The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018655	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 chromosome, complete genome	4699800	1336570	1347077	4699800		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144951.1|1336570_1337974_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1338151_1339045_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1339421_1340507_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1340506_1341406_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_058106732.1|1341453_1342332_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
WP_000973709.1|1342332_1342884_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1342889_1343864_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1343879_1344653_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1344657_1345737_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1345763_1347077_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 2
NZ_CP018655	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 chromosome, complete genome	4699800	1638421	1682967	4699800	terminase,tail,plate,holin,portal,head,tRNA,capsid,lysis,integrase	Enterobacteria_phage(62.16%)	54	1645709:1645733	1684011:1684035
WP_001144217.1|1638421_1640350_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	5.5e-130
WP_001574431.1|1640353_1640896_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001124225.1|1640991_1641189_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1641239_1641596_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1641716_1641761_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018570.1|1641897_1642881_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672408.1|1642896_1645284_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|1645288_1645588_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1645709:1645733	attL	GGCCGCATTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_023229131.1|1645943_1646084_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	71.7	3.1e-11
WP_024143245.1|1646317_1646578_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_076734539.1|1646632_1647754_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.5	1.1e-149
WP_045900664.1|1647911_1649099_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	4.8e-185
WP_000115856.1|1649099_1649612_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
WP_078057118.1|1649654_1650011_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	3.4e-17
WP_099800470.1|1650016_1650175_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	77.6	6.9e-15
WP_076734538.1|1650161_1653122_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.7	3.4e-256
WP_000980424.1|1653135_1653624_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
WP_058106670.1|1653775_1654642_+	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	91.7	2.2e-147
WP_076734537.1|1654644_1655178_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.9	6.7e-78
WP_078057117.1|1655181_1655799_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	86.7	3.0e-98
WP_076734536.1|1655768_1657817_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	89.8	2.2e-217
WP_058106667.1|1657822_1658350_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	60.6	4.2e-56
WP_045900654.1|1658342_1659239_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.1	1.5e-106
WP_001658912.1|1659225_1659594_-|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	6.5e-40
WP_058106666.1|1659590_1660181_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.6	2.4e-68
WP_048590845.1|1660177_1660813_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	59.8	1.0e-64
WP_058106665.1|1660809_1661256_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.1	2.5e-33
WP_058106664.1|1661242_1661734_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.9	2.7e-33
WP_050154612.1|1661740_1662184_-	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	8.1e-45
WP_001658928.1|1662180_1662519_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_001658929.1|1662548_1662749_-	Tail component protein	NA	A0A0A7NV57	Enterobacteria_phage	80.3	1.9e-22
WP_045900648.1|1662748_1663243_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	60.1	2.2e-51
WP_058106662.1|1663345_1664176_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.5	1.1e-90
WP_058106661.1|1664222_1665308_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	3.8e-136
WP_099800469.1|1665331_1666168_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	2.8e-99
WP_045900644.1|1666324_1668058_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.1	1.7e-263
WP_058106659.1|1668057_1669107_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.9	5.6e-153
WP_153302029.1|1670156_1671872_+	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	54.4	6.4e-138
WP_058106657.1|1672724_1672988_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_048590832.1|1673087_1673501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106656.1|1673493_1675998_-	replication protein	NA	A0A0M4RTM8	Salmonella_phage	47.4	6.0e-177
WP_099800468.1|1675994_1677014_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	67.5	6.7e-127
WP_058106654.1|1677010_1677514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048590829.1|1677507_1678473_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IH14	Erwinia_phage	42.4	3.1e-57
WP_058106653.1|1678469_1678709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106652.1|1678705_1679239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106651.1|1679226_1679484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106650.1|1679480_1679921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023170322.1|1679996_1680188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844112.1|1680157_1680361_-	LapA family protein	NA	NA	NA	NA	NA
WP_058106649.1|1680681_1681080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058343723.1|1681239_1681518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106648.1|1681612_1681924_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	5.4e-19
WP_058106647.1|1682013_1682967_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	48.6	2.0e-77
1684011:1684035	attR	GGCCGCATTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
>prophage 3
NZ_CP018655	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 chromosome, complete genome	4699800	2019748	2030536	4699800	tRNA	Escherichia_phage(72.73%)	15	NA	NA
WP_000640113.1|2019748_2020285_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2020281_2020572_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2020571_2021171_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|2021694_2021907_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|2022276_2023209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2023205_2023760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2023921_2024251_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2024523_2024991_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2025376_2025532_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2025639_2026161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2026598_2026820_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2026904_2027222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2027249_2027867_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2028183_2029119_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2029162_2030536_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 4
