The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018651	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 chromosome, complete genome	4698445	3221036	3230207	4698445	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|3221036_3221984_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|3221967_3222699_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3222679_3222787_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|3222846_3223578_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|3223800_3225486_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|3225482_3226202_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|3226248_3226716_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|3226772_3227303_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|3227474_3227933_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|3228173_3230207_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 2
NZ_CP018651	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 chromosome, complete genome	4698445	3297405	3307912	4698445		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144951.1|3297405_3298809_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|3298986_3299880_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3300256_3301342_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|3301341_3302241_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_058106732.1|3302288_3303167_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
WP_000973709.1|3303167_3303719_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|3303724_3304699_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|3304714_3305488_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|3305492_3306572_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|3306598_3307912_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 3
NZ_CP018651	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 chromosome, complete genome	4698445	3599260	3643806	4698445	head,capsid,lysis,integrase,holin,tRNA,terminase,tail,plate,portal	Enterobacteria_phage(62.16%)	54	3606548:3606572	3644850:3644874
WP_001144217.1|3599260_3601189_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	5.5e-130
WP_001574431.1|3601192_3601735_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001124225.1|3601830_3602028_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3602078_3602435_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3602555_3602600_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018570.1|3602736_3603720_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672408.1|3603735_3606123_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|3606127_3606427_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
3606548:3606572	attL	GGCCGCATTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_023229131.1|3606782_3606923_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	71.7	3.1e-11
WP_024143245.1|3607156_3607417_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_076734539.1|3607471_3608593_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.5	1.1e-149
WP_045900664.1|3608750_3609938_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	4.8e-185
WP_000115856.1|3609938_3610451_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
WP_078057118.1|3610493_3610850_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	3.4e-17
WP_099800470.1|3610855_3611014_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	77.6	6.9e-15
WP_076734538.1|3611000_3613961_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.7	3.4e-256
WP_000980424.1|3613974_3614463_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
WP_058106670.1|3614614_3615481_+	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	91.7	2.2e-147
WP_076734537.1|3615483_3616017_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.9	6.7e-78
WP_078057117.1|3616020_3616638_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	86.7	3.0e-98
WP_076734536.1|3616607_3618656_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	89.8	2.2e-217
WP_058106667.1|3618661_3619189_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	60.6	4.2e-56
WP_045900654.1|3619181_3620078_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.1	1.5e-106
WP_001658912.1|3620064_3620433_-|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	6.5e-40
WP_058106666.1|3620429_3621020_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.6	2.4e-68
WP_048590845.1|3621016_3621652_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	59.8	1.0e-64
WP_058106665.1|3621648_3622095_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.1	2.5e-33
WP_058106664.1|3622081_3622573_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.9	2.7e-33
WP_050154612.1|3622579_3623023_-	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	8.1e-45
WP_001658928.1|3623019_3623358_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_001658929.1|3623387_3623588_-	Tail component protein	NA	A0A0A7NV57	Enterobacteria_phage	80.3	1.9e-22
WP_045900648.1|3623587_3624082_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	60.1	2.2e-51
WP_058106662.1|3624184_3625015_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.5	1.1e-90
WP_058106661.1|3625061_3626147_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	3.8e-136
WP_099800469.1|3626170_3627007_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	2.8e-99
WP_045900644.1|3627163_3628897_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.1	1.7e-263
WP_058106659.1|3628896_3629946_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.9	5.6e-153
WP_153302029.1|3630995_3632711_+	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	54.4	6.4e-138
WP_058106657.1|3633563_3633827_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_048590832.1|3633926_3634340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106656.1|3634332_3636837_-	replication protein	NA	A0A0M4RTM8	Salmonella_phage	47.4	6.0e-177
WP_099800468.1|3636833_3637853_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	67.5	6.7e-127
WP_058106654.1|3637849_3638353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048590829.1|3638346_3639312_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IH14	Erwinia_phage	42.4	3.1e-57
WP_058106653.1|3639308_3639548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106652.1|3639544_3640078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106651.1|3640065_3640323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106650.1|3640319_3640760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023170322.1|3640835_3641027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844112.1|3640996_3641200_-	LapA family protein	NA	NA	NA	NA	NA
WP_058106649.1|3641520_3641919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058343723.1|3642078_3642357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106648.1|3642451_3642763_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	5.4e-19
WP_058106647.1|3642852_3643806_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	48.6	2.0e-77
3644850:3644874	attR	GGCCGCATTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
>prophage 4
NZ_CP018651	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 chromosome, complete genome	4698445	3980593	3991381	4698445	tRNA	Escherichia_phage(72.73%)	15	NA	NA
