The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	225181	246864	3991735	transposase,integrase	Vibriophage(40.0%)	20	230551:230610	245134:245330
WP_000736396.1|225181_225892_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_031986851.1|225892_227803_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_085940413.1|228224_229315_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|229407_230223_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|230309_230612_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_071543477.1|230505_230799_-	hypothetical protein	NA	NA	NA	NA	NA
230551:230610	attL	CAACGTATAGGAAGAATAAACGCCCTTTTCACCCAAGTCCAACAGCTTTGGACCGCAGTT	NA	NA	NA	NA
WP_000736396.1|231003_231714_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_000573060.1|231714_233625_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000417085.1|233629_234550_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000081835.1|234579_235695_+	TniQ family protein	NA	NA	NA	NA	NA
WP_002017214.1|235687_237118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|237492_237864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095006.1|237936_238236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034564.1|238303_239155_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_000953322.1|239167_240655_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
WP_001144964.1|240949_242746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089073.1|242828_244046_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|244127_244751_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_000512977.1|244728_245133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|245370_246864_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
245134:245330	attR	CAACGTATAGGAAGAATAAACGCCCTTTTCACCCAAGTCCAACAGCTTTGGACCGCAGTTGACTCTTTCGACACCCCTGCGATGCAACCCAATCCGGCTGACGGGGAGCCAGCAACGCTGAAAATTTACCCTCCTCTTTCCCACTAGCGGCTCCTTTTCCGACAACCAGCACGGCGGATCCCTGCCGCGGCGCTGTG	NA	NA	NA	NA
>prophage 2
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	1095544	1107892	3991735		Acinetobacter_phage(95.65%)	24	NA	NA
WP_000004579.1|1095544_1096267_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
WP_000147323.1|1096263_1096671_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000654846.1|1096671_1096923_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000698529.1|1096924_1097857_-	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_001207474.1|1097853_1098975_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000064463.1|1098986_1099310_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_000656405.1|1099302_1099593_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_001101038.1|1099592_1100036_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000051960.1|1100229_1100472_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_000845537.1|1100478_1100682_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_001129676.1|1100820_1101324_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000048052.1|1101325_1102333_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_000370485.1|1102384_1102600_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000052252.1|1102614_1103367_-	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000703023.1|1103471_1103660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048916.1|1103670_1103991_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_001180660.1|1104052_1104325_+	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000602535.1|1104396_1104621_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_000064627.1|1104613_1105495_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_001003671.1|1105497_1106298_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000647826.1|1106294_1106633_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_000462878.1|1106625_1107018_+	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000100162.1|1107017_1107419_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_001277128.1|1107415_1107892_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 3
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	1111850	1140524	3991735	capsid,terminase	Acinetobacter_phage(93.55%)	38	NA	NA
WP_001136773.1|1111850_1112306_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
WP_000378523.1|1112366_1112801_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_000435230.1|1112769_1113411_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000729387.1|1113469_1113985_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_001132930.1|1113944_1115237_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000301495.1|1115276_1116617_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_000146970.1|1116626_1117733_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000004550.1|1117729_1117960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291451.1|1117975_1118128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589038.1|1118179_1118494_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_000056390.1|1118580_1119372_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000852265.1|1119385_1120336_+	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000524488.1|1120380_1120716_+	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000008459.1|1120719_1121100_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524257.1|1121100_1121469_+	