NZ_CP018655	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 chromosome, complete genome	4699800	2255134	2271250	4699800	tail,lysis,integrase,holin	Salmonella_phage(28.57%)	17	2251764:2251793	2271386:2271415
2251764:2251793	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|2255134_2255998_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_099828410.1|2255988_2258355_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	67.7	0.0e+00
WP_001152415.1|2258639_2259335_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2259424_2259958_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2260852_2261332_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2261349_2261802_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2261785_2262115_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2262390_2263077_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2263437_2263887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2264260_2264785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2264881_2265571_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2265700_2265928_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_058106734.1|2265924_2266524_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.4	1.4e-95
WP_000972675.1|2266587_2266893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2267524_2269504_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2269917_2270196_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2270170_2271250_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2271386:2271415	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 5
NZ_CP018655	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 chromosome, complete genome	4699800	2443640	2529554	4699800	tRNA,terminase,tail,portal,head,capsid,protease,lysis,integrase	Salmonella_phage(41.38%)	96	2502466:2502481	2527054:2527069
WP_000938186.1|2443640_2444321_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2444939_2445599_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2445685_2446015_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2446011_2446293_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2446341_2447121_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2447146_2447695_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2447909_2449121_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2449178_2449496_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|2449540_2449957_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2450127_2450790_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2450884_2451343_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2451378_2453433_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2453556_2454003_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2454021_2456175_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2456161_2456767_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2456983_2457493_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2457849_2458902_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2458973_2459426_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2459611_2461372_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2461440_2461959_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2462058_2462226_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2462481_2463045_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2463041_2464682_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2464686_2465940_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2465954_2467862_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2467874_2469983_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2470081_2471191_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2471187_2471730_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2471895_2472906_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2473113_2475726_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2476152_2476344_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2476614_2477301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2477285_2477585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2477653_2478280_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_099828411.1|2478927_2479806_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.0	1.6e-172
WP_000143167.1|2480370_2480952_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000178849.1|2483443_2483686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099800437.1|2483724_2484588_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_099800563.1|2484583_2486944_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	67.9	0.0e+00
WP_000246065.1|2487147_2487852_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2487749_2488487_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2488496_2489192_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2489281_2489815_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2489931_2490429_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2490527_2490860_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_001175132.1|2491974_2492277_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	58.6	2.8e-25
WP_000478854.1|2492297_2492687_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	58.9	1.5e-31
WP_000126419.1|2492735_2493488_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	70.0	1.9e-94
WP_001032919.1|2493500_2493902_-	hypothetical protein	NA	A0A291AWY2	Escherichia_phage	59.8	8.1e-44
WP_000053601.1|2493901_2494501_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	68.7	8.3e-69
WP_000083787.1|2494510_2494867_-|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.8e-31
WP_000448213.1|2494877_2495252_-	DNA breaking-rejoining protein	NA	A0A2R9YJP4	Escherichia_phage	34.9	4.8e-06
WP_001048356.1|2495315_2496344_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	58.4	2.4e-108
WP_000143301.1|2496398_2496746_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	4.6e-19
WP_023233092.1|2496745_2498260_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	51.8	2.1e-100
WP_099800436.1|2498249_2499836_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.9e-184
WP_000224407.1|2499832_2500036_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	80.0	1.0e-18
WP_021000150.1|2500019_2501954_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	66.1	7.0e-258
WP_000867564.1|2501925_2502471_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
2502466:2502481	attL	TTTCATAAAAAATTAC	NA	NA	NA	NA
WP_099800562.1|2502939_2503380_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.0	6.2e-53
WP_024798992.1|2503400_2503889_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	1.0e-56
WP_001526513.1|2503866_2504169_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001534381.1|2504371_2504560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051124474.1|2504869_2505550_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	1.4e-59
WP_000801757.1|2505546_2505687_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_051124475.1|2505683_2506295_-	protein ninG	NA	A0A0M4RU10	Salmonella_phage	96.6	7.9e-91
