099836460.1|1705997_1707098_+	OmpA family protein	NA	NA	NA	NA	NA
WP_172952344.1|1707613_1708381_+	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_100014357.1|1708584_1710600_+	transketolase	NA	NA	NA	NA	NA
WP_014709884.1|1710657_1711095_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	A0A222YX14	Synechococcus_phage	29.8	2.2e-18
WP_100014358.1|1711231_1712671_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_100014359.1|1712687_1712969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100014360.1|1712973_1713759_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_100014362.1|1714399_1715383_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_100014363.1|1715366_1715969_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_099891526.1|1716303_1716594_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_100014364.1|1717037_1718258_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.8	4.9e-23
1717709:1717723	attL	CATTACGCAGGAAGA	NA	NA	NA	NA
WP_100014365.1|1718262_1719531_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.8	1.0e-23
WP_100014365.1|1718262_1719531_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.8	1.0e-23
1721256:1721270	attR	CATTACGCAGGAAGA	NA	NA	NA	NA
>prophage 1
NZ_CP024728	Prevotella intermedia strain KCOM 1949 chromosome 2, complete sequence	753182	594686	640527	753182	transposase,protease	Bacillus_phage(40.0%)	40	NA	NA
WP_097647326.1|594686_595586_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_044047448.1|596553_596952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014913.1|597172_599029_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_045168229.1|599046_599889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014914.1|599878_601519_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_099891194.1|601542_601908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099891192.1|601972_602446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014915.1|602479_603523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014916.1|603535_603967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014917.1|604129_604681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014918.1|604690_605179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014919.1|605250_605898_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_157765017.1|606644_606797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014921.1|606883_607573_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_099891184.1|607569_607896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014922.1|608062_608521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045168226.1|608543_609017_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_045168225.1|609180_609621_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_080889514.1|610729_611221_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_045168223.1|611222_611639_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_096409094.1|612051_612792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157765986.1|612754_613126_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_096409479.1|613166_613760_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_100014925.1|614557_615370_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	27.5	4.8e-11
WP_100013832.1|615498_616344_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100014926.1|616607_617720_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	21.9	2.9e-06
WP_100014927.1|618105_619761_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	43.1	9.8e-51
WP_100014928.1|619854_620091_+|protease	protease inhibitor I9 family protein	protease	NA	NA	NA	NA
WP_100014929.1|620325_621978_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	40.7	1.1e-46
WP_100014930.1|622399_622759_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100014931.1|622983_623634_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_100014932.1|623640_624099_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_100014933.1|626351_629513_-	DUF4981 domain-containing protein	NA	B9U1H7	Vaccinia_virus	32.2	1.8e-125
WP_100014934.1|636663_637149_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_172952367.1|637232_637388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097550179.1|637705_637972_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006948333.1|637995_638304_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100014935.1|638306_638933_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_100014936.1|639139_639520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014937.1|639627_640527_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP024728	Prevotella intermedia strain KCOM 1949 chromosome 2, complete sequence	753182	655158	713455	753182	transposase,integrase	unidentified_phage(28.57%)	47	654669:654684	719538:719553
654669:654684	attL	AATATGCGTTGGTTTT	NA	NA	NA	NA
WP_100014945.1|655158_656478_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.9	1.5e-17
WP_100014946.1|656491_657745_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.3	2.6e-27
WP_100014947.1|662640_664743_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	30.7	1.1e-38
WP_100014948.1|664763_666173_-	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_100014949.1|666958_668485_-	phytoene desaturase	NA	NA	NA	NA	NA
WP_100014950.1|668433_669171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100014951.1|669181_670279_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_100014952.1|670275_670896_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_100014953.1|670900_671545_-	carotenoid biosynthesis protein	NA	NA	NA	NA	NA
WP_100014954.1|671549_672077_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_100014955.1|672080_672938_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_088439803.1|673595_674576_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_100014956.1|674690_675431_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	24.2	3.8e-15
WP_100014957.1|675435_676461_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.3	1.6e-14
WP_014709370.1|676536_677505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088439509.1|677535_677967_-|integrase	integrase catalytic domain-containing protein	integrase	A0A1W6JNC2	Staphylococcus_phage	32.8	9.1e-09
WP_018921191.1|678098_678458_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100014958.1|678635_679478_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_100014959.1|680649_681042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014960.1|682170_682869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100014961.1|682869_684102_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_099890983.1|684316_685618_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_157765022.1|685941_687309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014963.1|687339_689034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014964.1|689098_690502_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_100015026.1|692568_693855_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_100014965.1|693993_695997_-	YWFCY domain-containing protein	NA	NA	NA	NA	NA
WP_100014966.1|696068_697349_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_100014967.1|697345_697726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100014968.1|698317_699121_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_100014969.1|699107_699581_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_100014970.1|699587_700064_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_100015027.1|700066_700873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014971.1|701015_701318_+	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_008566149.1|701322_701658_+	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
WP_100014972.1|701654_704168_+	TraG family conjugative transposon ATPase	NA	NA	NA	NA	NA
WP_100015028.1|704386_705001_+	DUF4141 domain-containing protein	NA	NA	NA	NA	NA
WP_100014973.1|705043_706081_+	conjugative transposon protein TraJ	NA	NA	NA	NA	NA
WP_009236098.1|706133_706757_+	conjugative transposon protein TraK	NA	NA	NA	NA	NA
WP_088401306.1|706761_707064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100014974.1|707056_708325_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_100014975.1|708373_709324_+	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_100014976.1|709317_709911_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_100014977.1|709923_710406_+	DUF3872 domain-containing protein	NA	NA	NA	NA	NA
WP_100014978.1|710392_710902_+	lysozyme	NA	A0A2I7S753	Vibrio_phage	33.6	5.9e-07
WP_100015029.1|711715_711949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100014979.1|712204_713455_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
719538:719553	attR	AATATGCGTTGGTTTT	NA	NA	NA	NA
