The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	143160	242351	4934513	tail,head,protease,tRNA,lysis,integrase,terminase,transposase	Escherichia_phage(13.79%)	119	198254:198268	240191:240205
WP_001221014.1|143160_143856_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|143913_145824_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|145954_146299_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|146304_146484_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978464.1|146564_147929_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
WP_000381544.1|147932_148511_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624277.1|148774_150139_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192525.1|150276_151878_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000421815.1|151899_153459_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150521.1|153931_154900_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|154952_155753_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|155765_156617_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156280.1|156674_157133_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|157542_158109_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_022742705.1|158105_158915_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730322.1|158980_160726_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|160945_161155_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|161167_161311_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|161959_162247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714547.1|162317_162461_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|162618_162858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|163069_163861_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416128.1|164036_165410_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|165457_166339_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|166532_168581_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|168600_169287_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|169384_169969_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|170010_171294_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001535256.1|171262_173896_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001542138.1|173973_175413_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000978525.1|175527_175767_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|175877_176069_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|176087_176738_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|176961_177126_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|177410_178133_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_022742706.1|178816_179212_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.0	6.0e-15
WP_000030934.1|179541_180018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|180405_180825_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|181194_181464_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|181629_181770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|183233_183602_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001233446.1|184905_185820_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|185952_186111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|186120_186735_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000457876.1|187882_188008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|188577_188778_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000275418.1|188874_189756_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|190228_190417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|190481_190649_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|190905_191439_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|191492_191723_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|191912_192407_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|192466_193321_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_022742707.1|194228_195371_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_022742708.1|195633_196533_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_022742709.1|197028_197685_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024150649.1|197685_198381_-	hypothetical protein	NA	NA	NA	NA	NA
198254:198268	attL	GCATTAATGCCAACT	NA	NA	NA	NA
WP_022742711.1|198763_199339_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
WP_022742712.1|199338_200790_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_022742713.1|200779_201382_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_022742714.1|201383_202625_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
WP_001191865.1|202621_202978_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_000122818.1|203647_204517_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|204513_204816_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_022742716.1|204815_205526_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_022742717.1|205522_207694_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228831.1|207677_207860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101348.1|207901_208306_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000016414.1|208305_208752_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_001748488.1|208752_210237_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
WP_000094504.1|210217_210763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748490.1|210747_211113_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_022742718.1|211109_211694_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_023139348.1|211687_212143_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
WP_001748493.1|212149_212497_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_001031915.1|212500_213529_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001525451.1|213528_214011_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_023139349.1|214012_215359_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_000552017.1|215355_216045_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139350.1|216085_217606_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
WP_022742723.1|217605_219027_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_022742724.1|218992_219745_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_001113128.1|219815_219998_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_085983312.1|220223_220664_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
WP_001208103.1|220684_221173_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
WP_001526513.1|221150_221453_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000502119.1|221619_222078_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_022742726.1|222355_222901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|222891_223098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139353.1|223575_224505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139354.1|225053_225395_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_023139355.1|225734_226046_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
WP_021000145.1|226042_226237_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_022742730.1|226233_226833_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_024150651.1|226896_227202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|227394_227547_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_023139357.1|227753_228026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742732.1|228022_228418_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_000140163.1|228430_228892_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_022742734.1|228884_229892_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
WP_001534383.1|229935_230430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|230416_230671_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|230769_231168_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_024135672.1|231598_231778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|232038_232314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|232317_232524_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000799627.1|232599_232935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742735.1|233075_235766_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_001534364.1|235758_236589_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|236624_236945_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_023139358.1|236937_237270_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
WP_023139359.1|237880_238060_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_077907869.1|238350_238587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|238647_238926_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022742740.1|238900_239980_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_000722368.1|240362_240716_-	YebY family protein	NA	NA	NA	NA	NA
240191:240205	attR	AGTTGGCATTAATGC	NA	NA	NA	NA
WP_000979702.1|240732_241608_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|241608_241983_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|242120_242351_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 2
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	317799	396459	4934513	tail,plate,head,protease,holin,integrase,terminase,transposase,portal,capsid	Salmonella_phage(81.16%)	104	324337:324352	398082:398097
WP_000502119.1|317799_318258_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000659236.1|318438_319644_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|319722_321210_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|321466_322870_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|322884_323292_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|323291_323660_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|323731_325216_+	alpha-amylase	NA	NA	NA	NA	NA
324337:324352	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|325255_325681_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|325866_327072_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|327068_327302_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|327566_327953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|328072_328387_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|328603_330286_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|330278_331274_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|331266_331974_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|331973_333344_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|333365_333809_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|333805_335023_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|335127_335595_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|335599_336604_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|336600_337014_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|337013_337391_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|337390_338128_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|338137_338407_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|338415_339210_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|339491_340115_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|340153_340402_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|340476_340704_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|341013_341829_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|341807_343520_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|343684_343930_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|343946_344858_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|345033_345954_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|345942_346413_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|346393_347824_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|347897_348593_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|348684_348984_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|349633_350830_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|351090_351279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|351289_351502_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|351956_353225_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|353227_353647_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|353773_353935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|355128_355341_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|355337_355751_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|355798_355912_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|355986_356220_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|356333_356939_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|356908_358471_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|358457_359045_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|359047_360127_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|360119_360533_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|360537_361071_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|361070_362129_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|362125_363466_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|363499_365428_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000588854.1|365512_365839_-|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
