The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024610	Lactobacillus terrae strain NIBRBAC000499792 chromosome, complete genome	1548794	978	24377	1548794	head,capsid,portal,integrase,terminase,protease	Lactobacillus_phage(60.0%)	32	8735:8750	28883:28898
WP_099973850.1|978_2142_-|capsid	phage major capsid protein	capsid	E9LUI4	Lactobacillus_phage	50.8	5.4e-96
WP_099973851.1|2189_2813_-|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	50.0	1.5e-44
WP_099973852.1|2769_4029_-|portal	phage portal protein	portal	B4XYP4	Lactobacillus_phage	56.1	2.7e-125
WP_099975310.1|4224_5913_-|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	57.8	5.8e-192
WP_099973853.1|5953_6403_-|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	47.7	1.5e-33
WP_099973854.1|6845_7550_-	HNH endonuclease	NA	E9LUN5	Lactobacillus_phage	37.7	1.5e-37
WP_138108110.1|7565_8744_-	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	44.6	2.4e-88
8735:8750	attL	TTTCTTTCATATTCCA	NA	NA	NA	NA
WP_099973856.1|8794_8980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973857.1|9737_10175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973858.1|10214_10436_-	DUF3310 domain-containing protein	NA	D1L2X8	Klebsiella_phage	47.9	6.5e-11
WP_099973859.1|10436_10871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138108111.1|10867_11101_-	hypothetical protein	NA	C1KFJ8	Lactobacillus_virus	41.6	7.6e-10
WP_169922419.1|11150_11327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973861.1|11457_11715_-	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	58.3	3.3e-22
WP_099973862.1|11866_12217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973863.1|12213_12672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973864.1|12661_12919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973865.1|13085_13310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973866.1|13419_14025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169922420.1|14025_14190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973867.1|14488_16324_-	DNA primase	NA	A0A059T6H3	Listeria_phage	38.9	4.8e-123
WP_099973868.1|16330_18016_-	hypothetical protein	NA	A8ATS1	Listeria_phage	40.7	7.2e-118
WP_099973869.1|18025_18649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973870.1|18662_19463_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_099973871.1|19471_20089_-	hypothetical protein	NA	B6D7K1	Listeria_phage	42.2	6.9e-42
WP_099973872.1|20173_20437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099973873.1|21011_21329_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_099973874.1|21331_21547_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099973875.1|21802_22132_+	helix-turn-helix transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	36.4	2.2e-10
WP_169922421.1|22263_22509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099973877.1|22565_23192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099973878.1|23255_24377_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	42.4	1.7e-78
28883:28898	attR	TGGAATATGAAAGAAA	NA	NA	NA	NA
>prophage 2
NZ_CP024610	Lactobacillus terrae strain NIBRBAC000499792 chromosome, complete genome	1548794	327659	337101	1548794		Enterococcus_phage(42.86%)	12	NA	NA
WP_099974124.1|327659_328850_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	32.9	1.0e-49
WP_099974125.1|328863_329331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974126.1|329363_330206_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_099974127.1|330205_330562_+	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_099974128.1|330597_331581_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	67.0	1.2e-120
WP_169922433.1|331590_333789_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.1	7.2e-251
WP_099974130.1|333730_334126_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	27.0	2.1e-07
WP_099974131.1|334125_334356_-	glutaredoxin-like protein NrdH	NA	A0A249XUR7	Enterococcus_phage	50.0	2.7e-12
WP_099975321.1|334638_335265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974132.1|335294_335504_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_099974133.1|335595_336144_+	guanylate kinase	NA	A0A0A8WJG4	Clostridium_phage	32.1	7.0e-14
WP_099974134.1|336369_337101_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	37.9	9.4e-14
>prophage 3
