The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	256757	307032	5072943	transposase,plate	Streptococcus_phage(22.22%)	44	NA	NA
WP_000224521.1|256757_258104_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013428.1|258106_258631_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433567.1|258627_259920_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896716.1|259924_260974_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863399.1|260937_262779_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001189667.1|262784_263210_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|263214_264699_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|264721_265225_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|265930_266449_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000053624.1|266669_268652_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	1.6e-23
WP_000571853.1|268758_269805_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528851.1|269797_271237_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|271211_271502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|272752_273256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|273349_273838_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|274108_274879_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|275032_275506_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973131.1|275548_277993_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|278232_278811_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001298195.1|279015_279783_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|279753_280494_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001298188.1|281514_283254_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207578.1|283198_283984_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|284054_285110_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|285161_285455_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|285457_285856_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|285865_286318_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001335538.1|286495_287647_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
WP_000602124.1|287643_288258_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|288314_289772_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291991.1|290032_290491_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189578.1|290582_291827_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|291884_292286_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749900.1|292324_293380_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_001285288.1|293668_294772_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|294783_296037_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001335540.1|296537_297134_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
WP_000258743.1|297220_298858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266639.1|299549_299777_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000120393.1|299882_300110_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335706.1|300358_301792_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282079.1|302761_303325_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_089644009.1|303532_305064_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
WP_001298025.1|306009_307032_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
>prophage 2
NZ_CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	599195	665620	5072943	tRNA,integrase,transposase,protease	Bacillus_phage(23.08%)	60	609149:609173	658705:658729
WP_099156434.1|599195_600543_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000970327.1|600631_601090_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|601086_602004_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001298568.1|602149_602827_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.2e-26
WP_001295323.1|602813_603593_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|603655_604510_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148959.1|604570_605380_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|605369_605993_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110567.1|605963_606650_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561914.1|606646_609061_+	ABC transporter permease	NA	NA	NA	NA	NA
609149:609173	attL	GGATAAGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
WP_001157944.1|609201_610296_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460119.1|610364_611291_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776372.1|611520_612003_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|612080_612896_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001298337.1|612985_614767_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
WP_000943566.1|614779_615556_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765829.1|615655_616534_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401115.1|616703_618158_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006873.1|618217_619579_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298336.1|619634_620936_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001298339.1|620957_622103_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	42.6	1.4e-48
WP_000540999.1|622231_623017_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001298347.1|623027_624263_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703882.1|624284_625334_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580878.1|625650_627318_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495383.1|627327_628587_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001298331.1|628597_629413_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855405.1|629409_630303_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815579.1|631968_633036_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001298348.1|633032_633542_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_001188438.1|633637_633967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000212245.1|634078_634801_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|634803_635298_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|635471_636857_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143502.1|636892_637414_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190287.1|637521_637734_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|637735_638602_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000025786.1|638642_638840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001334163.1|638956_639265_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	86.4	2.9e-41
WP_001335704.1|639284_639584_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	78.0	2.0e-31
WP_000239877.1|639996_640665_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201852.1|640896_641850_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001224590.1|642508_643399_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001298338.1|643399_646372_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383919.1|646358_648596_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000253854.1|648745_650188_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000770953.1|650177_650861_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074219.1|651017_652400_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709873.1|652423_652756_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717138.1|652771_653995_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573984.1|654006_657150_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.7e-59
WP_001295847.1|657251_658634_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153132.1|658791_660039_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
658705:658729	attR	GGATAAGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