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000540685.1|1121537_1121735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235282.1|1121742_1122036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248411.1|1122087_1122498_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000539749.1|1122469_1122838_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_001984404.1|1122794_1123238_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_001277696.1|1123239_1123458_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749909.1|1123566_1124088_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000064593.1|1124184_1124538_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000002408.1|1124537_1125716_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000094278.1|1125768_1126686_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_001185585.1|1126755_1127271_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000335868.1|1127773_1128073_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|1128081_1128540_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000721572.1|1128644_1129325_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_001275792.1|1129326_1129590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|1129717_1134028_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_000721057.1|1134118_1134706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277448.1|1134798_1135197_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000368388.1|1135196_1135703_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000835160.1|1135699_1136062_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000598554.1|1136054_1139480_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000433907.1|1139547_1139937_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_001019739.1|1139978_1140524_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
>prophage 4
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	1146140	1268233	3991735	transposase,integrase,tRNA	Escherichia_phage(30.3%)	112	1141968:1141982	1221842:1224362
1141968:1141982	attL	ATACTTTTTTGATAA	NA	NA	NA	NA
WP_000046989.1|1146140_1147514_-|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
1141968:1141982	attL	ATACTTTTTTGATAA	NA	NA	NA	NA
WP_000003720.1|1147941_1148226_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_000893185.1|1148222_1148783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001150150.1|1148847_1149477_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_000775459.1|1149544_1150867_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_001187364.1|1150898_1152107_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000005670.1|1152103_1153336_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000129799.1|1153545_1153797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000058923.1|1153851_1154253_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000896577.1|1154318_1154960_+	cation transporter	NA	NA	NA	NA	NA
WP_000950251.1|1155018_1155621_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000887365.1|1155728_1156619_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_000140381.1|1156621_1157008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001275986.1|1157101_1157938_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	4.0e-45
WP_000959396.1|1158131_1158533_+	YraN family protein	NA	NA	NA	NA	NA
WP_000919363.1|1158613_1159321_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_001048900.1|1159324_1160188_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001292948.1|1160210_1160954_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_001289239.1|1160953_1162597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084042.1|1162731_1164111_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
WP_000277824.1|1164343_1167550_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.7e-25
WP_085916950.1|1167688_1169401_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000536107.1|1169430_1170483_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000008523.1|1170482_1171493_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000550783.1|1171470_1173060_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.2e-19
WP_000077974.1|1173245_1174490_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_000364465.1|1174548_1176663_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001982681.1|1176940_1177603_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_001084867.1|1177587_1178622_-	dihydroorotase	NA	NA	NA	NA	NA
WP_000013374.1|1178771_1180034_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
WP_014462718.1|1180092_1181451_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
WP_000205078.1|1181716_1183747_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
1181658:1181672	attR	TTATCAAAAAAGTAT	NA	NA	NA	NA
WP_000043049.1|1184086_1185139_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
1181658:1181672	attR	TTATCAAAAAAGTAT	NA	NA	NA	NA
WP_001153949.1|1185198_1186287_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000732876.1|1187130_1188006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000703423.1|1188130_1188397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000504070.1|1188859_1189000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014538326.1|1188950_1189619_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|1192112_1192817_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|1193053_1193758_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001277461.1|1193769_1194078_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281124.1|1194095_1195778_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	7.4e-38
WP_000523860.1|1195816_1196224_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732277.1|1196251_1196533_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294665.1|1196548_1196899_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429724.1|1196970_1197426_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_075911820.1|1197492_1198581_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_000983249.1|1198567_1199353_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|1199528_1200029_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|1200156_1200996_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|1200989_1201337_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067855.1|1202004_1202709_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001109644.1|1203763_1204315_+	AAC(6')-Ia family aminoglycoside 6'-N-acetyltransferase AacA16	NA	NA	NA	NA	NA
WP_001067855.1|1204846_1205551_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001217881.1|1206284_1206842_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|1207024_1207885_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|1207955_1208660_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000904905.1|1211683_1212343_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