WP_000640113.1|3980593_3981130_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|3981126_3981417_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|3981416_3982016_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|3982539_3982752_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|3983121_3984054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|3984050_3984605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|3984766_3985096_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|3985368_3985836_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|3986221_3986377_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|3986484_3987006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|3987443_3987665_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|3987749_3988067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|3988094_3988712_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|3989028_3989964_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|3990007_3991381_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 5
NZ_CP018651	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 chromosome, complete genome	4698445	4215980	4232096	4698445	lysis,integrase,holin,tail	Salmonella_phage(28.57%)	17	4212610:4212639	4232232:4232261
4212610:4212639	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|4215980_4216844_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_099828410.1|4216834_4219201_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	67.7	0.0e+00
WP_001152415.1|4219485_4220181_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|4220270_4220804_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|4221698_4222178_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|4222195_4222648_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|4222631_4222961_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|4223236_4223923_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|4224283_4224733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|4225106_4225631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|4225727_4226417_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|4226546_4226774_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_058106734.1|4226770_4227370_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.4	1.4e-95
WP_000972675.1|4227433_4227739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|4228370_4230350_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|4230763_4231042_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|4231016_4232096_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
4232232:4232261	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
NZ_CP018651	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 chromosome, complete genome	4698445	4404488	4490403	4698445	head,tail,capsid,lysis,protease,integrase,tRNA,terminase,portal	Salmonella_phage(40.35%)	95	4463315:4463330	4487903:4487918
WP_000938186.1|4404488_4405169_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|4405787_4406447_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|4406533_4406863_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|4406859_4407141_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|4407189_4407969_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|4407994_4408543_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|4408757_4409969_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|4410026_4410344_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|4410388_4410805_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|4410975_4411638_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|4411732_4412191_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|4412226_4414281_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|4414404_4414851_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|4414869_4417023_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|4417009_4417615_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|4417831_4418341_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|4418697_4419750_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|4419821_4420274_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|4420459_4422220_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|4422288_4422807_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|4422906_4423074_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|4423329_4423893_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|4423889_4425530_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|4425534_4426788_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|4426802_4428710_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|4428722_4430831_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|4430929_4432039_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|4432035_4432578_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|4432743_4433754_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|4433961_4436574_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|4437000_4437192_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|4437462_4438149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|4438133_4438433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|4438501_4439128_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_099800438.1|4439775_4440744_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	1.5e-192
WP_000143167.1|4441219_4441801_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000178849.1|4444292_4444535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099800437.1|4444573_4445437_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_099800563.1|4445432_4447793_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	67.9	0.0e+00
WP_000246065.1|4447996_4448701_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|4448598_4449336_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|4449345_4450041_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|4450130_4450664_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|4450780_4451278_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|4451376_4451709_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_001175132.1|4452823_4453126_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	58.6	2.8e-25
WP_000478854.1|4453146_4453536_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	58.9	1.5e-31
WP_000126419.1|4453584_4454337_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	70.0	1.9e-94
WP_001032919.1|4454349_4454751_-	hypothetical protein	NA	A0A291AWY2	Escherichia_phage	59.8	8.1e-44
WP_000053601.1|4454750_4455350_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	68.7	8.3e-69
WP_000083787.1|4455359_4455716_-|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.8e-31
WP_000448213.1|4455726_4456101_-	DNA breaking-rejoining protein	NA	A0A2R9YJP4	Escherichia_phage	34.9	4.8e-06
WP_001048356.1|4456164_4457193_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	58.4	2.4e-108
WP_000143301.1|4457247_4457595_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	4.6e-19
WP_023233092.1|4457594_4459109_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	51.8	2.1e-100
WP_099800436.1|4459098_4460685_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.9e-184
WP_000224407.1|4460681_4460885_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	80.0	1.0e-18
WP_021000150.1|4460868_4462803_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	66.1	7.0e-258
WP_000867564.1|4462774_4463320_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
4463315:4463330	attL	TTTCATAAAAAATTAC	NA	NA	NA	NA
WP_099800562.1|4463788_4464229_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.0	6.2e-53
