The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018637	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861, complete genome	4690881	3110463	3116516	4690881		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|3110463_3110631_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|3110646_3110790_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|3111779_3113702_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|3113719_3113974_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|3113942_3114332_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_038394307.1|3115574_3116516_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.5	4.6e-146
>prophage 2
NZ_CP018637	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861, complete genome	4690881	3352949	3362120	4690881	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|3352949_3353897_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|3353880_3354612_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3354592_3354700_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|3354759_3355491_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|3355713_3357399_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|3357395_3358115_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|3358161_3358629_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|3358685_3359216_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|3359387_3359846_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|3360086_3362120_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP018637	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861, complete genome	4690881	3429317	3439824	4690881		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|3429317_3430721_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|3430898_3431792_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3432168_3433254_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|3433253_3434153_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|3434200_3435079_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|3435079_3435631_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|3435636_3436611_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|3436626_3437400_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|3437404_3438484_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|3438510_3439824_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP018637	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861, complete genome	4690881	3657677	3705325	4690881	plate,protease,tRNA,tail,capsid,terminase,holin,portal,integrase	Salmonella_phage(31.11%)	64	3649755:3649768	3663821:3663834
3649755:3649768	attL	GATTTCAGCGGTAA	NA	NA	NA	NA
WP_000004540.1|3657677_3658784_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476069.1|3658837_3659299_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825951.1|3659310_3659640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065618812.1|3659636_3660302_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444508.1|3660473_3661724_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_001539740.1|3661835_3662963_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	59.2	1.2e-121
WP_000939947.1|3662943_3663189_-	excisionase	NA	NA	NA	NA	NA
WP_038394275.1|3663552_3664380_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	98.9	1.1e-151
3663821:3663834	attR	TTACCGCTGAAATC	NA	NA	NA	NA
WP_000997190.1|3664437_3664809_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_071586821.1|3665349_3665688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023262052.1|3665625_3665934_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
WP_038394274.1|3666265_3666802_+	hypothetical protein	NA	A0A1B5FPB0	Escherichia_phage	31.1	1.8e-14
WP_038394273.1|3666780_3667152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038394271.1|3667692_3668319_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.7e-46
WP_023237927.1|3668420_3668648_+	repressor protein dicC	NA	NA	NA	NA	NA
WP_038394270.1|3668658_3669213_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	71.2	4.4e-72
WP_071842796.1|3669376_3669556_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	7.8e-15
WP_023210476.1|3669545_3670490_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	85.7	1.7e-129
WP_000265003.1|3670449_3670974_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.3	1.7e-94
WP_023210475.1|3670973_3671627_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	88.9	3.2e-114
WP_000779150.1|3671623_3672013_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	86.0	2.4e-61
WP_001061452.1|3672029_3672890_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_038394427.1|3672897_3673887_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	8.3e-191
WP_001047142.1|3673900_3674653_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	6.4e-135
WP_000508329.1|3674832_3675051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658039.1|3675331_3675520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|3675609_3675999_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226307.1|3675985_3676267_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075994.1|3676266_3676881_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.6	2.2e-109
WP_038394268.1|3676877_3677426_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_038394267.1|3677451_3678012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138017660.1|3678152_3678689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143310.1|3679047_3679764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844528.1|3680287_3680878_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	53.7	1.4e-36
WP_020844527.1|3680877_3681423_+	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	37.2	2.6e-16
WP_038394266.1|3681428_3683288_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.5	8.2e-232
WP_021000635.1|3683299_3683539_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
WP_020844525.1|3683535_3685098_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.5	3.2e-189
WP_038394265.1|3685090_3686155_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	50.1	2.0e-81
WP_020844523.1|3686165_3686552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038394264.1|3686567_3687611_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	44.6	5.3e-71
WP_051984978.1|3687611_3688067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038394263.1|3688073_3688418_+	ATP-binding sugar transporter from pro-phage family protein	NA	A0A067ZJA6	Vibrio_phage	45.8	2.4e-20
WP_021000628.1|3688414_3688900_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	36.0	8.4e-19
WP_038394262.1|3688899_3689199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038394261.1|3689198_3690668_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	54.5	5.8e-148
WP_001623391.1|3690680_3691202_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
WP_001623392.1|3691211_3691493_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_077917397.1|3692199_3694104_+|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	26.3	1.1e-42
WP_021000622.1|3694096_3694315_+	hypothetical protein	NA	A0A0C5AEF4	Bacteriophage	50.0	1.4e-10
WP_001623396.1|3694304_3695306_+	phage late control D	NA	A0A0C5AJ59	Bacteriophage	36.3	1.8e-55
WP_038394259.1|3695306_3695927_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
WP_024145350.1|3695923_3696391_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021000619.1|3696387_3696711_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	41.3	6.0e-13
WP_020844514.1|3696707_3697832_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.7	9.4e-90
WP_023220967.1|3697824_3698406_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	34.1	7.7e-19
WP_077917396.1|3699363_3700230_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	91.0	8.7e-152
WP_023220965.1|3700232_3700766_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	82.6	2.7e-79
WP_077917387.1|3700769_3701387_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	88.7	1.1e-100