WP_001067855.1|1212354_1213059_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000902128.1|1213325_1213505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018326.1|1213658_1214474_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|1214603_1215308_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845054.1|1215799_1216813_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_002089484.1|1216983_1217448_+	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_001102919.1|1217566_1218079_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002018749.1|1217963_1218617_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206316.1|1219029_1219821_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|1219984_1220332_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1220325_1221165_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|1221292_1221793_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|1222432_1223137_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072266016.1|1223172_1223322_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|1223447_1224008_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067855.1|1225041_1225746_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000600025.1|1226578_1227412_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000626177.1|1227474_1228434_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000107496.1|1228958_1229582_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000459997.1|1229646_1230369_-	pirin family protein	NA	NA	NA	NA	NA
WP_000226456.1|1230879_1231842_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000599996.1|1231907_1232738_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010700419.1|1232761_1234312_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002001404.1|1234710_1234908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729980.1|1235230_1236550_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_001077405.1|1236661_1237660_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001111760.1|1237703_1238261_-	cytochrome b	NA	NA	NA	NA	NA
WP_000735756.1|1238499_1238889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495836.1|1238954_1239521_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000906487.1|1239590_1239845_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|1240091_1241372_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000199457.1|1241437_1244074_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_001188823.1|1244343_1245369_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000155680.1|1245644_1246811_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000517792.1|1246875_1248195_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000776215.1|1248317_1248635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034598.1|1248751_1249531_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001159802.1|1249590_1250640_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_085940413.1|1250884_1251975_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000203219.1|1252031_1252697_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001195082.1|1253135_1253558_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001026230.1|1253649_1254075_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001237344.1|1254071_1254878_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001210050.1|1255179_1257759_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_000941316.1|1257815_1258304_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
WP_001060738.1|1258572_1258989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498918.1|1259014_1261240_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000654268.1|1261457_1261802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000546639.1|1261925_1262942_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_001987632.1|1262945_1264190_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_000026482.1|1264403_1265819_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000703552.1|1265905_1266685_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_000912930.1|1266695_1267322_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_002000926.1|1267492_1268233_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	1314211	1338825	3991735	tail,head,terminase	Bordetella_phage(40.0%)	30	NA	NA
WP_010700449.1|1314211_1315609_-	DEAD/DEAH box helicase	NA	Q774Z8	Bordetella_phage	69.9	9.3e-196
WP_010700460.1|1315605_1315896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010700452.1|1315888_1316158_-	VRR-NUC domain-containing protein	NA	Q775A2	Bordetella_phage	70.9	1.0e-26
WP_010700457.1|1316157_1316982_-	hypothetical protein	NA	A0A2I7RWZ3	Vibrio_phage	51.0	1.1e-68
WP_010700450.1|1316986_1319062_-	3'-5' exonuclease	NA	Q775A3	Bordetella_phage	65.6	1.6e-263
WP_010700466.1|1319160_1320009_-	DUF2303 family protein	NA	I3PUY7	Vibrio_phage	27.1	1.4e-21
WP_010700443.1|1320045_1320372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010700442.1|1320546_1321104_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	60.2	5.4e-62
WP_010700456.1|1321109_1322402_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	44.8	6.6e-95
WP_010700439.1|1322557_1323028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000643565.1|1323173_1323839_-	LexA family transcriptional regulator	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	66.2	3.5e-52
WP_000106776.1|1323990_1324242_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	46.3	4.0e-09
WP_010700463.1|1324238_1324604_+	hypothetical protein	NA	A0A2P9HY19	Yersinia_phage	54.5	4.4e-20
WP_010700462.1|1324605_1324824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010700453.1|1324825_1325233_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	35.8	6.8e-06
WP_010700441.1|1325229_1327830_+	PriCT-2 domain-containing protein	NA	Q775B5	Bordetella_phage	55.8	1.8e-280
