The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018645	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 chromosome, complete genome	4684909	2275961	2283274	4684909	integrase,protease	Dickeya_phage(16.67%)	7	2264700:2264714	2283491:2283505
2264700:2264714	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|2275961_2277080_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|2277076_2279023_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|2279152_2279374_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2279697_2280018_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|2280048_2282325_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|2282537_2282735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|2282896_2283274_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
2283491:2283505	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP018645	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 chromosome, complete genome	4684909	2333732	2395248	4684909	tail,protease,tRNA	Salmonella_phage(23.53%)	54	NA	NA
WP_001154025.1|2333732_2334536_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|2334528_2335851_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|2335831_2336536_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|2336535_2341002_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925870.1|2341346_2343197_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|2343456_2344005_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|2344032_2344680_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|2344741_2345932_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|2346116_2347208_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|2347801_2349202_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|2349402_2349864_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544855.1|2350181_2351396_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893200.1|2351641_2353078_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|2353155_2354358_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001676370.1|2354552_2354963_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
WP_000274547.1|2354983_2355613_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001707713.1|2355596_2356175_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	73.4	1.7e-74
WP_000583382.1|2356218_2357928_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|2357927_2358509_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_072100753.1|2358512_2358761_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_016748023.1|2359075_2359954_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.3	2.4e-173
WP_000334547.1|2360601_2361228_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|2361587_2362274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|2362544_2362736_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|2363162_2365775_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291723.1|2365982_2366993_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|2367158_2367701_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|2367697_2368807_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2368905_2371014_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|2371026_2372934_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333139.1|2372948_2374202_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|2374206_2375847_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2375843_2376407_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2376662_2376830_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2376929_2377448_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|2377516_2379277_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2379462_2379915_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|2379986_2381039_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288733.1|2381395_2381905_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|2382121_2382727_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|2382713_2384867_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2384885_2385332_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|2385455_2387510_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|2387545_2388004_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|2388098_2388761_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975204.1|2388931_2389348_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2389392_2389710_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140478.1|2389767_2390979_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|2391193_2391742_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|2391767_2392547_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|2392595_2392877_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904449.1|2392873_2393203_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|2393289_2393949_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938186.1|2394567_2395248_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
>prophage 3
NZ_CP018645	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 chromosome, complete genome	4684909	2567634	2583747	4684909	integrase,lysis,tail,holin	Salmonella_phage(30.77%)	15	2567470:2567499	2587089:2587118
2567470:2567499	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|2567634_2568714_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|2568688_2568967_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|2569380_2571360_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000972675.1|2571991_2572297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|2572360_2572960_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|2572956_2573184_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|2573313_2574003_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|2574099_2574624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|2575806_2576493_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|2576768_2577098_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|2577081_2577534_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|2577551_2578031_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|2578925_2579459_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|2579548_2580244_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_072100756.1|2582883_2583747_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
2587089:2587118	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 4
NZ_CP018645	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 chromosome, complete genome	4684909	2808175	2824119	4684909	holin,tRNA	Escherichia_phage(62.5%)	21	NA	NA
WP_000123686.1|2808175_2809549_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|2809592_2810528_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|2810844_2811462_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|2811489_2811807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2811891_2812113_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|2812550_2813072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085981757.1|2813179_2813335_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|2813719_2814187_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|2814459_2814789_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|2814950_2815505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|2815501_2816434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|2816803_2817016_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000940751.1|2817539_2818139_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|2818138_2818429_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|2818425_2818962_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000900605.1|2821132_2821528_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_001688615.1|2821449_2821638_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|2821627_2821909_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|2821905_2822451_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000159240.1|2823296_2823635_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001082296.1|2823684_2824119_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 5
NZ_CP018645	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 chromosome, complete genome	4684909	3476123	3486629	4684909		Enterobacteria_phage(37.5%)	9	NA	NA
WP_000126349.1|3476123_3477437_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|3477463_3478543_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|3478547_3479321_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000973709.1|3480315_3480867_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|3480867_3481746_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|3481793_3482693_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697848.1|3482692_3483778_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3484154_3485048_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|3485225_3486629_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 6
NZ_CP018645	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 chromosome, complete genome	4684909	3553823	3562994	4684909	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|3553823_3555857_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|3556097_3556556_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|3556727_3557258_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|3557314_3557782_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|3557828_3558548_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3558544_3560230_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|3560452_3561184_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|3561243_3561351_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3561331_3562063_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|3562046_3562994_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 7