NZ_CP024610	Lactobacillus terrae strain NIBRBAC000499792 chromosome, complete genome	1548794	433573	500811	1548794	head,transposase,capsid,portal,integrase,terminase,tail	Lactobacillus_phage(39.02%)	85	435835:435857	474227:474249
WP_099974214.1|433573_434869_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.1	5.1e-31
WP_099974215.1|435026_435827_+	hypothetical protein	NA	NA	NA	NA	NA
435835:435857	attL	ATCACCTAGAAGGTGATCTTTTT	NA	NA	NA	NA
WP_099974216.1|435918_437040_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	39.6	2.0e-71
WP_179946636.1|437094_437640_-	DUF5067 domain-containing protein	NA	A0A1W6JP83	Staphylococcus_phage	32.3	5.5e-11
WP_099974218.1|437697_438375_-	helix-turn-helix domain-containing protein	NA	O64370	Lactobacillus_phage	44.7	1.4e-43
WP_099975324.1|438564_438744_+	XRE family transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	58.8	1.9e-08
WP_099974219.1|438764_439085_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	35.3	3.5e-05
WP_099974220.1|439367_439874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099974221.1|440034_440514_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	42.7	8.2e-27
WP_099974222.1|440513_441251_+	AAA family ATPase	NA	Q6J1V8	Lactobacillus_phage	63.7	1.3e-79
WP_099974223.1|441189_442512_+	DEAD/DEAH box helicase family protein	NA	Q9T0Y3	Lactobacillus_phage	61.4	9.6e-150
WP_099974224.1|442514_443018_+	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	52.9	2.0e-47
WP_099974225.1|443030_443822_+	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	58.1	8.7e-82
WP_099974226.1|443818_445081_+	helicase	NA	A0A0A1EL11	Lactobacillus_phage	54.2	2.0e-125
WP_099974227.1|445329_445641_+	VRR-NUC domain-containing protein	NA	A0A0M7RDN7	Lactobacillus_phage	63.7	1.6e-31
WP_169922420.1|445745_445910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974228.1|445909_446500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974229.1|446524_446713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974230.1|446709_447399_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	41.5	1.6e-39
WP_099974231.1|447415_447670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974232.1|447687_448164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974233.1|448160_448352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974234.1|448351_448567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974235.1|448563_448872_+	MazG-like family protein	NA	A0A286QPB2	Streptococcus_phage	45.5	2.2e-17
WP_138108120.1|448909_449143_+	hypothetical protein	NA	C1KFJ8	Lactobacillus_virus	41.0	7.6e-10
WP_099973858.1|449139_449361_+	DUF3310 domain-containing protein	NA	D1L2X8	Klebsiella_phage	47.9	6.5e-11
WP_099973857.1|449401_449839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974237.1|450901_451087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138108121.1|451137_452316_+	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	44.3	1.6e-87
WP_099974239.1|452305_452509_+	hypothetical protein	NA	Q5GQT7	Synechococcus_phage	51.0	4.9e-05
WP_099974240.1|452509_452917_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	42.9	4.0e-22
WP_099974241.1|452909_453155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179946637.1|453157_454414_+|terminase	PBSX family phage terminase large subunit	terminase	Q9AZ91	Lactobacillus_prophage	63.2	4.7e-154
WP_099974243.1|454424_455765_+|portal	phage portal protein	portal	A0A0P0IQQ3	Lactobacillus_phage	41.8	4.0e-87
WP_099974244.1|455757_456648_+|capsid	minor capsid protein	capsid	A0A0A1EKX3	Lactobacillus_phage	36.2	5.8e-50
WP_099974245.1|456767_457397_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_099974246.1|457401_458277_+|capsid	N4-gp56 family major capsid protein	capsid	D7RWD0	Brochothrix_phage	59.3	2.3e-83
WP_099974247.1|458316_458961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974248.1|458978_459686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975325.1|459713_460076_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IV23	Lactobacillus_phage	46.8	1.8e-18
WP_099974249.1|460065_460368_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_099974250.1|460367_460730_+	hypothetical protein	NA	A0A0P0I3G7	Lactobacillus_phage	31.4	1.9e-07
WP_099974251.1|460731_461127_+	hypothetical protein	NA	A0A0P0I3C8	Lactobacillus_phage	41.9	5.6e-21
WP_099974252.1|461142_461997_+|tail	phage major tail protein, TP901-1 family	tail	A0A0N7IR90	Lactobacillus_phage	44.5	2.6e-39