WP_010700440.1|1328248_1328986_+|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	48.6	4.8e-50
WP_010700438.1|1328978_1329188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025467317.1|1329204_1329540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010700461.1|1329520_1331143_+	Terminase-like domain protein	NA	Q775B9	Bordetella_phage	60.8	3.1e-190
WP_000337259.1|1331220_1331505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133670.1|1331506_1333198_+|head,tail	head-tail connector protein	head,tail	G9L6C2	Escherichia_phage	31.2	1.6e-69
WP_001281313.1|1333194_1333527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005806.1|1333492_1334158_+	hypothetical protein	NA	A0A2I7RHR0	Vibrio_phage	35.6	1.0e-11
WP_010700445.1|1334169_1335192_+	hypothetical protein	NA	Q775C7	Bordetella_phage	50.3	1.2e-88
WP_001229564.1|1335205_1335610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283618.1|1335624_1335810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288256.1|1335874_1336240_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	53.3	2.6e-25
WP_001256669.1|1336254_1336809_+	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	26.2	2.4e-06
WP_001200115.1|1336809_1338825_+	hypothetical protein	NA	Q775D1	Bordetella_phage	38.8	7.5e-130
>prophage 6
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	1342706	1359985	3991735	tail,tRNA,integrase	Acinetobacter_phage(40.0%)	13	1348918:1348932	1364358:1364372
WP_010700454.1|1342706_1349525_+	N-acetyltransferase	NA	Q775D4	Bordetella_phage	24.2	2.0e-102
1348918:1348932	attL	TTTACAACTGGTTCA	NA	NA	NA	NA
WP_099770549.1|1349618_1351904_+|tail	phage tail protein	tail	A0A0P0IRG3	Acinetobacter_phage	94.1	0.0e+00
WP_001104859.1|1351905_1352130_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	83.6	1.3e-27
WP_000999570.1|1352235_1352607_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	62.6	2.0e-36
WP_000109885.1|1352617_1353235_+	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	63.5	3.9e-69
WP_000079897.1|1353372_1353570_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	71.1	6.8e-12
WP_002122312.1|1353598_1354612_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	40.3	2.9e-66
WP_001182287.1|1354965_1356387_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	3.3e-55
WP_001133555.1|1356600_1357578_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
WP_000179338.1|1357581_1358121_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|1358158_1358707_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|1358690_1359239_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|1359238_1359985_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
1364358:1364372	attR	TTTACAACTGGTTCA	NA	NA	NA	NA
>prophage 7
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	2317783	2359590	3991735	transposase,integrase,capsid,plate	Acinetobacter_phage(100.0%)	60	2317259:2317276	2359751:2359768
2317259:2317276	attL	ATAAAAGAAGTAGAATCC	NA	NA	NA	NA
WP_085942227.1|2317783_2318948_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_000151893.1|2319194_2319788_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
WP_001109862.1|2319794_2320442_-	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_000999701.1|2320452_2321133_-	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
WP_001019736.1|2321322_2321868_-	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	100.0	1.8e-102
WP_000433900.1|2321910_2322300_-	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	100.0	1.1e-66
WP_001104857.1|2322377_2322605_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	100.0	3.0e-35
WP_000224779.1|2322606_2324661_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	100.0	0.0e+00
WP_000359223.1|2324724_2325333_-	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	100.0	6.2e-112
WP_001192561.1|2325325_2325916_-	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	100.0	8.7e-111
WP_001229408.1|2325915_2327100_-|plate	baseplate J/gp47 family protein	plate	A0A0P0I499	Acinetobacter_phage	100.0	7.1e-221
WP_001270576.1|2327102_2327456_-	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	100.0	1.4e-63
WP_001218525.1|2327490_2328153_-	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	100.0	5.1e-128
WP_000003732.1|2328155_2329115_-	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	100.0	3.1e-182
WP_001240304.1|2329111_2329408_-	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	100.0	7.3e-50
WP_001018608.1|2329410_2330007_-	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	100.0	7.9e-104
WP_001051325.1|2330366_2330594_+	hypothetical protein	NA	A0A0P0I8G2	Acinetobacter_phage	100.0	1.5e-31
WP_000821707.1|2330593_2330950_+	DUF1311 domain-containing protein	NA	A0A0P0IRF2	Acinetobacter_phage	100.0	4.5e-62
WP_001285933.1|2330946_2332971_-	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	100.0	0.0e+00
WP_001165484.1|2333166_2333628_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	100.0	1.2e-78
WP_000109248.1|2333627_2334071_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	100.0	3.3e-78
WP_000174797.1|2334085_2335561_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	100.0	3.7e-275
WP_000502801.1|2335564_2336104_-	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	100.0	3.3e-101
WP_000057776.1|2336106_2336475_-	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	100.0	5.9e-65
WP_000094499.1|2336461_2337022_-	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	100.0	5.2e-97
WP_000622625.1|2337018_2337405_-	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	100.0	2.3e-67
WP_000041170.1|2337408_2337840_-	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	100.0	8.1e-58
WP_000040568.1|2337849_2338875_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	100.0	1.7e-194
WP_000525986.1|2338939_2339416_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	100.0	3.0e-85
WP_000473611.1|2339419_2340736_-	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	100.0	3.5e-213
WP_000635838.1|2341024_2341660_-|capsid	minor capsid protein	capsid	A0A0P0IKX5	Acinetobacter_phage	100.0	7.1e-119