WP_038394257.1|3701356_3702658_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	87.0	8.1e-210
WP_038394256.1|3702687_3703284_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.0	6.1e-88
WP_001539798.1|3703583_3703892_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	8.4e-25
WP_038394255.1|3703996_3705067_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	60.4	3.3e-116
WP_038394254.1|3705031_3705325_+	Bro-N domain-containing protein	NA	B6SD57	Bacteriophage	54.7	1.0e-19
>prophage 5
NZ_CP018637	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861, complete genome	4690881	4138540	4154484	4690881	tRNA,holin	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|4138540_4138975_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|4139024_4139363_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|4140208_4140754_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|4140750_4141032_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|4141021_4141210_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|4141131_4141527_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|4143697_4144234_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|4144230_4144521_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|4144520_4145120_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|4145643_4145856_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_038394224.1|4146225_4147158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|4147154_4147709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|4147870_4148200_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|4148472_4148940_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|4149324_4149480_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_038394222.1|4149587_4150109_-	membrane protein	NA	NA	NA	NA	NA
WP_000560208.1|4150546_4150768_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|4150852_4151170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|4151197_4151815_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|4152131_4153067_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|4153110_4154484_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP018637	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861, complete genome	4690881	4378915	4395030	4690881	lysis,integrase,tail,holin	Salmonella_phage(30.77%)	16	4375545:4375574	4395166:4395195
4375545:4375574	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|4378915_4379779_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|4382419_4383115_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|4383204_4383738_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|4384632_4385112_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|4385129_4385582_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|4385565_4385895_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|4386170_4386857_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|4387217_4387667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|4388040_4388565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|4388661_4389351_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|4389480_4389708_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|4389704_4390304_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|4390367_4390673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|4391304_4393284_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|4393697_4393976_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|4393950_4395030_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
4395166:4395195	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP018637	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861, complete genome	4690881	4567419	4608117	4690881	protease,tail	Salmonella_phage(30.77%)	39	NA	NA
WP_000938186.1|4567419_4568100_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|4568718_4569378_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|4569464_4569794_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|4569790_4570072_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|4570120_4570900_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|4570925_4571474_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|4571688_4572900_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|4572957_4573275_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|4573319_4573736_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|4573906_4574569_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|4574663_4575122_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|4575157_4577212_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|4577335_4577782_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|4577800_4579954_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|4579940_4580546_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|4580762_4581272_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|4581628_4582681_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|4582752_4583205_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|4583390_4585151_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|4585219_4585738_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|4585837_4586005_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|4586260_4586824_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|4586820_4588461_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|4588465_4589719_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|4589733_4591641_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|4591653_4593762_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|4593860_4594970_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|4594966_4595509_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|4595674_4596685_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|4596892_4599505_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|4599931_4600123_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|4600393_4601080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|4601439_4602066_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_072100753.1|4603907_4604156_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|4604159_4604741_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|4604740_4606450_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|4606446_4607073_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|4607056_4607686_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|4607706_4608117_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP018637	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861, complete genome	4690881	4679395	4686708	4690881	integrase,protease	Ralstonia_phage(16.67%)	7	4674192:4674206	4685444:4685458
4674192:4674206	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|4679395_4679773_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|4679934_4680132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|4680344_4682621_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|4682651_4682972_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|4683295_4683517_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|4683646_4685593_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
4685444:4685458	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|4685589_4686708_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP018639	Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-2, complete sequence	59335	22999	29907	59335	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|22999_23422_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|23421_24696_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_077681951.1|24777_25755_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000427676.1|25751_26957_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|27371_28313_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|28309_28915_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|28971_29307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|29490_29907_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