WP_099974253.1|462065_462404_+|tail	tail assembly chaperone	tail	A0A097BY80	Leuconostoc_phage	50.0	1.3e-18
WP_169922436.1|462499_462814_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	47.1	6.2e-15
WP_099974255.1|462860_465986_+	tape measure protein	NA	A0A1P8BKQ5	Lactococcus_phage	44.1	8.5e-80
WP_099974256.1|465988_466804_+|tail	phage tail family protein	tail	A1EAB1	Streptococcus_phage	25.7	1.7e-11
WP_099974257.1|466800_468258_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_099974258.1|468269_468980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974259.1|468981_469677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974260.1|469676_470282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974261.1|470298_470697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974262.1|470693_470942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974263.1|470967_471336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974264.1|471339_472338_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	44.7	2.1e-40
WP_099974265.1|472676_473102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974266.1|473114_473312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974267.1|473393_473678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974268.1|474250_475135_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.0	2.5e-61
474227:474249	attR	ATCACCTAGAAGGTGATCTTTTT	NA	NA	NA	NA
WP_099974269.1|475284_477192_+	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_099974270.1|477202_478495_-	hypothetical protein	NA	Q9KX94	Enterobacteria_phage	37.9	1.4e-65
WP_099974271.1|479011_479767_-	TerC family protein	NA	S5MAL1	Bacillus_phage	44.9	1.8e-44
WP_099974272.1|479852_481214_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_099974273.1|481450_481921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974274.1|481950_483417_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_099974275.1|483486_484185_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_099974276.1|484190_484616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099974277.1|484648_485383_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099974278.1|485453_486143_+	viroplasmin family protein	NA	J9QPV9	Pectobacterium_phage	33.3	1.6e-15
WP_099974279.1|486198_486912_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_099974280.1|486943_487885_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_099974281.1|488060_489110_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_099974282.1|489228_490383_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_099974283.1|490601_491744_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_099974284.1|491852_493796_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	38.4	5.7e-34
WP_099974285.1|493849_494599_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_099974286.1|494660_495407_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.8	2.4e-12
WP_099974287.1|495422_496592_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_099974288.1|496733_496967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099974289.1|497070_498180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169922437.1|498130_498301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099974290.1|498573_499557_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	30.7	2.1e-29
WP_099974291.1|499667_499970_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099974292.1|500223_500811_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	56.8	2.7e-35
>prophage 4
NZ_CP024610	Lactobacillus terrae strain NIBRBAC000499792 chromosome, complete genome	1548794	667209	675001	1548794		Bacillus_phage(50.0%)	8	NA	NA
WP_099974444.1|667209_668325_+	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	39.6	1.9e-05
WP_099974445.1|668309_668990_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	2.4e-27
WP_099975336.1|669098_670649_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	34.3	8.0e-31
WP_099975337.1|670769_671594_+	phosphate ABC transporter substrate-binding protein	NA	M1U9L0	Synechococcus_phage	26.5	8.7e-08
WP_099974446.1|671614_672535_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_099974447.1|672534_673425_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_099974448.1|673427_674222_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	6.8e-10