WP_000522918.1|2341682_2343095_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	100.0	4.6e-259
WP_000220360.1|2343105_2344764_-	hypothetical protein	NA	A0A0P0IVT4	Acinetobacter_phage	100.0	0.0e+00
WP_000113271.1|2344760_2345270_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	100.0	1.2e-89
WP_000787534.1|2345317_2345965_-	hypothetical protein	NA	A0A0N7IRF1	Acinetobacter_phage	100.0	5.0e-128
WP_000715269.1|2346059_2346818_-	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	100.0	2.9e-143
WP_002001437.1|2347079_2347730_-	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
WP_000783470.1|2347925_2348426_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_000100185.1|2348422_2348818_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
WP_001288422.1|2348817_2349042_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_002018225.1|2349034_2349397_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_000647820.1|2349446_2349869_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
WP_000544510.1|2349865_2350615_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	100.0	9.6e-139
WP_000280081.1|2350607_2351537_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	100.0	4.3e-173
WP_002017020.1|2351529_2351673_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	97.6	2.1e-15
WP_001084147.1|2351889_2352186_-	hypothetical protein	NA	A0A0P0HSJ2	Acinetobacter_phage	100.0	1.1e-48
WP_001180656.1|2352182_2352455_-	hypothetical protein	NA	A0A0P0J0B9	Acinetobacter_phage	100.0	4.6e-43
WP_000092157.1|2352517_2352874_-	hypothetical protein	NA	A0A0P0IKQ0	Acinetobacter_phage	100.0	2.2e-61
WP_001050157.1|2352884_2353100_-	helix-turn-helix domain-containing protein	NA	A0A0P0IY81	Acinetobacter_phage	100.0	1.3e-35
WP_000129518.1|2353200_2353956_+	helix-turn-helix transcriptional regulator	NA	A0A0P0I8E0	Acinetobacter_phage	100.0	1.5e-144
WP_001101456.1|2354153_2354594_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	100.0	4.0e-76
WP_000181035.1|2354596_2354920_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	100.0	3.9e-57
WP_001207480.1|2354931_2356053_+	ATP-binding protein	NA	A0A0P0IDZ3	Acinetobacter_phage	100.0	3.0e-213
WP_000698524.1|2356049_2357051_+	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	100.0	1.6e-189
WP_000654796.1|2357052_2357310_+	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	100.0	2.0e-43
WP_000453807.1|2357300_2357510_+	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	100.0	7.4e-33
WP_000048755.1|2357506_2357791_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	100.0	2.3e-45
WP_000005650.1|2357794_2358052_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	100.0	5.9e-48
WP_000910238.1|2358052_2358322_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000773619.1|2358327_2359590_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	100.0	3.8e-249
2359751:2359768	attR	ATAAAAGAAGTAGAATCC	NA	NA	NA	NA
>prophage 8
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	2702966	2715681	3991735	transposase	Acinetobacter_phage(100.0%)	8	NA	NA
WP_000960547.1|2702966_2705378_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000281127.1|2705457_2708190_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_001982145.1|2708545_2709595_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608304.1|2709604_2710411_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_000066126.1|2710420_2711116_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164226.1|2711126_2712110_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_085940413.1|2712718_2713809_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001076814.1|2713842_2715681_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
>prophage 9
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	2881192	2927702	3991735	capsid,integrase,terminase,tRNA,tail,holin	Acinetobacter_phage(66.67%)	55	2872464:2872478	2898009:2898023
2872464:2872478	attL	TTTAATAATATTGAT	NA	NA	NA	NA
WP_001988581.1|2881192_2882239_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000537617.1|2882342_2883947_+|integrase	site-specific integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.1	1.4e-91
WP_000200051.1|2883949_2884141_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	83.9	4.4e-24
WP_000566934.1|2884202_2884793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958559.1|2885040_2885370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002016874.1|2885390_2885621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189398.1|2885792_2886110_-	hypothetical protein	NA	A0A1W5PUJ8	Salmonella_phage	58.5	9.6e-24
WP_001019749.1|2886110_2886656_-	N-acetylmuramidase	NA	A0A0B5KTG8	Acinetobacter_phage	89.4	1.1e-91
WP_000200151.1|2886714_2886939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999700.1|2886919_2887213_-|holin	holin	holin	NA	NA	NA	NA
WP_000371015.1|2887281_2888007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141976.1|2888006_2888330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018917.1|2888330_2898350_-|tail	tail protein	tail	A0A0R6PIC9	Moraxella_phage	37.2	1.6e-10
2898009:2898023	attR	ATCAATATTATTAAA	NA	NA	NA	NA
WP_000920736.1|2898416_2899088_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	46.8	1.2e-39
WP_000778488.1|2899071_2899827_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	57.4	4.5e-88
WP_000175075.1|2899833_2900532_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
WP_000985763.1|2900541_2900892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281459.1|2900946_2901288_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000191304.1|2901405_2905371_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	44.7	3.7e-165
WP_000720591.1|2905431_2905833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966689.1|2905913_2906318_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	88.8	1.0e-62
WP_000838146.1|2906382_2906565_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_001185622.1|2906896_2907430_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	59.9	6.3e-44
WP_000094300.1|2907474_2908404_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	40.8	5.3e-54