NZ_CP018645	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 chromosome, complete genome	4684909	3799424	3805483	4684909		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|3799424_3800366_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|3801607_3801997_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|3801965_3802220_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|3802237_3804160_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|3805149_3805293_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108630384.1|3805231_3805483_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
>prophage 8
NZ_CP018645	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 chromosome, complete genome	4684909	4034300	4134248	4684909	integrase,head,tRNA,plate,capsid,terminase,lysis,portal,transposase,tail	Salmonella_phage(75.47%)	89	4052674:4052688	4133153:4133167
WP_000083345.1|4034300_4035038_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|4035167_4036502_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|4036519_4037419_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|4037521_4038109_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|4038170_4038554_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|4038872_4039562_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|4039677_4040715_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|4040918_4041338_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|4041410_4042091_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082648.1|4042144_4044805_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|4044919_4046275_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|4046319_4046643_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|4046639_4047941_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|4048044_4048500_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
4052674:4052688	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|4054280_4056854_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|4056983_4057715_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|4057711_4058692_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|4058823_4059561_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|4059832_4060171_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|4060274_4060322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200077.1|4060421_4061582_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|4061542_4062451_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|4062508_4063630_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|4063639_4064710_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|4065149_4065668_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|4065660_4066881_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|4067037_4067385_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|4067425_4068193_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|4068237_4068786_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|4068804_4069053_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|4069305_4070667_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|4070832_4071624_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|4071643_4072930_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|4073050_4073656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|4073690_4074281_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|4074404_4075283_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|4075368_4077030_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|4077178_4077517_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|4077682_4077973_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|4077962_4078439_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|4078588_4079071_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237693.1|4079685_4091160_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|4091224_4092634_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|4092630_4094811_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|4094818_4095982_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|4096533_4096752_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|4096820_4097921_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|4097917_4098403_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282768.1|4098399_4101207_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000763316.1|4101199_4101319_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|4101333_4101636_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|4101690_4102206_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|4102215_4103388_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|4103490_4103715_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|4104584_4105160_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001086804.1|4107008_4107614_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|4107606_4108515_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|4108501_4108861_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|4108857_4109436_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|4109513_4110365_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|4110366_4110813_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|4110805_4111237_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|4111332_4111761_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|4111757_4112273_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000868184.1|4112471_4112675_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|4112674_4113139_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|4113232_4113883_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|4113886_4114948_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|4114964_4115798_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|4115940_4117707_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|4117706_4118747_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|4118850_4120515_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|4120828_4121506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217571.1|4121619_4121853_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001154433.1|4121863_4122052_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|4122204_4124619_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|4124615_4125473_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|4125469_4125697_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|4125696_4125930_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|4125997_4126339_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|4126302_4126503_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|4126510_4127020_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|4127053_4127296_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|4127417_4128050_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|4128052_4129069_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|4129621_4130284_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|4130545_4131139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|4131537_4132341_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|4133136_4134248_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
4133153:4133167	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
>prophage 1
NZ_CP018646	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence	54796	0	12383	54796	transposase	Enterobacteria_phage(42.86%)	7	NA	NA
WP_001143760.1|706_3712_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|3875_4433_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|4615_5476_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001323889.1|5752_7330_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001161490.1|7639_8200_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|8203_11170_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000731968.1|11849_12383_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	2.0e-21
>prophage 2
NZ_CP018646	Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence	54796	26034	41862	54796	protease,transposase	Burkholderia_phage(37.5%)	12	NA	NA
WP_085959879.1|26034_27164_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_000904897.1|27194_27818_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_099807431.1|27943_30829_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.8	2.4e-190
WP_001694850.1|30903_31545_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000844102.1|31549_31747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288435.1|32132_33566_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_000583524.1|35051_35648_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	7.1e-36
WP_000359513.1|37591_38311_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.4	3.9e-20
WP_000057569.1|38870_39212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001452808.1|39226_40018_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000457702.1|40168_41434_-	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	54.0	3.4e-120
WP_000861760.1|41421_41862_-	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