WP_000351450.1|660146_660800_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360948.1|660878_661262_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682525.1|661326_661575_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130668.1|661640_662759_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956465.1|663203_663356_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001298346.1|663477_664098_-	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_099156434.1|664272_665620_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 3
NZ_CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	922245	929968	5072943	integrase	uncultured_Caudovirales_phage(50.0%)	10	916232:916246	928572:928586
916232:916246	attL	GCTCACGGGCCAGAT	NA	NA	NA	NA
WP_000188148.1|922245_924192_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|924264_924489_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085201.1|924893_926132_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
WP_001206970.1|926541_926751_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_000103622.1|926889_927069_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_021527564.1|927202_927400_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609226.1|927392_927704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543626.1|927696_927924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791981.1|927929_928217_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761778.1|928213_929968_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
928572:928586	attR	ATCTGGCCCGTGAGC	NA	NA	NA	NA
>prophage 4
NZ_CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	1183894	1228997	5072943	tRNA,integrase,portal,capsid,head,tail,terminase,lysis	Enterobacteria_phage(55.77%)	60	1176529:1176544	1236174:1236189
1176529:1176544	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_001298466.1|1183894_1185001_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1185054_1185516_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248675.1|1185525_1186179_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1186350_1187601_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741330.1|1187714_1188857_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.4	3.1e-205
WP_000088653.1|1188846_1189083_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|1189222_1189462_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|1189509_1189728_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001308571.1|1189826_1190108_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000548537.1|1190118_1190310_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682300.1|1190282_1190465_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|1190461_1191142_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|1191138_1191924_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995491.1|1191929_1192226_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233576.1|1192300_1192507_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1192982_1193360_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1193337_1194399_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_001337214.1|1194479_1195172_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|1195282_1195510_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182882.1|1195540_1196080_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_001546578.1|1196166_1197096_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	5.6e-112
WP_000788796.1|1197092_1197806_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
WP_000608370.1|1197884_1198313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182282.1|1198309_1198687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053041.1|1198954_1199410_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000224917.1|1199409_1199580_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
WP_000774485.1|1199572_1199863_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_001099712.1|1199859_1200222_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971056.1|1200218_1200359_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204776.1|1200444_1200828_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1201016_1202099_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1202687_1202903_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135283.1|1202902_1203400_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_001228695.1|1203616_1203799_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1203889_1204183_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1204663_1204990_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881607.1|1205196_1205379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1205942_1206491_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|1206462_1208391_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_023151962.1|1208374_1208581_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831760.1|1208577_1210170_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253894.1|1210159_1211665_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
WP_000256813.1|1211701_1212049_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522651.1|1212106_1213135_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|1213186_1213561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1213553_1213907_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_001007375.1|1213918_1214497_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
WP_000683149.1|1214493_1214889_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
WP_001577918.1|1214896_1215637_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479163.1|1215652_1216075_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_000459487.1|1216056_1216491_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
WP_023151960.1|1216483_1219045_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
WP_000847349.1|1219041_1219371_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
WP_016230622.1|1219370_1220069_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_044869897.1|1220073_1220817_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
WP_000090917.1|1220753_1221386_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_052991286.1|1221446_1224845_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_023152091.1|1224911_1225511_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.3e-111
WP_024179053.1|1225575_1228416_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
WP_023152094.1|1228415_1228997_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.6e-101
1236174:1236189	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 5
NZ_CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	2732834	2774295	5072943	terminase,integrase,tail,holin	Salmonella_phage(51.11%)	51	NA	NA
WP_000904982.1|2732834_2733389_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
WP_001115569.1|2733418_2733913_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	92.8	1.1e-79
WP_000805550.1|2733912_2734506_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	4.5e-59
WP_001106827.1|2734477_2734918_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_001096981.1|2734944_2735634_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.0	3.7e-28
WP_000049952.1|2735633_2736314_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	3.4e-103
WP_001197080.1|2736310_2737510_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.7e-185
WP_001270631.1|2737509_2737863_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_000301073.1|2737862_2738615_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.5e-86
WP_000718774.1|2739056_2739830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824896.1|2739925_2740258_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.5	1.1e-22
WP_000081732.1|2740257_2741322_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
WP_000155120.1|2741324_2741627_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	6.3e-49
WP_001298404.1|2741626_2742214_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000990889.1|2742213_2744199_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_000393960.1|2744376_2744829_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_000109249.1|2744832_2745273_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046934.1|2745283_2746429_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	5.2e-160