WP_000121166.1|2908511_2908724_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	75.4	1.3e-21
WP_001132270.1|2908725_2909124_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	71.2	4.0e-51
WP_000539752.1|2909125_2909494_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	4.8e-51
WP_000248324.1|2909465_2909870_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	92.5	4.9e-65
WP_001197735.1|2909878_2910292_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	76.6	5.6e-56
WP_000008492.1|2910248_2910638_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	9.5e-66
WP_000767881.1|2910642_2911308_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	67.4	5.2e-72
WP_000214195.1|2911372_2912329_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	5.6e-168
WP_000770060.1|2912356_2913124_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	94.1	8.1e-117
WP_000159880.1|2913237_2913552_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	48.5	3.4e-13
WP_000166323.1|2913620_2914133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741600.1|2914425_2915529_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	83.4	5.9e-177
WP_001286349.1|2915530_2916982_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	90.2	1.2e-259
WP_000102065.1|2916978_2918406_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	88.4	1.2e-251
WP_000729373.1|2918395_2918866_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.7	2.6e-73
WP_000372127.1|2918924_2919566_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.2	4.4e-124
WP_000377939.1|2919534_2920002_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.8	4.4e-65
WP_000359988.1|2919991_2920165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000837652.1|2920479_2921250_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	60.8	1.4e-89
WP_001989822.1|2921435_2921666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214487.1|2921846_2922410_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
WP_001279874.1|2922431_2922716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203140.1|2922725_2923133_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
WP_001293626.1|2923129_2923531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039747.1|2923517_2923700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000779000.1|2923696_2924095_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	1.5e-26
WP_000755976.1|2924106_2924973_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	43.7	1.4e-72
WP_000631609.1|2924969_2925428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049976.1|2925424_2926528_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	56.1	1.4e-29
WP_000612880.1|2926524_2927379_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_000108908.1|2927375_2927702_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	36.0	3.2e-06
>prophage 10
NZ_CP024124	Acinetobacter baumannii strain AYP-A2 chromosome, complete genome	3991735	3416924	3467273	3991735	transposase,integrase,capsid,terminase	Acinetobacter_phage(98.48%)	73	3413463:3413478	3475375:3475390
3413463:3413478	attL	TATTTTTGAAAATTTC	NA	NA	NA	NA
WP_085942227.1|3416924_3418089_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_000151893.1|3418335_3418929_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
WP_001109862.1|3418935_3419583_-	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_000999701.1|3419593_3420274_-	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
WP_001019716.1|3420463_3421009_-	N-acetylmuramidase	NA	J7I0Y1	Acinetobacter_phage	98.9	2.6e-101
WP_000096283.1|3421347_3422247_-	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
WP_000124482.1|3422412_3422673_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001226299.1|3422692_3423184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735265.1|3423240_3423567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720514.1|3423570_3423912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433918.1|3424110_3424500_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_000590505.1|3424567_3428014_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	100.0	0.0e+00
WP_000835168.1|3428006_3428369_-	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
WP_000368375.1|3428365_3428872_-	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.2e-92
WP_000277443.1|3428871_3429270_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
WP_000246069.1|3429334_3429727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937383.1|3429730_3430483_-	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
WP_000046576.1|3430557_3434892_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	70.2	0.0e+00
WP_001275792.1|3435019_3435283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|3435284_3435965_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000966688.1|3436063_3436468_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
WP_000838146.1|3436560_3436743_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_024616020.1|3437068_3437584_-	hypothetical protein	NA	J7I4Q2	Acinetobacter_phage	100.0	2.8e-73
WP_000094253.1|3437654_3438572_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.7	7.8e-167
WP_000002415.1|3438624_3439980_-	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	99.3	6.5e-202
WP_000064593.1|3439979_3440333_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|3440429_3440951_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|3441059_3441278_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_002016455.1|3441279_3441723_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	87.8	3.1e-68
WP_000539748.1|3441679_3442048_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
WP_000247952.1|3442019_3442424_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_000524213.1|3442432_3442801_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