WP_000515952.1|365835_366192_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|366191_367688_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|367677_367842_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|367845_368406_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|368402_368915_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|368886_369291_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|369287_369611_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|369613_369814_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|369864_371070_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|371084_371735_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|371712_372954_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|372953_373136_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|373147_374881_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|374877_375372_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|375497_375848_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|375898_376231_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|376693_377086_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|377082_377697_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|377696_377978_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|377964_378351_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|378496_378754_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|378904_379657_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|379670_380660_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|380667_381528_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|381544_381934_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|381930_382824_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|382823_383306_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|383307_384126_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|384122_384347_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|384343_385501_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|385497_386052_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|386080_386305_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|386402_387098_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|387303_387642_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|387604_387829_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|388368_388740_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|388797_389625_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|389761_390301_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|390371_390905_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|390906_391164_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|391174_391756_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|391759_392329_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|392353_392596_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|392597_393587_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|393878_394676_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|395047_395338_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|395985_396459_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
398082:398097	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 3
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	483164	493670	4934513		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|483164_484478_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|484504_485584_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|485588_486362_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|486358_487351_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|487356_487908_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|487908_488787_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|488834_489734_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|489733_490819_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|491195_492089_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|492266_493670_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 4
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	561978	571149	4934513	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|561978_564012_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|564252_564711_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|564882_565413_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|565469_565937_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|565983_566703_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|566699_568385_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|568607_569339_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|569398_569506_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|569486_570218_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|570201_571149_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 5
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	590387	656782	4934513	holin,lysis,tail	Salmonella_phage(30.0%)	59	NA	NA
WP_000989296.1|590387_591083_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|591236_592121_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|592297_593017_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|593013_593259_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|593463_594705_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|594698_595934_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|596008_597019_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|597034_598555_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|598688_599687_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|600185_601208_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|601357_602500_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|602514_603183_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|603512_604370_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|604358_604748_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|604752_606120_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|606336_607224_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|607256_608579_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|608622_610614_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|610959_612429_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|612618_613482_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|613602_614652_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|614730_615588_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|615652_617341_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|617357_618296_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|618295_619426_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|619794_620976_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|621040_621706_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|621707_621830_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|622217_622472_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|622795_623368_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|623580_624567_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|624596_625316_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|625729_626302_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|626627_628184_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|628290_630096_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|630105_631200_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|631199_632225_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|632226_633816_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|633819_634164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|634554_635745_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|635772_636468_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|636619_638380_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|638504_638789_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|638897_639518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|639545_640553_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|640732_640960_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|640991_642752_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|643032_643536_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|643563_643854_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|644201_646031_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|646084_646528_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|646905_647433_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|647435_648677_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|649269_649599_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|649895_651227_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|651255_651624_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|651638_652628_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001113462.1|655490_655694_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|655990_656782_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 6
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	996367	1101975	4934513	tail,head,holin,tRNA,lysis,integrase,terminase,transposase,portal,capsid	Salmonella_phage(35.0%)	110	1020912:1020928	1109879:1109895
WP_000940032.1|996367_997099_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|997217_998021_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|998165_999044_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|999225_1000269_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|1000272_1001091_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|1001101_1002115_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|1002115_1003102_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|1003092_1003731_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|1003856_1005134_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|1005128_1006268_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|1006463_1007717_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|1008041_1009232_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|1009413_1010958_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|1011318_1012650_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|1012732_1014877_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|1014932_1016393_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|1016441_1016780_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|1016856_1018194_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|1018190_1018955_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|1018956_1020387_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