WP_001298391.1|2746432_2746996_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_001142475.1|2746970_2747360_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_000008727.1|2747346_2747901_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.7e-79
WP_001125664.1|2747897_2748305_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	4.3e-69
WP_000627477.1|2748533_2749475_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	3.2e-155
WP_001066729.1|2749486_2749993_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_000873175.1|2749996_2751217_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
WP_000113489.1|2751855_2753322_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_001130788.1|2753321_2754944_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000162795.1|2754946_2755519_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_000779565.1|2755580_2756105_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001194119.1|2756088_2756565_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2756568_2756910_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001174015.1|2757355_2757697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|2757728_2758151_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001337135.1|2758432_2760625_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
WP_000170998.1|2760628_2760841_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|2760961_2761585_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000801672.1|2762218_2762368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051353.1|2762364_2763267_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113502.1|2763269_2764571_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.2e-134
WP_000769011.1|2764586_2765135_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001298623.1|2765186_2765825_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
WP_000065468.1|2766217_2768281_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
WP_000216034.1|2768286_2768490_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
WP_000008824.1|2768495_2768717_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000128190.1|2768706_2769189_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	3.6e-70
WP_000312950.1|2769188_2769482_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	5.0e-27
WP_085961393.1|2769451_2770483_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	53.0	1.1e-100
WP_000212683.1|2770479_2770800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127138.1|2770834_2772229_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.7	7.3e-217
WP_001138328.1|2772422_2773820_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054755.1|2774034_2774295_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 6
NZ_CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	4077774	4089335	5072943	integrase	Enterobacteria_phage(88.89%)	13	4077592:4077614	4088225:4088247
4077592:4077614	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218974.1|4077774_4078962_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
WP_000281857.1|4079008_4079536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001335488.1|4079542_4080628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446153.1|4080924_4081497_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638629.1|4081570_4082071_-	transactivation protein	NA	NA	NA	NA	NA
WP_001279711.1|4082067_4082802_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
WP_001149160.1|4083354_4083621_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980256.1|4083617_4084208_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
WP_001244665.1|4084200_4084488_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459296.1|4084480_4084936_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4085071_4085392_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783690.1|4085406_4087740_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_001280586.1|4088297_4089335_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
4088225:4088247	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 7
NZ_CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	4838910	4911167	5072943	holin,transposase	Escherichia_phage(26.67%)	51	NA	NA
WP_000088532.1|4838910_4840524_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.5	8.6e-177
WP_000624649.1|4840554_4840905_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	2.0e-38
WP_042033708.1|4840901_4841342_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	79.8	5.8e-35
WP_000165820.1|4842224_4842524_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000528123.1|4843443_4846488_-	cytotoxic necrotizing factor CNF1	NA	NA	NA	NA	NA
WP_000509949.1|4846765_4846993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860473.1|4847433_4848870_-	alpha-hemolysin T1SS ABC transporter subunit HlyD	NA	NA	NA	NA	NA
WP_000376543.1|4848888_4851012_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	6.4e-47
WP_001142370.1|4851082_4854157_-	RTX toxin hemolysin HlyA	NA	NA	NA	NA	NA
WP_001535080.1|4854168_4854681_-	alpha-hemolysin-activating lysine-acyltransferase HlyC	NA	NA	NA	NA	NA
WP_000789515.1|4855864_4856107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730195.1|4856134_4856905_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001182766.1|4856904_4857504_-	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_001066997.1|4857644_4858364_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	3.3e-35
WP_000995843.1|4858364_4859837_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.9e-21
WP_001332775.1|4862061_4863645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001063091.1|4863742_4866703_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	24.3	3.9e-34
WP_000635307.1|4866707_4867754_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	43.0	2.0e-65
WP_000631802.1|4870056_4870443_-	toxin-immunity protein system imunity protein CdiI	NA	NA	NA	NA	NA
WP_099989847.1|4870439_4880168_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	33.5	2.1e-28
WP_001577377.1|4880180_4881947_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	2.7e-22
WP_000124167.1|4882310_4882544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260397.1|4882641_4883265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534800.1|4883532_4884081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534801.1|4884347_4884581_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991585.1|4884649_4885210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126811.1|4885456_4886023_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000426441.1|4887133_4888462_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000556033.1|4888479_4889817_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_001298079.1|4890034_4890979_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_000481835.1|4891631_4891961_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000095890.1|4891976_4892378_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000139438.1|4892410_4893076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564322.1|4893087_4893708_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_001086628.1|4893704_4894169_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001275637.1|4894180_4895128_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_000035052.1|4895179_4898566_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_001288714.1|4898592_4899747_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000599365.1|4899762_4900020_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_000570989.1|4900046_4901633_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_001206281.1|4901686_4901965_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502010.1|4901979_4902264_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502008.1|4902281_4902560_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001217008.1|4903079_4903598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270145.1|4903597_4904416_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000926369.1|4904438_4905017_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.1	3.4e-11