WP_000008496.1|3442802_3443192_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_000692540.1|3443196_3443862_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000214198.1|3443927_3444884_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000770049.1|3444911_3445679_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_001139861.1|3445792_3445984_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004363.1|3446201_3446444_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_000965231.1|3446542_3446971_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000179763.1|3446979_3448083_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_001286355.1|3448084_3449536_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	100.0	1.0e-285
WP_000102080.1|3449532_3450960_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_000212566.1|3450949_3451420_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000435252.1|3451478_3452120_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.1	6.7e-125
WP_000378508.1|3452088_3452523_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
WP_000195753.1|3452584_3453040_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	100.0	3.1e-84
WP_000959662.1|3453461_3454214_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	100.0	8.7e-140
WP_000100186.1|3454224_3454626_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
WP_001288422.1|3454625_3454850_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_002018225.1|3454842_3455205_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_000648413.1|3455254_3455677_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_001031749.1|3455663_3455798_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_001003675.1|3455794_3456595_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	100.0	2.0e-150
WP_000064623.1|3456597_3457479_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	100.0	9.8e-143
WP_002037796.1|3457471_3457696_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	98.6	6.5e-35
WP_001095598.1|3457767_3458043_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	100.0	8.9e-42
WP_000049334.1|3458098_3458419_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	100.0	4.6e-50
WP_000996063.1|3458429_3458681_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	100.0	8.9e-41
WP_001093654.1|3458789_3459554_+	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	100.0	2.8e-146
WP_000370481.1|3459568_3459784_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	100.0	8.5e-32
WP_000048052.1|3459835_3460843_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|3460844_3461348_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_001101441.1|3461556_3461997_+	hypothetical protein	NA	A0A0P0IR91	Acinetobacter_phage	100.0	5.7e-75
WP_000656412.1|3461996_3462287_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	100.0	5.5e-50
WP_002134806.1|3462279_3462603_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	99.1	1.5e-56
WP_001207480.1|3462614_3463736_+	ATP-binding protein	NA	A0A0P0IDZ3	Acinetobacter_phage	100.0	3.0e-213
WP_000698524.1|3463732_3464734_+	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	100.0	1.6e-189
WP_000654796.1|3464735_3464993_+	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	100.0	2.0e-43
WP_000453807.1|3464983_3465193_+	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	100.0	7.4e-33
WP_000048755.1|3465189_3465474_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	100.0	2.3e-45
WP_000005650.1|3465477_3465735_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	100.0	5.9e-48
WP_000910238.1|3465735_3466005_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000773619.1|3466010_3467273_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	100.0	3.8e-249
3475375:3475390	attR	TATTTTTGAAAATTTC	NA	NA	NA	NA
>prophage 1
NZ_CP024125	Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence	110967	0	16619	110967	portal,terminase	Rhizobium_phage(35.71%)	21	NA	NA
WP_000101578.1|545_1043_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_001068664.1|1042_1429_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	32.8	1.6e-12
WP_000494965.1|1425_1776_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.1	2.5e-09
WP_002027131.1|1762_2458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110365.1|2459_3230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000769019.1|3236_3731_-	hypothetical protein	NA	L7TKJ9	Rhizobium_phage	28.7	6.8e-08
WP_001130341.1|3869_4772_-	hypothetical protein	NA	A0A2H4P701	Pseudomonas_phage	58.3	6.9e-91
WP_001131896.1|4907_5786_-	hypothetical protein	NA	A0A2H4P6Z8	Pseudomonas_phage	29.4	7.3e-13
WP_000206081.1|5829_7500_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	51.9	8.1e-146
WP_000764108.1|7545_8790_-|terminase	terminase	terminase	A0A2H4P6Z9	Pseudomonas_phage	62.4	1.3e-151
WP_000134192.1|8799_9405_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	34.3	4.0e-18
WP_000084570.1|9557_9959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002027127.1|10070_10565_-	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	33.9	5.4e-05
WP_001175928.1|10533_10857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416809.1|10847_11801_-	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	42.1	4.6e-61
WP_000184979.1|11839_12262_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000312034.1|12258_12915_-	ATP-binding cassette domain-containing protein	NA	L7TNS9	Rhizobium_phage	54.8	5.9e-60
WP_001292430.1|12914_13565_-	ParB N-terminal domain-containing protein	NA	L7TMF9	Rhizobium_phage	41.9	3.8e-35
WP_000131110.1|13561_14164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000110211.1|14192_14831_-	ParB N-terminal domain-containing protein	NA	L7TL04	Rhizobium_phage	46.1	1.0e-48
WP_000521251.1|14909_16619_+	DEAD/DEAH box helicase	NA	L7TNS5	Rhizobium_phage	46.2	3.4e-131
>prophage 2
NZ_CP024125	Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence	110967	23434	31455	110967	transposase	Synechococcus_phage(40.0%)	8	NA	NA
WP_000401859.1|23434_23683_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	44.8	1.3e-07
WP_000075093.1|23758_24481_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	34.1	4.2e-14