WP_099974449.1|674236_675001_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	8.6e-18
>prophage 5
NZ_CP024610	Lactobacillus terrae strain NIBRBAC000499792 chromosome, complete genome	1548794	704669	717089	1548794	integrase	Lactobacillus_phage(54.55%)	20	693406:693422	726206:726222
693406:693422	attL	TAGGTAACTTTTCAATT	NA	NA	NA	NA
WP_099974473.1|704669_705140_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.1	2.0e-41
WP_099974474.1|705231_705735_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099974475.1|705948_706512_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099974476.1|706521_707082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099974477.1|707157_707826_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	40.4	1.1e-40
WP_099974478.1|707980_709030_-|integrase	site-specific integrase	integrase	Q77YW7	Streptococcus_phage	35.2	4.4e-49
WP_099974479.1|709334_709880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974480.1|709957_710323_-	DUF805 domain-containing protein	NA	D6PSS5	Lactobacillus_phage	30.0	3.6e-06
WP_179946638.1|710416_710866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169922441.1|710932_711325_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	35.5	1.5e-13
WP_099974482.1|711339_711651_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	48.1	1.1e-19
WP_169922442.1|711905_712082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974483.1|712074_712281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099974484.1|712429_712756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099974485.1|712916_713396_+	siphovirus Gp157 family protein	NA	Q8W5W1	Listeria_phage	46.5	1.8e-26
WP_179946639.1|713392_714142_+	AAA family ATPase	NA	A8YQL5	Lactobacillus_phage	62.8	3.8e-79
WP_099974486.1|714071_714962_+	DEAD/DEAH box helicase family protein	NA	A0A0P0ID30	Lactobacillus_phage	67.6	1.1e-106
WP_099974487.1|715078_715642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099974488.1|715853_716546_+	nicotinamide mononucleotide transporter	NA	A0A288TY98	Enterococcus_phage	57.0	9.0e-67
WP_169922443.1|716630_717089_+	hypothetical protein	NA	A0A0M7RDP0	Lactobacillus_phage	31.5	7.9e-11
726206:726222	attR	AATTGAAAAGTTACCTA	NA	NA	NA	NA
>prophage 6
NZ_CP024610	Lactobacillus terrae strain NIBRBAC000499792 chromosome, complete genome	1548794	1121834	1132181	1548794	tRNA	Prochlorococcus_phage(50.0%)	11	NA	NA
WP_099974872.1|1121834_1122104_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	37.3	8.5e-05
WP_099974873.1|1122096_1122822_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_099974874.1|1122856_1123486_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_099974875.1|1123482_1124748_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_099974876.1|1124759_1126301_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.5	5.3e-75
WP_099974877.1|1126297_1126882_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-26
WP_099974878.1|1126886_1127396_-	hypothetical protein	NA	H8ZMN7	Synechococcus_phage	37.0	6.7e-19
WP_169922455.1|1127395_1127665_-	hypothetical protein	NA	Q58MH8	Prochlorococcus_phage	41.2	7.9e-11
WP_099974880.1|1127646_1127895_-	hypothetical protein	NA	Q58MH8	Prochlorococcus_phage	44.7	1.5e-11
WP_099974881.1|1127910_1129317_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	32.2	2.1e-54
WP_099974882.1|1131509_1132181_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	A9YX36	Burkholderia_phage	30.1	9.2e-08
>prophage 7
NZ_CP024610	Lactobacillus terrae strain NIBRBAC000499792 chromosome, complete genome	1548794	1540636	1548314	1548794	head,tail	Lactobacillus_phage(100.0%)	7	NA	NA
WP_099975302.1|1540636_1545583_-|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	41.9	3.7e-154
WP_099975303.1|1545782_1546109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099975304.1|1546239_1546845_-|tail	phage tail protein	tail	U5U3Z7	Lactobacillus_phage	54.2	1.9e-52
WP_099975305.1|1546887_1547301_-	hypothetical protein	NA	E9LUI8	Lactobacillus_phage	38.9	1.4e-22
WP_099975306.1|1547297_1547669_-	HK97 gp10 family phage protein	NA	D2KRB2	Lactobacillus_phage	45.6	6.6e-24
WP_099975307.1|1547668_1548001_-|head	phage head closure protein	head	B4XYP8	Lactobacillus_phage	49.5	6.3e-26
WP_099975308.1|1547987_1548314_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUI5	Lactobacillus_phage	41.2	1.9e-14