WP_001241019.1|2506297_2506504_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929790.1|2506503_2507106_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2507140_2507389_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2507505_2507739_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000802853.1|2507986_2508313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251218.1|2508406_2508475_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000132543.1|2508455_2509673_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_000974174.1|2509983_2510229_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|2510228_2510549_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000113626.1|2510545_2510893_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000800016.1|2510903_2511653_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	100.0	6.6e-140
WP_099800435.1|2511655_2512711_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	53.2	4.9e-40
WP_072208318.1|2512725_2512914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010835408.1|2513005_2513380_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_051124477.1|2513345_2513582_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	71.8	2.6e-26
WP_015406390.1|2513686_2514082_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_023226317.1|2514151_2515213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038988958.1|2515190_2515562_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-31
WP_000917563.1|2516190_2516349_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|2516370_2516721_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_051124479.1|2516847_2519775_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	98.8	0.0e+00
WP_001539618.1|2519737_2520895_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2520937_2521177_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2521217_2521466_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262311.1|2521510_2522803_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.3e-252
WP_099800434.1|2522997_2524200_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893200.1|2524277_2525714_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544855.1|2525959_2527174_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
2527054:2527069	attR	GTAATTTTTTATGAAA	NA	NA	NA	NA
WP_000762342.1|2527491_2527953_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|2528153_2529554_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
>prophage 6
NZ_CP018655	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 chromosome, complete genome	4699800	2594081	2601394	4699800	protease,integrase	Ralstonia_phage(16.67%)	7	2588879:2588893	2600130:2600144
2588879:2588893	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2594081_2594459_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2594620_2594818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2595030_2597307_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2597337_2597658_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2597981_2598203_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2598332_2600279_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2600130:2600144	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_099800433.1|2600275_2601394_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	0	7073	244210		Salmonella_phage(50.0%)	7	NA	NA
WP_001281654.1|204_1362_-	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
WP_001225593.1|1721_2546_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
WP_001178650.1|2560_3382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682872.1|3664_4372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357614.1|4368_4569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015069.1|4586_5663_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
WP_001282731.1|6197_7073_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
>prophage 2
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	19131	21129	244210		Vibrio_phage(100.0%)	1	NA	NA
WP_001541890.1|19131_21129_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
>prophage 3
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	27704	28712	244210		Aeromonas_phage(100.0%)	1	NA	NA
WP_001278833.1|27704_28712_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	32.1	3.9e-10
>prophage 4
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	31958	32993	244210		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000137273.1|31958_32993_+	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.3	6.7e-42
>prophage 5
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	48816	49476	244210		Escherichia_phage(100.0%)	1	NA	NA
WP_000412211.1|48816_49476_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
>prophage 6
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	52841	53546	244210	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|52841_53546_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	57392	57557	244210		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|57392_57557_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 8
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	62499	63332	244210	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000064919.1|62499_62925_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001541541.1|62981_63332_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 9
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	66392	116452	244210	transposase,integrase	Escherichia_phage(28.57%)	56	65288:65302	91437:91451
65288:65302	attL	CCCGGCCGGTCTGTC	NA	NA	NA	NA
WP_000082169.1|66392_67175_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_099828416.1|67209_67731_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001266176.1|67727_68018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159863.1|68019_68325_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813641.1|68326_68545_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_080199465.1|69220_69742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057493.1|69875_70106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000461382.1|71014_72004_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.9	5.0e-103
WP_015059604.1|72292_72454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751876.1|72506_72893_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
WP_000979451.1|73599_73902_+	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_000748204.1|74176_74701_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001038509.1|77327_78020_+	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_000085742.1|78016_78595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676641.1|78777_79632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004289.1|79891_80104_+	transcriptional regulator PefI	NA	NA	NA	NA	NA
WP_000135399.1|80088_80439_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077907617.1|80682_81339_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_058684844.1|81524_82370_+	YjiK family protein	NA	NA	NA	NA	NA
WP_000725064.1|82459_83017_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
WP_000417897.1|83281_84028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001676666.1|85201_86083_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001541552.1|86063_86141_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_016710725.1|86390_86657_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_077681954.1|86835_87075_-	phospholipase	NA	NA	NA	NA	NA
WP_001676658.1|87031_87316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477657.1|87437_87890_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_016716015.1|89019_89244_-	DUF2689 domain-containing protein	NA	NA	NA	NA	NA
