The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024698	Fusobacterium pseudoperiodonticum strain KCOM 1283 chromosome, complete genome	2222370	2134677	2141063	2222370		Synechococcus_phage(33.33%)	6	NA	NA
WP_099972079.1|2134677_2135151_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.3	4.5e-25
WP_005968313.1|2135200_2135914_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.8	2.5e-43
WP_099986116.1|2135960_2137310_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.3	4.4e-49
WP_099986117.1|2137357_2138377_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A127KMF9	Cyanophage	44.4	1.1e-65
WP_099972082.1|2138364_2139276_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.3	9.9e-21
WP_099986118.1|2139548_2141063_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	42.9	5.2e-59
>prophage 2
NZ_CP024698	Fusobacterium pseudoperiodonticum strain KCOM 1283 chromosome, complete genome	2222370	2145357	2194325	2222370	integrase,protease,tRNA,transposase	uncultured_virus(25.0%)	49	2178163:2178182	2199713:2199732
WP_099985928.1|2145357_2146533_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099959196.1|2146808_2147816_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099972089.1|2147872_2149084_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_099972090.1|2149088_2152016_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_147383787.1|2152281_2152704_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_099972091.1|2152931_2154077_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	60.8	7.1e-117
WP_147384665.1|2154269_2155844_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099972093.1|2155806_2156550_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.4e-20
WP_008793573.1|2156615_2157497_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099959201.1|2157635_2158091_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_099972094.1|2158210_2159368_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_099985940.1|2159542_2160829_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.6	3.2e-41
WP_099972095.1|2160966_2161935_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_099972096.1|2161950_2162322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099986123.1|2162314_2163199_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099986124.1|2163226_2163874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099986125.1|2163874_2165335_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_099986126.1|2165331_2165910_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_099986127.1|2165920_2166829_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_099972100.1|2166844_2167846_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_192868894.1|2167998_2168538_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_099986129.1|2168952_2169939_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	23.2	6.1e-08
WP_008793560.1|2169952_2170201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099986130.1|2170202_2171297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099986131.1|2171313_2172624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099986132.1|2172636_2172933_-	Dabb family protein	NA	NA	NA	NA	NA
WP_099986133.1|2172977_2173517_-	glutathione reductase	NA	NA	NA	NA	NA
WP_005914973.1|2173709_2173973_+	membrane protein	NA	NA	NA	NA	NA
WP_099986134.1|2174145_2175645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099986135.1|2175663_2177235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099972108.1|2177234_2178182_-	hypothetical protein	NA	NA	NA	NA	NA
2178163:2178182	attL	AATAATAAAAATTTTTTCAT	NA	NA	NA	NA
WP_099972109.1|2178284_2178749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099986136.1|2178940_2179618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099986137.1|2179892_2180393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099972122.1|2180467_2180938_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_099972123.1|2180956_2182759_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_099972124.1|2183022_2183673_+	viroplasmin family protein	NA	NA	NA	NA	NA
WP_099972125.1|2183685_2184387_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_005967877.1|2184537_2184810_+	co-chaperone GroES	NA	A0A221S4H9	uncultured_virus	43.8	1.5e-09
WP_099972126.1|2184825_2186445_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.3	9.9e-157
WP_099986138.1|2186456_2187917_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_099972128.1|2187957_2188533_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_099972129.1|2188545_2188995_-	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	34.9	6.8e-15
WP_099972130.1|2189067_2189796_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	1.9e-27
WP_099972131.1|2189805_2190810_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099972132.1|2190796_2191570_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099986139.1|2191729_2192650_-	amidinotransferase	NA	NA	NA	NA	NA
WP_008820429.1|2192676_2193570_-	GTPase Era	NA	NA	NA	NA	NA
WP_172952708.1|2193569_2194325_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2199713:2199732	attR	AATAATAAAAATTTTTTCAT	NA	NA	NA	NA