WP_000495140.1|24496_24823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119273.1|25056_25302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001202407.1|26725_27889_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.0	2.2e-09
WP_085942965.1|28690_29854_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	79.2	8.8e-131
WP_001133624.1|30045_30321_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_000842147.1|30342_31455_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	1.2e-31
>prophage 3
NZ_CP024125	Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence	110967	38677	40834	110967	transposase	Vibrio_phage(50.0%)	2	NA	NA
WP_001040034.1|38677_39610_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.1	8.2e-63
WP_000991896.1|39970_40834_-	hypothetical protein	NA	A0A2H4P788	Pseudomonas_phage	29.7	8.8e-11
>prophage 4
NZ_CP024125	Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence	110967	44061	110079	110967	tail,integrase	Pseudomonas_phage(32.26%)	59	49063:49082	104456:104475
WP_000613547.1|44061_44601_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	48.9	2.0e-37
WP_000973813.1|44925_45072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575331.1|45263_45935_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000774949.1|45931_46297_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0S0NAG1	Pseudomonas_phage	63.6	2.8e-35
WP_002017378.1|46289_46547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000047655.1|46577_46805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019929.1|46804_47089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167538.1|47092_48004_-	hypothetical protein	NA	A0A0K2FHE7	Achromobacter_phage	44.4	7.7e-66
WP_023897602.1|48016_49006_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	38.4	2.5e-54
49063:49082	attL	AGTAAGCGCTTACTAATATT	NA	NA	NA	NA
WP_001103335.1|49103_51476_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	50.7	3.1e-207
WP_000030999.1|51497_51878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692605.1|51951_52554_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	42.8	1.1e-31
WP_000192217.1|52685_53522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000698012.1|53614_55555_-	AAA family ATPase	NA	L7TNH6	Rhizobium_phage	42.8	6.4e-118
WP_002017393.1|55554_56670_-	metallophosphoesterase	NA	A0A2H4P756	Pseudomonas_phage	38.1	1.3e-59
WP_000234226.1|57012_57393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000095727.1|57392_57854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000680035.1|57850_58210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433629.1|58297_60496_-	recombinase RecA	NA	J9Q736	Salmonella_phage	50.7	3.6e-53
WP_000429229.1|60498_61536_-	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	36.6	8.8e-50
WP_001099771.1|61598_62459_-	hypothetical protein	NA	A0A2H4P7I7	Pseudomonas_phage	31.5	1.9e-29
WP_000034357.1|62601_63690_-	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	35.3	5.0e-11
WP_000695256.1|63779_65045_-	hypothetical protein	NA	A0A2H4P750	Pseudomonas_phage	38.1	5.9e-72
WP_000432853.1|65041_65617_-	HNH endonuclease	NA	A0A2D1GG92	Gordonia_phage	44.4	2.1e-24
WP_000931856.1|65665_68023_-	DNA polymerase III subunit alpha	NA	L7TNG6	Rhizobium_phage	43.4	4.3e-177
WP_000840050.1|68068_68749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000252084.1|68799_69465_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000063932.1|69489_70734_-	AAA family ATPase	NA	L7TKP0	Rhizobium_phage	41.7	2.4e-86
WP_001005716.1|70878_72801_-	hypothetical protein	NA	A0A2H4P735	Pseudomonas_phage	43.9	3.9e-75
WP_000047261.1|73041_73236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833465.1|73657_74077_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000124736.1|74416_75001_+|integrase	site-specific integrase	integrase	A0A0A8WF93	Clostridium_phage	29.9	4.0e-07
WP_001180910.1|75005_75413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000770709.1|75615_76293_+	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	26.8	2.8e-12
WP_000016664.1|76289_76718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925127.1|76705_77326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497826.1|77398_77971_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	28.5	7.1e-09
WP_001083510.1|78010_79714_-	DNA ligase	NA	A0A2H4P729	Pseudomonas_phage	40.2	2.3e-87
WP_000063348.1|79726_80236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256859.1|80232_80841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082443.1|80834_81326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000053683.1|81325_81880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283392.1|81943_83038_-	DNA primase	NA	A0A2H4P738	Pseudomonas_phage	43.7	1.1e-87
WP_000102028.1|83125_84529_-	DNA helicase	NA	L7TS87	Rhizobium_phage	38.8	4.3e-84
WP_000005905.1|84565_84997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084436.1|85084_85816_-	hypothetical protein	NA	L7TM14	Rhizobium_phage	26.6	1.7e-15
WP_000818857.1|85932_87054_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000097415.1|88057_88696_-	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	65.0	2.0e-68
WP_000138816.1|88695_89088_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	56.2	9.7e-34
WP_001185527.1|89211_89415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281052.1|89547_89799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121317.1|89808_90543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262280.1|90556_90871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992032.1|90871_102055_-|tail	tail protein	tail	A4JX16	Burkholderia_virus	36.4	7.6e-155
WP_000959558.1|102078_102657_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	35.6	2.5e-25
WP_000567460.1|102650_103400_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	40.5	7.8e-48
WP_000504046.1|103396_104092_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	48.0	2.8e-60
WP_000394499.1|104091_104418_-|tail	phage tail protein	tail	D6PGG4	uncultured_phage	31.1	9.0e-09
WP_000896671.1|104490_110079_-|tail	tail length tape measure protein	tail	NA	NA	NA	NA
104456:104475	attR	AGTAAGCGCTTACTAATATT	NA	NA	NA	NA