WP_000527901.1|89221_89818_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_000146697.1|89807_91229_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_001230718.1|91228_91969_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
91437:91451	attR	GACAGACCGGCCGGG	NA	NA	NA	NA
WP_000399767.1|91955_92522_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012130.1|92543_92855_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001274199.1|92869_93232_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001676655.1|93273_93501_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_001151546.1|94473_94854_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_015056628.1|95269_95740_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001676653.1|97971_98136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137853.1|98178_99930_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_000925628.1|100200_100623_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|100622_101897_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_099828418.1|101978_102956_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000427676.1|102952_104158_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|104572_105514_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|105510_106116_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|106172_106508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|106691_107108_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001247117.1|107193_108309_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001135409.1|108566_109055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541566.1|109709_110450_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_001240330.1|110656_111217_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
WP_000098781.1|111200_112865_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|113000_113705_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|114289_115150_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|115299_115701_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|115747_116452_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 10
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	126917	168937	244210	transposase,integrase	Salmonella_phage(27.27%)	42	125216:125232	153464:153480
125216:125232	attL	AAAAAGTTACTTTTGCC	NA	NA	NA	NA
WP_016690326.1|126917_128099_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|128313_128526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807689.1|130111_130867_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_000480968.1|133199_134036_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|134035_134839_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_085959879.1|134945_136075_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_000904906.1|136139_136754_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001138082.1|136879_139765_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_016695100.1|140157_140301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|140336_140813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111573.1|140960_141236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|141225_141426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016695101.1|141492_141885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024156253.1|142221_142479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001209044.1|142884_143691_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
WP_011011075.1|143796_144216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010892346.1|144523_144973_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	35.4	5.8e-06
WP_001287388.1|145740_146145_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_016695105.1|146406_146679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024156254.1|146675_147344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062400.1|147851_148307_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000272280.1|148475_148664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010892342.1|148666_149887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323423.1|149941_150145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000529858.1|150158_151478_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_011011077.1|151502_151673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286633.1|151801_153229_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	2.8e-102
WP_000173535.1|153451_153967_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	1.2e-07
153464:153480	attR	AAAAAGTTACTTTTGCC	NA	NA	NA	NA
WP_072075284.1|153963_154896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339175.1|155077_156286_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
WP_000599533.1|156651_157857_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|158300_158621_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001339197.1|158768_159977_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_089508164.1|159951_160338_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_001284954.1|160345_161032_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|161009_161636_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|161714_162920_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|163032_163626_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001339197.1|164139_165348_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001109100.1|165472_166225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011079.1|166432_167041_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000125667.1|167530_168937_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	173009	174305	244210		Burkholderia_virus(100.0%)	1	NA	NA
WP_000193885.1|173009_174305_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.9	1.5e-59
>prophage 12
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	177362	179040	244210		Morganella_phage(50.0%)	2	NA	NA
WP_001395519.1|177362_177797_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	41.1	1.2e-21
WP_000281815.1|177780_179040_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	43.1	9.3e-94
>prophage 13
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	201094	203006	244210		Salinibacter_virus(50.0%)	2	NA	NA
WP_000476771.1|201094_202276_+	S49 family peptidase	NA	A0A2I6UGK8	Salinibacter_virus	31.4	7.8e-10
WP_011011085.1|202292_203006_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.4	5.7e-08
>prophage 14
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	207602	208808	244210		Yersinia_phage(100.0%)	1	NA	NA
WP_000108722.1|207602_208808_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.6	2.6e-13
>prophage 15
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	217889	218864	244210		Salmonella_phage(50.0%)	3	NA	NA
WP_016695123.1|217889_218210_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.0	5.3e-06
WP_000478450.1|218273_218657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010892317.1|218687_218864_-	hypothetical protein	NA	Q71T76	Escherichia_phage	70.3	4.2e-05
>prophage 16
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	226351	226648	244210		Escherichia_phage(100.0%)	1	NA	NA
WP_000581856.1|226351_226648_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
>prophage 17
NZ_CP018656	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence	244210	230275	231567	244210		Escherichia_phage(50.0%)	2	NA	NA
WP_000902167.1|230275_230635_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.9e-08
WP_000178072.1|230862_231567_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	7.1e-11