1020912:1020928	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|1021036_1024924_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|1024945_1025179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|1025179_1026724_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|1026774_1027326_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|1027350_1027986_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|1027989_1029351_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|1029361_1030255_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|1030370_1031219_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|1031257_1032175_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|1032196_1033393_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|1033508_1034435_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|1034472_1034733_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|1034844_1035225_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|1035224_1035956_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|1035967_1036696_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|1036707_1037613_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|1037609_1038290_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|1038563_1039538_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|1039554_1041354_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|1041758_1043252_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_157763123.1|1043624_1043774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542312.1|1043778_1043916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|1044628_1044793_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|1045372_1045438_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|1045500_1045713_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|1045819_1046047_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|1046143_1046722_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|1046711_1047536_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_022742779.1|1047532_1049905_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	65.4	2.0e-89
WP_000178853.1|1049958_1050201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|1050239_1053602_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|1053663_1054311_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|1054208_1054946_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|1054952_1055651_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|1055660_1055990_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_022742781.1|1055992_1059088_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
WP_010989052.1|1059059_1059398_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|1059394_1059790_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|1059840_1060587_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_022742782.1|1060594_1060996_-	hypothetical protein	NA	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000677089.1|1060992_1061571_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|1061557_1061935_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|1061945_1062311_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_022742784.1|1062368_1063397_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000011260.1|1063451_1063799_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|1063811_1065308_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|1065297_1066878_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|1066874_1067078_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623088.1|1067061_1068993_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|1068964_1069510_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|1069795_1070197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603581.1|1070453_1070957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050955063.1|1071284_1071731_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_022742788.1|1071763_1072378_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
WP_021000643.1|1072377_1072659_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294873.1|1072645_1073035_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_023221874.1|1073124_1073313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150660.1|1073839_1074265_-	subtilase	NA	NA	NA	NA	NA
WP_022742790.1|1074397_1075123_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_022742791.1|1075323_1075902_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_050196634.1|1075916_1076906_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_024150661.1|1076913_1077774_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_000767086.1|1077790_1078180_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_024150662.1|1079068_1079551_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
WP_022742797.1|1079552_1080512_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_000620702.1|1080508_1080733_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_031609052.1|1080729_1081872_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_023139406.1|1081868_1082423_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|1082451_1082676_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|1082773_1083469_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000917563.1|1083822_1083981_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|1084002_1084353_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_022742801.1|1084479_1087407_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	98.2	0.0e+00
WP_022742802.1|1087369_1088527_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	4.7e-217
WP_001237031.1|1088569_1088809_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|1088849_1089134_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_022742803.1|1089111_1090341_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	5.4e-232
WP_000589087.1|1090838_1091318_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|1091314_1092271_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|1092270_1092921_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|1092952_1093528_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|1093524_1093689_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_022742804.1|1093952_1095575_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|1095559_1096297_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|1096427_1097762_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|1097779_1098679_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|1098781_1099369_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|1099430_1099814_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|1100132_1100822_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|1100937_1101975_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
1109879:1109895	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 7
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	2740290	2760709	4934513	plate,tail	Burkholderia_phage(47.37%)	25	NA	NA
WP_000587738.1|2740290_2741019_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|2741215_2741506_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|2741754_2742210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|2742206_2742812_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|2742816_2744562_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|2744564_2745197_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|2745189_2746305_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|2746295_2746655_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|2746818_2748366_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|2748365_2749295_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|2749291_2749654_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|2749981_2750704_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|2750713_2751757_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|2751744_2751954_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_001262499.1|2752905_2755260_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|2755356_2755485_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|2755444_2755762_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|2755813_2756338_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|2756337_2757765_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|2757754_2757952_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|2757948_2758404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|2758563_2758878_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|2758890_2759496_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|2759498_2759786_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|2760361_2760709_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 8
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	3540795	3585743	4934513	protease,lysis,integrase,terminase,coat,portal	Enterobacteria_phage(78.12%)	65	3531565:3531581	3594334:3594350
3531565:3531581	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|3540795_3541848_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|3542130_3543234_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|3543245_3544496_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051897.1|3544701_3545865_-|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_155675089.1|3546094_3546235_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000002104.1|3546303_3546588_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000371199.1|3546580_3546865_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_025617570.1|3546864_3547509_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_071533029.1|3547495_3547729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000812203.1|3547725_3548235_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_001214777.1|3548231_3548402_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|3548412_3548706_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|3548752_3549037_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001046968.1|3549036_3549744_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_000156731.1|3549873_3550062_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|3550042_3550201_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000776963.1|3550285_3550600_-	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000713613.1|3550875_3551163_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_015974224.1|3551196_3551841_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000213982.1|3551924_3552119_-	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_001066179.1|3552332_3552920_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000216178.1|3552932_3553235_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_000834175.1|3553598_3553802_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_001532928.1|3553840_3554920_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000712403.1|3555084_3555774_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|3555884_3556100_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|3556210_3556492_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000539342.1|3556674_3557496_+	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001248410.1|3557492_3558869_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_001036030.1|3558865_3559135_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_000736891.1|3559208_3559646_+	