WP_164504460.1|4905307_4906521_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	95.3	4.2e-160
WP_001534804.1|4906994_4908173_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_001063844.1|4908165_4909356_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_001297096.1|4909365_4910145_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001298025.1|4910144_4911167_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
>prophage 8
NZ_CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	4995318	5036262	5072943	integrase,portal,terminase,tail,protease,holin,lysis	Enterobacteria_phage(48.84%)	47	4995069:4995088	5040214:5040233
4995069:4995088	attL	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
WP_001218287.1|4995318_4996533_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|4996908_4997904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206728.1|4998471_4999092_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
WP_001242728.1|4999091_4999454_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|4999444_4999981_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081256.1|5000108_5000933_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000135680.1|5000998_5001361_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000500990.1|5001829_5002342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298691.1|5002657_5003350_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
WP_001191672.1|5003447_5003708_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
WP_000515840.1|5003700_5004252_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_001087311.1|5004248_5005085_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
WP_024179079.1|5005089_5005314_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
WP_000061519.1|5005310_5006129_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_001315196.1|5006125_5006620_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000066917.1|5006619_5007273_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210180.1|5007269_5007596_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000767113.1|5007592_5007982_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061422.1|5008001_5008844_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_001540821.1|5008851_5009841_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001205460.1|5009858_5010200_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|5010212_5010761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|5010747_5011674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917727.1|5011938_5012142_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_000799673.1|5012292_5013345_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001120490.1|5013421_5013748_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001197768.1|5013751_5014228_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001298489.1|5014224_5014668_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
WP_000084843.1|5014706_5015081_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
WP_000373423.1|5015719_5016214_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934116.1|5016213_5018316_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|5018312_5018525_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|5018452_5020033_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001136583.1|5019977_5022005_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|5022091_5022415_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|5022407_5022683_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677099.1|5022694_5023273_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
WP_001298485.1|5023269_5023671_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
WP_000211128.1|5023681_5024425_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|5024485_5024872_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|5024880_5025210_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372054.1|5025181_5028247_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447254.1|5028246_5028576_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_099989854.1|5028585_5029284_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	8.9e-131
WP_044869897.1|5029288_5030032_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
WP_099989856.1|5030660_5034143_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_021518115.1|5034201_5036262_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
5040214:5040233	attR	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
>prophage 1
NZ_CP024652	Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence	107274	0	48415	107274	integrase,transposase	Escherichia_phage(29.41%)	47	3416:3430	38145:38159
WP_000344784.1|1715_2576_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000287615.1|2626_4171_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
3416:3430	attL	GCGCGCCAGCTTCAG	NA	NA	NA	NA
WP_001324342.1|4293_5817_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|5806_6589_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|6764_7265_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|7392_8232_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|8225_8573_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|8736_9528_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|9676_10690_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|10892_11243_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|11368_11929_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|11931_14898_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|14964_15342_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|15542_16202_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001333089.1|18987_19269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|19391_19742_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|19744_20707_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|20853_21147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|21223_21907_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|21907_22129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|22142_22577_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001333091.1|23276_23849_+	YubH family protein	NA	NA	NA	NA	NA
WP_001671341.1|23944_24247_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|24293_24716_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027493.1|24712_24904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|25939_26170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|26221_27583_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001298559.1|27629_28193_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_016831969.1|28192_28453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290834.1|29046_29574_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|29631_29865_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117321.1|29925_31347_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	1.2e-20
WP_001352368.1|31416_32625_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|32990_34196_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|34639_34960_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_039025567.1|35145_36126_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.7e-183
WP_011152973.1|36585_37137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229371.1|37133_38477_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
38145:38159	attR	GCGCGCCAGCTTCAG	NA	NA	NA	NA
WP_080528056.1|38609_39467_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229374.1|39796_40237_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000018326.1|40867_41683_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_086255707.1|43036_43405_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_001284954.1|43412_44099_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|44076_44700_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089064.1|44781_45987_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|46099_46693_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001352368.1|47206_48415_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