WP_024798992.1|4464249_4464738_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	1.0e-56
WP_001526513.1|4464715_4465018_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001534381.1|4465220_4465409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051124474.1|4465718_4466399_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	1.4e-59
WP_000801757.1|4466395_4466536_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_051124475.1|4466532_4467144_-	protein ninG	NA	A0A0M4RU10	Salmonella_phage	96.6	7.9e-91
WP_000929790.1|4467352_4467955_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|4467989_4468238_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|4468354_4468588_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000802853.1|4468835_4469162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251218.1|4469255_4469324_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000132543.1|4469304_4470522_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_000974174.1|4470832_4471078_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|4471077_4471398_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000113626.1|4471394_4471742_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000800016.1|4471752_4472502_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	100.0	6.6e-140
WP_099800435.1|4472504_4473560_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	53.2	4.9e-40
WP_072208318.1|4473574_4473763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010835408.1|4473854_4474229_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_051124477.1|4474194_4474431_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	71.8	2.6e-26
WP_015406390.1|4474535_4474931_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_023226317.1|4475000_4476062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038988958.1|4476039_4476411_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-31
WP_000917563.1|4477039_4477198_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|4477219_4477570_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_051124479.1|4477696_4480624_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	98.8	0.0e+00
WP_001539618.1|4480586_4481744_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|4481786_4482026_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|4482066_4482315_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262311.1|4482359_4483652_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.3e-252
WP_099800434.1|4483846_4485049_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893200.1|4485126_4486563_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544855.1|4486808_4488023_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
4487903:4487918	attR	GTAATTTTTTATGAAA	NA	NA	NA	NA
WP_000762342.1|4488340_4488802_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|4489002_4490403_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
>prophage 7
NZ_CP018651	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 chromosome, complete genome	4698445	4554931	4562244	4698445	protease,integrase	Ralstonia_phage(16.67%)	7	4549728:4549742	4560980:4560994
4549728:4549742	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|4554931_4555309_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|4555470_4555668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|4555880_4558157_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|4558187_4558508_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|4558831_4559053_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|4559182_4561129_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
4560980:4560994	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_099800433.1|4561125_4562244_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP018652	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence	200045	80550	114541	200045	transposase	Salmonella_phage(30.0%)	37	NA	NA
WP_000125667.1|80550_81957_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000627692.1|82008_83055_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001109100.1|83262_84015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|84139_85348_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000428546.1|85861_86455_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|86567_87773_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001322387.1|87851_88478_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|88455_89142_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089508164.1|89149_89536_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_001339197.1|89510_90719_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000562370.1|90866_91187_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|91630_92836_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001339175.1|93201_94410_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
WP_072075284.1|94591_95524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173535.1|95520_96036_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	1.2e-07
WP_000286633.1|96258_97686_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	2.8e-102
WP_011011077.1|97814_97985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529858.1|98009_99329_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000323423.1|99342_99546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010892342.1|99600_100821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272280.1|100823_101012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062400.1|101180_101636_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_024156254.1|102143_102812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016695105.1|102808_103081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287388.1|103342_103747_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_010892346.1|104514_104964_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	35.4	5.8e-06
WP_011011075.1|105271_105691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001209044.1|105796_106603_-	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
WP_024156253.1|107008_107266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016695101.1|107602_107995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|108061_108262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111573.1|108251_108527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|108674_109151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016695100.1|109186_109330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001138082.1|109722_112608_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_000904906.1|112733_113348_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_085959879.1|113412_114541_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
>prophage 1
NZ_CP018653	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-2, complete sequence	59334	40211	47119	59334	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|40211_40628_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|40811_41147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|41203_41809_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|41805_42747_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|43161_44367_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_099828418.1|44363_45341_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000457542.1|45422_46697_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|46696_47119_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