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_000113770.1|3559782_3559959_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_001532927.1|3559961_3560303_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950963.1|3560295_3560472_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001108073.1|3560464_3561076_+	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000036320.1|3561072_3561297_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|3561293_3561497_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|3561477_3561657_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|3561653_3562427_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000286100.1|3562857_3563061_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|3563038_3563536_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|3563532_3564000_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_000877028.1|3564212_3564743_+	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_000808099.1|3564965_3565208_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|3565211_3565601_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|3565600_3566005_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|3566008_3566497_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_000417860.1|3566474_3567974_+|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000774652.1|3567973_3570151_+|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000433855.1|3570164_3571076_+	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_001196937.1|3571075_3572368_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|3572408_3572969_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001166103.1|3572952_3573453_+	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_001122420.1|3573412_3574831_+	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_000774917.1|3574834_3575536_+	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_000627593.1|3575535_3575991_+	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000964904.1|3575993_3576683_+	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000246977.1|3576693_3578130_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_001029860.1|3578129_3580106_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_071533035.1|3580244_3580538_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|3580558_3580807_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_000129933.1|3580942_3582946_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000671496.1|3583004_3584462_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|3584451_3585384_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|3585380_3585743_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
3594334:3594350	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 9
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	4178679	4187411	4934513	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|4178679_4179798_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|4179794_4181741_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|4181870_4182092_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|4182415_4182736_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|4182766_4185043_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|4185234_4185693_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_085983316.1|4186155_4187411_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 10
NZ_CP018657	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 chromosome, complete genome	4934513	4237474	4336281	4934513	tail,protease,holin,tRNA,lysis,integrase,terminase,portal	Salmonella_phage(43.4%)	96	4240383:4240402	4312169:4312188
WP_001154025.1|4237474_4238278_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|4238270_4239593_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|4239573_4240278_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022742649.1|4240277_4244744_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
4240383:4240402	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|4245088_4246930_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|4247189_4247738_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|4247765_4248413_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|4248474_4249665_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|4249849_4250941_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|4251547_4252948_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|4253148_4253610_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|4253926_4255141_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000191399.1|4256898_4258101_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|4258295_4259588_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|4259632_4259881_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|4259921_4260161_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|4260203_4261361_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_022742652.1|4261323_4264209_-	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|4264335_4264635_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|4264656_4264815_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_010989002.1|4264807_4265068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|4265117_4265528_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|4265647_4265887_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|4265852_4266227_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|4266311_4267295_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|4267297_4268047_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|4268057_4268405_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|4268401_4268713_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|4268790_4269081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|4269372_4269606_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|4269717_4269939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096552.1|4270832_4271444_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|4271440_4271587_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_022742653.1|4271576_4272374_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
WP_010989004.1|4272440_4272758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|4272931_4273057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|4274001_4274688_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|4274963_4275293_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|4275276_4275729_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|4275746_4276226_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|4276433_4276967_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|4276923_4279062_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|4279058_4279265_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|4279291_4280809_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_001107908.1|4282903_4283227_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|4283219_4283519_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|4283499_4284066_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|4284062_4284464_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|4284475_4285225_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|4285270_4285669_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|4285665_4285995_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|4286074_4289062_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|4289058_4289391_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|4289489_4289987_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|4290103_4290637_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_022742655.1|4290726_4291422_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
WP_000246065.1|4292066_4292771_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_126834981.1|4294625_4296194_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	63.9	1.2e-127
WP_000178849.1|4296232_4296475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742660.1|4296528_4298967_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.7e-91
WP_022742661.1|4298966_4299548_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
WP_001533476.1|4300023_4300992_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|4301639_4302266_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|4302334_4302634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|4302618_4303305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|4303575_4303767_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|4304193_4306806_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_022742665.1|4307013_4308024_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|4308189_4308732_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|4308728_4309838_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|4309936_4312045_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|4312057_4313965_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
4312169:4312188	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|4313979_4315233_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|4315237_4316878_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|4316874_4317438_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|4317693_4317861_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|4317960_4318479_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|4318547_4320308_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|4320493_4320946_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|4321017_4322070_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|4322426_4322936_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|4323152_4323758_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|4323744_4325898_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|4325916_4326363_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|4326486_4328541_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|4328576_4329035_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|4329129_4329792_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|4329962_4330379_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|4330423_4330741_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|4330798_4332010_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|4332224_4332773_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|4332798_4333578_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|4333626_4333908_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|4333904_4334234_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|4334320_4334980_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|4335600_4336281_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 1
NZ_CP018658	Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 plasmid pSE92-0392, complete sequence	94039	70437	79733	94039	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|70437_71118_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|71499_71856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|71848_72319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|72829_73252_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_022743179.1|73251_74526_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
WP_001541561.1|74607_75585_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|75581_76787_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|77201_78143_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|78174_78741_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|78797_79133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|79316_79733_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
